HYDROGEN acid Molecules Structural Archive and Gallery

Acid carbonate Bicarbonate C00288 HCO3- Hydrogencarbonate

463-79-6 C01353 Carbonic acid Dihydrogen carbonate H2CO3
pdb file: 4484.pdb
sdf file: 4484.sdf
directory: 4484

C06399 Hydrogenobyrinate Hydrogenobyrinic acid
pdb file: 8379.pdb
sdf file: 8379.sdf
directory: 8379

C06503 Hydrogenobyrinate a,c diamide Hydrogenobyrinate diamide Hydrogenobyrinic acid a,c-diamide
pdb file: 8472.pdb
sdf file: 8472.sdf
directory: 8472

3-Carbomethoxypropanoic acid 3878-55-5 Butanedioic acid, monomethyl ester Methyl hydrogen succinate Monomethyl succinate NSC511 Succinic acid monomethyl ester Succinic acid, monomethyl ester
pdb file: 50461.pdb
sdf file: 50461.sdf
directory: 50461

2-Methyl-2-thiopseudourea sulfate 2-Methyl-2-thiopseudourea sulfate (2:1) 867-44-7 Carbamimidothioic acid, methyl ester, sulfate (2:1) Methylthiopseudourea sulfate NSC516 Pseudourea, 2-methyl-2-thio-, hydrogen sulfate Pseudourea, 2-methyl-2-thio-, sulfate (2:1) S-Methylisothiourea hemisulfate S-Methylisothiourea sulfate (2:1) S-Methylthiouronium sulfate (2:1) Usaf ek-1231
pdb file: 50466.pdb
sdf file: 50466.sdf
directory: 50466

3658-48-8 Bis(2-ethylhexyl) hydrogen phosphite Bis(2-ethylhexyl) phosphite Bis(2-ethylhexyl) phosphonate Di-2-ethylhexyl phosphite Diisooctyl phosphite NSC2664 Phosphonic acid, bis(2-ethylhexyl) ester Phosphorous acid, bis(2-ethylhexyl) ester
pdb file: 52332.pdb
sdf file: 52332.sdf
directory: 52332

762-04-9 Diethoxyphosphine oxide Diethyl acid phosphite Diethyl hydrogen phosphite Diethyl phosphite Diethyl phosphonate Ethyl phosphonate ((EtO)2HPO) Hydrogen diethyl phosphite NSC2665 O,O-Diethyl phosphonate Phosphonic acid diethyl ester Phosphonic acid, diethyl ester Phosphorous acid, diethyl ester WLN: 2OPQO2
pdb file: 52333.pdb
sdf file: 52333.sdf
directory: 52333

1809-19-4 Butyl alcohol, hydrogen phosphite Butyl phosphonate ((BuO)2HPO) DIBUTYL PHOSPHITE Di-n-butyl hydrogen phosphite Dibutoxyphosphine oxide Dibutyl hydrogen phosphite Dibutyl hydrogen phosphonate Dibutyl phosphonate NSC2668 Phosphonic acid, dibutyl ester Phosphorous acid, dibutyl ester WLN: 4OPQO4
pdb file: 52336.pdb
sdf file: 52336.sdf
directory: 52336

813-78-5 Dimethyl hydrogen phosphate Dimethyl phosphate Methyl phosphate ((MeO)2(HO)PO) NSC2676 O,O-Dimethyl phosphate Phosphoric acid, dimethyl ester
pdb file: 52344.pdb
sdf file: 52344.sdf
directory: 52344

3037-89-6 Dioctadecyl hydrogen phosphate Dioctadecyl orthophosphate Dioctadecyl phosphate Distearyl acid phosphate Distearyl phosphate NSC2681 Phosphated stearyl alcohol Phosphoric acid, dioctadecyl ester
pdb file: 52347.pdb
sdf file: 52347.sdf
directory: 52347

1-Propanol, 2,3-dibromo-, dihydrogen phosphate 2,3-Dibromopropyl dihydrogen phosphate 5324-12-9 Mono(2,3-dibromopropyl)phosphate Mono(2,3-dibromopropyl)phosphoric acid NSC2862 Phosphoric acid mono(2,3-dibromopropyl) ester Phosphoric acid, mono-(2,3-dibromopropyl) ester WLN: QPQO&O1YE1E
pdb file: 52501.pdb
sdf file: 52501.sdf
directory: 52501

1-Propanol, 2,3-dibromo-, hydrogen phosphate 5412-25-9 Bis(2,3-dibromopropyl) hydrogen phosphate Bis(2,3-dibromopropyl)phosphate Bis(2,3-dibromopropyl)phosphoric acid NSC3239
pdb file: 52807.pdb
sdf file: 52807.sdf
directory: 52807

1,2-Benzenedicarboxylic acid, monoethenyl ester, homopolymer 29382-68-1 NSC5269 Phthalic acid, monovinyl ester, polymers Poly(hydrogen vinyl phthalate) Poly(vinyl hydrogen phthalate) Vinyl hydrogen phthalate polymer Vinyl hydrogen phthalate polymers
pdb file: 54454.pdb
sdf file: 54454.sdf
directory: 54454

838-85-7 Diphenyl hydrogen phosphate Diphenyl phosphate NSC6518 Phenyl hydrogen phosphate Phenyl phosphate ((PhO)2(HO)PO) Phenyl phosphate, ((PhO)2(HO)PO) Phosphoric acid, diphenyl ester
pdb file: 55533.pdb
sdf file: 55533.sdf
directory: 55533

2582-30-1 Aminoguanidine bicarbonate Aminoguanidine carbonate (1:1) Aminoguanidine hydrocarbonate Aminoguanidine hydrogen carbonate Aminoguanidinium bicarbonate Aminoguanidium hydrogen carbonate Ba 51-090222 Carbonic acid, compd. with aminoguanidine (1:1) Carbonic acid, compd. with hydrazinecarboximidamide (1:1) N1-Aminoguanidine carbonate (1:1) NSC7887
pdb file: 56699.pdb
sdf file: 56699.sdf
directory: 56699

1,2-Benzenedicarboxylic acid, monomethyl ester 4376-18-5 D 3 D 3 (ester) Methyl hydrogen phthalate Methyl phthalate Monomethyl 1,2-benzenedicarboxylate Monomethyl phthalate NSC8281 Phthalic acid, monomethyl ester o-(Methoxycarbonyl)benzoic acid
pdb file: 57023.pdb
sdf file: 57023.sdf
directory: 57023

1,2-Benzenedicarboxylic acid, monobutyl ester 131-70-4 Butyl hydrogen phthalate Mono-n-butyl phthalate Monobutyl phthalate NSC8479 Phthalic acid, monobutyl ester
pdb file: 57221.pdb
sdf file: 57221.sdf
directory: 57221

626-86-8 Adipic acid, monoethyl ester Ethyl hydrogen adipate Hexanedioic acid, monoethyl ester Monoethyl adipate NSC8877
pdb file: 57538.pdb
sdf file: 57538.sdf
directory: 57538

.alpha.-Glycerophosphate .alpha.-Glycerophosphoric acid .alpha.-Phosphoglycerol 1,2,3-Propanetriol, 1-(dihydrogen phosphate) 1-Glycerophosphate 1-Glycerophosphoric acid 3-Glycerophosphate 57-03-4 GLYCEROPHOSPHATE Glycerol .alpha.-phosphate Glycerol 1-phosphate Glycerol 3-phosphate Glycerol, 1-(dihydrogen phosphate) Glycerophosphoric acid NSC9231
pdb file: 57797.pdb
sdf file: 57797.sdf
directory: 57797

627-91-8 Adipic acid monomethyl ester Adipic acid, monomethyl ester Hexanedioic acid, monomethyl ester Methyl adipate Methyl hemiadipate Methyl hydrogen adipate Monomethyl adipate NSC9389
pdb file: 57932.pdb
sdf file: 57932.sdf
directory: 57932

2-Butenedioic acid (Z)-, monomethyl ester 2-Butenedioic acid, monomethyl ester 3052-50-4 Hydrogen methyl maleate Maleic acid, monomethyl ester Methyl hydrogen maleate Monomethyl maleate NSC11205
pdb file: 76247.pdb
sdf file: 76247.sdf
directory: 76247

2-Butenedioic acid (Z), monoethyl ester 2-Butenedioic acid (Z)-, monoethyl ester 3990-03-2 Ethyl hydrogen maleate Maleic acid, monoethyl ester Monoethyl maleate NSC11206
pdb file: 76248.pdb
sdf file: 76248.sdf
directory: 76248

7057-92-3 Di-n-dodecyl phosphate Didodecyl hydrogen phosphate Didodecyl phosphate Didodecylphosphoric acid Dilauryl acid phosphate Dilauryl phosphate Dodecyl phosphate ((C12H25O)2(HO)PO) ELA NSC12427 Ortholeum 162 Phosphoric acid, didodecyl ester
pdb file: 77130.pdb
sdf file: 77130.sdf
directory: 77130

1-Hexadecanol, hydrogen phosphate 2197-63-9 Dicetyl hydrogen phosphate Dicetyl phosphate Dicetylphosphoric acid Dihexadecyl hydrogen phosphate Dihexadecyl phosphate NSC12429
pdb file: 77132.pdb
sdf file: 77132.sdf
directory: 77132

107-56-2 Diisopropyl phosphorodithioate Isopropyl aerofloat NSC15258 O,O-Diisopropyl dithiophosphate O,O-Diisopropyl dithiophosphoric acid O,O-Diisopropyl hydrogen phosphorodithioate O,O-Diisopropyl phosphorodithioate O,O-Diisopropylphosphorodithioic acid Phosphorodithioic acid, O,O-bis(1-methylethyl) ester Phosphorodithioic acid, O,O-diisopropyl ester
pdb file: 79175.pdb
sdf file: 79175.sdf
directory: 79175

5'-AMP 5'-Adenylic acid 61-19-8 9H-Purine, 6-amino-9-.beta.-D-ribofuranosyl-, 5'-phosphate A 5MP ADENYLIC ACID, YEAST AMP AMP (nucleotide) Adenosine 5'-(dihydrogen phosphate) Adenosine 5'-monophosphate Adenosine 5'-monophosphoric acid Adenosine 5'-phosphate Adenosine 5'-phosphoric acid Adenosine Phosphate Adenosine monophosphate Adenosine, mono(dihydrogen phosphate) (ester) Adenovite Adenylic acid Cardiomone Lycedan Muscle adenylic acid My-B-Den NSC20264 Phosaden Phosphentaside
pdb file: 82892.pdb
sdf file: 82892.sdf
directory: 82892

54812-66-7 Benzoic acid, 4-amino-, 2-(diethylamino)ethyl ester, phosphate (1:1) NSC30375 Procaine dihydrogen phosphate Procaine phosphate
pdb file: 89625.pdb
sdf file: 89625.sdf
directory: 89625

6274-05-1 NSC35732 Naphtho[2,3-d]-1,3-dioxole-6-carboxylic acid, 5,6,7,8-tetrahydro-8-hydroxy-7-(hyddroxymethyl)-5-(3,4,5-trimethoxyphenyl)-, .gamma.-lactone, hydrogen succinate compd. with isopropylamine Podophyllotoxin, hydrogen succinate, compd. with isopropylamine
pdb file: 92652.pdb
sdf file: 92652.sdf
directory: 92652

47798-20-9 6267-85-2 Component CAS registry number(s): 75-31-0 Glutaric acid (8CI), monoester with podophyllotoxin, compd. with isopropylamine (1:1) NSC36570 Naphtho[2,3-d]-1,3-dioxole-6-carboxylic acid, 5,6,7,8-tetrahydro-8-hydroxy-7-(hydroxymethyl)-5-(3,4,5-trimethoxyphenyl)-, .gamma.-lactone, hydrogen glutarate compd. with isopropylamine Podophyllotoxin, hydrogen glutarate, compd. with isopropylamine
pdb file: 93184.pdb
sdf file: 93184.sdf
directory: 93184

812-00-0 Dihydrogen methyl phosphate Methyl dihydrogen phosphate Methyl phosphate, (MeO)(HO)2PO Monomethyl dihydrogen phosphate Monomethyl phosphate NSC41908 O-Methyl phosphate Phosphoric acid, monomethyl ester
pdb file: 96605.pdb
sdf file: 96605.sdf
directory: 96605

1623-06-9 Monopropyl phosphate NSC41909 Phosphoric acid, monopropyl ester Propyl hydrogen phosphate Propyl phosphate Propyl phosphate, (PrO)(HO)2PO
pdb file: 96606.pdb
sdf file: 96606.sdf
directory: 96606

1623-24-1 Dihydrogen isopropyl phosphate Isopropyl acid phosphate Isopropyl acid phosphate solid Isopropyl alcohol, monophosphated Isopropyl dihydrogen phosphate Isopropyl hydrogen phosphate Isopropyl phosphate Isopropyl phosphate, (C3H7O)(HO)2PO Isopropyl phosphoric acid Monoisopropyl phosphate NSC41910 Phosphoric acid, isopropyl ester Phosphoric acid, mono(1-methylethyl) ester Phosphoric acid, monoisopropyl ester WLN: QPQO&OY1&1
pdb file: 96607.pdb
sdf file: 96607.sdf
directory: 96607

1623-15-0 Butyl diacid phosphate Butyl dibasic acid phosphate Butyl dihydrogen phosphate Butyl phosphate, (BuO)(HO)2PO Monobutyl phosphate Monobutylphosphoric acid NSC41911 Phosphoric acid, monobutyl ester n-Butylphosphate
pdb file: 96608.pdb
sdf file: 96608.sdf
directory: 96608

2382-76-5 Amyl dihydrogen phosphate Monoamyl phosphate Monopentyl phosphate NSC41913 Pentyl dihydrogen phosphate Pentyl phosphate, (C5H11O)(OH)2PO Phosphoricacid, monopentyl ester
pdb file: 96610.pdb
sdf file: 96610.sdf
directory: 96610

(2-Ethylhexyl)orthophosphate 1070-03-7 2-Ethylhexyl dihydrogen phosphate 2-Ethylhexyl phosphate Ethylhexyl acid phosphate Mono(2-ethylhexyl)phosphate NSC41916 Phosphoric acid, mono(2-ethylhexyl) ester
pdb file: 96613.pdb
sdf file: 96613.sdf
directory: 96613

2627-35-2 Dihydrogen monolauryl phosphate Lauryl dihydrogen phosphate Monododecyl phosphate Monolauryl phosphate NSC41919 Phosphoric acid, monododecyl ester
pdb file: 96615.pdb
sdf file: 96615.sdf
directory: 96615

2958-09-0 Dihydrogen monooctadecyl phosphate Monooctadecyl orthophosphate Monooctadecyl phosphate Monostearyl acid phosphate Monostearyl dihydrogen phosphate Monostearyl phosphate NSC41920 Octadecyl phosphate Phosphoric acid, monooctadecyl ester Stearyl acid phosphate
pdb file: 96616.pdb
sdf file: 96616.sdf
directory: 96616

21302-09-0 Di-n-Dodecyl phosphite Didodecyl phosphite Dilauryl hydrogen phosphite Dilauryl phosphite Dodecyl phosphite, (C12H25O)2HPO NSC41924 Phosphonic acid, didodecyl ester
pdb file: 96619.pdb
sdf file: 96619.sdf
directory: 96619

4712-55-4 Diphenoxyphosphine oxide Diphenyl hydrogen phosphite Diphenyl phosphite Diphenyl phosphonate NSC43786 Phenyl phosphonate ((PhO)2HPO) Phenyl phosphonate, (PhO)2HPO Phosphonic acid, diphenyl ester Phosphorous acid, diphenyl ester
pdb file: 98109.pdb
sdf file: 98109.sdf
directory: 98109

693-55-0 Decanedioic acid, monoethyl ester Ethyl hydrogen sebacate Ethyl sebacate Monoethyl sebacate NSC53961 Sebacic acid, monoethyl ester
pdb file: 104305.pdb
sdf file: 104305.sdf
directory: 104305

627-91-8 Adipic acid monomethyl ester Adipic acid, monomethyl ester Hexanedioic acid, monomethyl ester Methyl adipate Methyl hemiadipate Methyl hydrogen adipate Monomethyl adipate NSC55113
pdb file: 104932.pdb
sdf file: 104932.sdf
directory: 104932

1-Hexanol, 3,5,5-trimethyl-, hydrogen phosphate 7153-98-2 NSC58150 Phosphoric acid, bis(3,5,5-trimethylhexyl) ester WLN: 1X1&1&1Y1&2OPQO&O2Y1&1X1&1&1
pdb file: 106922.pdb
sdf file: 106922.sdf
directory: 106922

645-15-8 BNPP Bis(4-nitrophenyl) phosphate Bis(p-nitrophenyl) phosphate Di-p-nitrophenyl phosphate NSC59824 Phosphoric acid bis(p-nitrophenyl ester) Phosphoric acid bis(p-nitrophenyl) ester Phosphoric acid, bis(4-nitrophenyl) ester Phosphoric acid, bis(p-nitrophenyl) ester p-Nitrophenyl monohydrogen phosphate
pdb file: 107903.pdb
sdf file: 107903.sdf
directory: 107903

2104-19-0 8-Carbomethoxyoctanoic acid Azelaic acid monomethyl ester Azelaic acid, monomethyl ester Methyl hydrogen azelate Monomethyl azelate Monomethyl nonanedioate NSC60226 Nonanedioic acid, monomethyl ester
pdb file: 108265.pdb
sdf file: 108265.sdf
directory: 108265

(2-Ethylhexyl)orthophosphate 1070-03-7 2-Ethylhexyl dihydrogen phosphate 2-Ethylhexyl phosphate Ethylhexyl acid phosphate Mono(2-ethylhexyl)phosphate NSC62313 Phosphoric acid, mono(2-ethylhexyl) ester
pdb file: 109468.pdb
sdf file: 109468.sdf
directory: 109468

1,2,4-Dithiazolidine-3-thione, 5-imino- 3H-1,2,4-Dithiazole-3-thione, 5-amino- 5-Imino-1,2,4-dithiazolidine-3-thione 6846-35-1 Isoperthiocyanic acid NSC65248 WLN: T5MYSSYJ BUS EUM Xanthane hydride Xanthanohydrogen
pdb file: 110722.pdb
sdf file: 110722.sdf
directory: 110722

3115-39-7 Di(octyl) hydrogen phosphate Dioctyl phosphate Dioctylorthophosphate NSC70167 Octyl phosphate, (C8H17O)2(HO)PO Phosphoric acid, dioctyl ester
pdb file: 113702.pdb
sdf file: 113702.sdf
directory: 113702

2'-Deoxy-5'-adenylic acid 2'-Deoxy-AMP 2'-Deoxyadenosine 5'-monophosphate 2'-Deoxyadenosine 5'-phosphate 2'-Deoxyadenosine monophosphate 2'-Deoxyadenylic acid 2'-dAMP 5'-Adenylic acid, 2'-deoxy- 653-63-4 Adenosine, 2'-deoxy-, 5'-(dihydrogen phosphate) Adenosine, 2'-deoxy-, 5'-phosphoric acid Deoxy-5'-adenylic acid Deoxy-AMP Deoxyadenosine 5'-monophosphate Deoxyadenosine 5'-phosphate Deoxyadenosine monophosphate Deoxyadenylic acid NSC77680 PdA dAMP
pdb file: 118435.pdb
sdf file: 118435.sdf
directory: 118435

1-Diethylcarbamoyl-4-methylpiperazine dihydrogen citrate 1-Methyl-4-diethylcarbamoylpiperazine citrate 1-Piperazinecarboxamide, N,N-diethyl-4-methyl-, 2-hydroxy-1,2,3-propanetricarboxylate (1:1) 1-Piperazinecarboxamide, N,N-diethyl-4-methyl-, citrate (1:1) 1642-54-2 Banocide Carbam Palatabs Caricide Caritrol Cypip D.E.C. Sol DEC Chewable Dek-Tabs Dicarocide Diethylcarbamazane citrate Diethylcarbamazine Acid Citrate Diethylcarbamazine citrate Diethylcarbamazine dihydrogen citrate Diethylcarbamazine hydrogen citrate Diethylcarbamazine, citrate Diro-Form Eosinopin Ethodryl citrate Filazine Franocide Franozan Hetrazan Loxuran N,N-Diethyl-4-methyl-1-piperazinecarboxamide citrate N,N-Diethyl-4-methyl-1-piperazinecarboxamide dihydrogen citrate NSC80513 WLN: T6N DNTJ AVN2&2 D1 &OV1XQVO&1VO
pdb file: 119897.pdb
sdf file: 119897.sdf
directory: 119897

1-Isonicotinyl-2-isopropylhydrazine phosphate 1-Isopropyl-2-isonicotinylhydrazine phosphate 305-33-9 4-Pyridinecarboxylic acid, 2-(1-methylethyl)hydrazide, phosphate (1:1) Iproniazid dihydrogen phosphate Iproniazid phosphate Iproniazide phosphate Isonicotinic acid, 2-isopropylhydrazide, phosphate Isonicotinic acid, 2-isopropylhydrazide, phosphate (1:1) Isoproniazid phosphate Marsilid phosphate NSC81850
pdb file: 120750.pdb
sdf file: 120750.sdf
directory: 120750

1809-20-7 Diisopropyl hydrogen phosphite Diisopropyl hydrogen phosphonate Diisopropyl phosphite Diisopropyl phosphonate Diisopropylphosphine oxide Isopropyl phosphonate ((C3H7O)2HPO) NSC82344 O,O-Diisopropyl phosphonate Phosphonic acid, bis(1-methylethyl) ester Phosphonic acid, diisopropyl ester WLN: 1Y1&OPHO&OY1&1
pdb file: 121046.pdb
sdf file: 121046.sdf
directory: 121046

2'-Deoxy-5'-adenylic acid 2'-Deoxy-AMP 2'-Deoxyadenosine 5'-monophosphate 2'-Deoxyadenosine 5'-phosphate 2'-Deoxyadenosine monophosphate 2'-Deoxyadenylic acid 2'-dAMP 5'-Adenylic acid, 2'-deoxy- 653-63-4 Adenosine, 2'-deoxy-, 5'-(dihydrogen phosphate) Adenosine, 2'-deoxy-, 5'-phosphoric acid Deoxy-5'-adenylic acid Deoxy-AMP Deoxyadenosine 5'-monophosphate Deoxyadenosine 5'-phosphate Deoxyadenosine monophosphate Deoxyadenylic acid NSC82625 PdA dAMP
pdb file: 121179.pdb
sdf file: 121179.sdf
directory: 121179

2'-Deoxy-5'-guanylic acid 2'-Deoxy-GMP 2'-Deoxyguanosine 5'-monophosphate 2'-Deoxyguanosine 5'-phosphate 2'-Deoxyguanosine 5'-phosphoric acid 2'-Deoxyguanosine 5'MP 2'-Deoxyguanylic acid 2'-dGMP 5'-DGMP 5'-Deoxyguanylic acid 5'-Guanylic acid, 2'-deoxy- 902-04-5 DGMP Deoxy GMP Deoxy-GMP Deoxyguanosine 5'-monophosphate Deoxyguanosine 5'-phosphate Deoxyguanosine monophosphate Deoxyguanylic acid Guanosine, 2'-deoxy-, 5'-(dihydrogen phosphate) Guanosine, 2'-deoxy-, 5'-phosphoric acid NSC82626
pdb file: 121180.pdb
sdf file: 121180.sdf
directory: 121180

1,4-Benzenedicarboxylic acid, monomethyl ester 1679-64-7 4-Methoxycarbonylbenzoic acid Hydrogen methyl terephthalate Methyl hydrogen terephthalate Monomethyl terephthalate NSC210838 Terephthalic acid, monomethyl ester
pdb file: 126490.pdb
sdf file: 126490.sdf
directory: 126490

116-49-4 Amoebicon Arsanilic acid, N-glycoloyl-, bismuth deriv Bismuth glycolyl arsanilate Bismuth p-glycolylaminophenylarsonate Bismuth p-glycolylarsanilate Bismuth, (hydrogen N-glycoloylarsanilato)oxo- Bismuth, [[4-[(hydroxyacetyl)amino]phenyl]arsonato(1-)]oxo- Bismuthoxy-p-N-glycolylarsanilate Bismuthyl N-glycolylarsanilate Broxolin Chemo Puro Dysentulin Glycobiarsol Milibis NSC221709 Viasept Wintodon [[4-[(HYDROXYACETYL)AMINO]PHENYL]ARSONATO(1-)OXOBISMUTH
pdb file: 130484.pdb
sdf file: 130484.sdf
directory: 130484

83-86-3 Alkalovert Fytic acid Inositol hexaphosphate Inositol, hexakis(dihydrogen phosphate), myo- NSC269896 Phytic acid myo-Inosistol hexakisphosphate myo-Inositol hexaphosphate myo-Inositol, hexakis(dihydrogen phosphate)
pdb file: 140932.pdb
sdf file: 140932.sdf
directory: 140932

2-(3-Aminopropylamino)ethyl thiophosphate 20537-88-6 AU-95722 Amifostine Aminopropylaminoethyl thiophosphate Ethanethiol, 2-[(3-aminopropyl)amino]-, dihydrogen phosphate (ester) Ethanethiol, S-[(3-aminopropyl)amino]-, dihydrogen phosphate- (ester) Ethiofos Gammaphos NSC296961 Phosphorothioic acid, S-[2-[(3-aminopropyl)amino]ethyl] ester Phosphorothioic acid, S-[2-[(3-aminopropyl)amino]ethyl]ester S-(2-(3-Aminopropylamino)ethyl) phosphorothioate S-[2-(3-Aminopropylamino)ethyl] phosphorothioate S-[2-[(3-Aminopropyl)amino]ethyl] dihydrogen phosphorothioate SAPEP WR 2721 WR 2721C
pdb file: 147094.pdb
sdf file: 147094.sdf
directory: 147094

L-Glutamic acid, 5-[[1-[4-[(3-amino-2,3,6-trideoxy-.alpha.-L-lyxo-hexopyranosyl)oxy]-1,2,3,4,6,11-hexahydro-2,5,12-trihydroxy-7-methoxy-6,11-dioxo-2-naphthacenyl]ethylidene]-hydrazide, (2S-cis)-, polymer with N-[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]-L-glutamine and 5-(phenylmethyl)hydrogen L-glutamate NSC301185
pdb file: 148194.pdb
sdf file: 148194.sdf
directory: 148194

(-)-Noradrenaline ( )-bitartrate (-)-Norepinephrine bitartrate (-)-R-Norepinephrine bitartrate 1,2-Benzenediol, 4-((1R)-2-amino-1-hydroxyethyl)-, (2R,3R)-2,3-dihydroxybutanedioate (1:1) (salt) 1,2-Benzenediol, 4-(2-amino-1-hydroxyethyl)-, (R)-, (R-(R*,R*))-2,3-dihydroxybutanedioate (1:1) 2477-42-1 24868-01-7 33404-26-1 350-25-4 51-40-1 51-41-2 73-98-3 893-91-4 Arterenol bitartrate BENZYL ALCOHOL, alpha-(AMINOMETHYL)-3,4-DIHYDROXY-, (-)-, TARTRATE (1:1) Benzyl alcohol, alpha-(aminomethyl)-3,4-dihydroxy-, (-)-, tartrate (1:1) (salt) EINECS 200-095-0 L-Noradrenaline bitartrate Levarterenol bitartrate Levophed bitartrate NSC 169106 Noradrenalin bitartrate Noradrenalin bitartrate, l- Noradrenaline acid tartrate Noradrenaline bitartrate Noradrenaline hydrogen tartrate Noradrenaline tartrate Noradrenaline, tartrate (1:1) Norartrinal bitartrate Norepinephrine bitartrate anhydrous Norepinephrine hydrogen tartrate Norepinephrine tartrate l-Arterenol bitartrate l-Arterenol d-bitartrate l-Noradrenaline d-bitartrate l-Noradrenaline tartrate l-Norepinephrine bitartrate
pdb file: 148605.pdb
sdf file: 148605.sdf
directory: 148605

(-)-3,4-Dihydroxy-alpha-((methylamino)methyl)benzyl alcohol (+)-tartrate (1:1) salt (-)-Adrenaline acid tartrate (-)-Adrenaline bitartrate (-)-Adrenaline hydrogen tartrate (-)-Adrenaline tartrate (-)-Epinephrine (+)-bitartrate (-)-Epinephrine bitartrate (R)-(-)-Epinephrine bitartrate 1,2-Benzenediol, 4-(1-hydroxy-2-(methylamino)ethyl)-, (R)-, (R-(R*,R*))-2,3-dihydroxybutanedioate (1:1) (salt) 1,2-Benzenediol, 4-(1-hydroxy-2-(methylamino)ethyl)-, (theta)-, (theta-(theta,theta))-2,3-dihydroxybutanedioate (1:1) (salt) 16536-89-3 3506-10-3 51-42-3 5502-52-3 8028-06-6 Adrenaline acid tartrate Adrenaline acid tartrate, l- Adrenaline bitartrate Adrenaline hydrogen tartrate Asmatane Mist Asthmahaler Benzyl alcohol, 3,4-dihydroxy-alpha-((methylamino)methyl)-, (-)-, tartrate (1:1), (+)- Bronitin Mist Bronkaid Mist Suspension E-Pilo EINECS 200-097-1 EPINEPHRINE TARTRATE Epinephrine bitartrate Epinephrine bitartrate [USAN:JAN] Epinephrine d-bitartrate Epinephrine hydrogen tartrate Epitrate L-Adrenaline tartrate Medihaler-Epi Primatene Mist Suspension Suprarenin l-Adrenaline bitartrate l-Adrenaline d-bitartrate l-Adrenaline hydrogen tartrate l-Epinephrine bitartrate l-Epinephrine d-bitartrate
pdb file: 148607.pdb
sdf file: 148607.sdf
directory: 148607

1,1'-Pentamethylenebis(1-methylpyrrolidinium hydrogen tartrate) 1,1'-Pentamethylenebis(1-methylpyrrolidinium tartrate) 52-62-0 56614-93-8 Ansolysen Ansolysen bitartrate Ansolysen tartrate Butanoic acid, 2,3-dihydroxy- (2R,3R)-, ion(1-), 1,1'-(1,5-pentanediyl)bis(1-methylpyrrolidinium) (2:1) EINECS 200-146-7 MB 2050A PENTOLINIUM TARTRATE Pendine Pentalinium tartrate Pentamethylene-1,5-bis(1'-methylpyrrolidinium tartrate) Pentapyrrolidium bitartrate Pentilium Pentolinio tartrato [DCIT] Pentolinium bitartrate Pentolinium ditartrate Pentolinium tartrate [BAN] Pentolonii tartras [INN-Latin] Pentolonium tartrate Pyrrolidinium 1,1'-(1,5-pentanediyl)bis-(1-methyl-, (R-(R*,R*))-2,3-dihydroxybutanedioate Pyrrolidinium, 1,1'-(1,5-pentanediyl)bis(1-methyl-, salt with (R-(R*,R*))-2,3-dihydroxybutanedioic acid (1:2) Pyrrolidinium, 1,1'-pentamethylenebis(1-methyl-, tartrate (1:2) Recuryl Tartaric acid, ion(1-), 1,1'-pentamethylenebis(1-methylpyrrolidinium) (2:1) Tartrate de pentolonium [INN-French] Tartrato de pentolonio [INN-Spanish] Tensilest
pdb file: 148656.pdb
sdf file: 148656.sdf
directory: 148656

((o-Carboxyphenyl)thio)ethylmercury sodium salt 11004-81-2 113170-85-7 130995-49-2 2141-27-7 23065-35-2 25948-50-9 54-64-8 77536-61-9 8030-32-8 8030-33-9 Aeroaid spray CCRIS 4839 Caswell No. 766 Collyrium Eye Wash EINECS 200-210-4 EPA Pesticide Chemical Code 078901 Elcide 73 Elcide 75 Elicide Estivin Ethyl (sodium o-mercaptobenzoato)mercury Ethyl(2-mercaptobenzoato-S)mercury sodium salt Ethyl(2-mercaptobenzoato-S)mercury, sodium salt Ethylmercurithiosalicyclic acid, sodium salt Ethylmercurithiosalicylate sodium Ethylmercurithiosalicylate sodium salt Ethylmercurithiosalicylic acid sodium salt Ethylmerkurithiosalicilan sodny [Czech] HSDB 7151 MERTHIOLATE Mercurate(1-), ethyl(2-(mercapto-kappaS)benzoato(2-)-kappaO)-, sodium Mercurate(1-), ethyl(2-mercaptobenzoate(2-)-O,S)-, sodium salt Mercurate(1-), ethyl(2-mercaptobenzoato(2-)-O,S)-, sodium Mercurate(1-), ethyl(o-mercaptobenzoato(2-))-, sodium Mercurothiolate Mercurothiolatum Mercury, ((o-carboxyphenyl)thio)ethyl-, sodium salt Mercury, ethyl (2-mercaptobenzoato-S)-, sodium salt Mercury, ethyl(2-mercaptobenzoate-S)-, sodium salt Mercury, ethyl(2-mercaptobenzoato-S)-, sodium salt Mercury, ethyl(hydrogen o-mercaptobenzoato)-,
pdb file: 148720.pdb
sdf file: 148720.sdf
directory: 148720

151-16-6 18144-22-4 2-(2-Aminoethyl)-2-thiopseudourea dihydrobromide 2-(2-Aminoethyl)-2-thiopseudourea hydrobromide 2-(beta-Aminoethyl)isothiouronium bromide hydrobromide 2-Aminoethylisothiouronium dibromide 2-Aminoethylisothiuronium bromide hydrobromide 2-Aminoethylisothiuronium dihydrobromide 2-Aminoethylthiopseudourea dihydrobromide 2141-04-0 2beta-Aminoethylisothiourea-bromide-hydrogen bromide 56-10-0 63680-10-4 63680-11-5 63680-12-6 63680-13-7 871-25-0 927-71-9 A 15591 A. E. T. AET AI3-23427 Aminoethylisothiuronium bromide hydrobromide Antirad Antiradon Carbamimidothioic acid, 2-aminoethyl ester, dihydrobromide EINECS 200-257-0 Isothiuronium bromide, aminoethyl-, hydrobromide Ixecur NSC 22877 Pseudourea, (2-aminoethyl)-2-thio-, dihydrobromide S-(2-Aminoaethyl)isothiuronium dibromid [German] S-(2-Aminoethyl)isothiuronium dibromide S-(2-Aminoethyl)pseudothiourea dihydrobromide S-2-Aminoethylisothiouronium bromide hydrobromide S-2-Aminoethylthiouronium bromide hydrobromide S-Aminoethylisothiuronium bromide hydrobromide S-beta-Aminoethylisothiuronium bromohydrate Surrectan USAF XR-31 beta-Aminoaethyl-isothiuronium dihydrobromid [German] beta-Aminoethylisothiouronium bromide hydrobromide
pdb file: 148763.pdb
sdf file: 148763.sdf
directory: 148763

10168-83-9 16488-07-6 5'-Atp 51569-41-6 56-65-5 71800-44-7 84412-18-0 9-beta-D-Arabinofuranosyladenine 5'-triphosphate ADENOSINE-5'-PHOSPHATE ATP ATP (nucleotide) Adenosine 5'-(tetrahydrogen triphosphate) Adenosine 5'-triphosphate Adenosine 5'-triphosphoric acid Adenosine triphosphate Adenosine, 5'-(tetrahydrogen triphosphate) Adenosintriphosphorsaeure Adenylpyrophosphoric acid Adephos Adetol Ado-5'-P-P-P Adynol Ara-ATP Atipi Atriphos EINECS 200-283-2 Glucobasin Myotriphos Striadyne Triadenyl Triphosaden Triphosphaden Triphosphoric acid adenosine ester
pdb file: 148785.pdb
sdf file: 148785.sdf
directory: 148785

1,2,3-Propanetriol, 1-(dihydrogen phosphate) 1-Glycerophosphate 1-Glycerophosphoric acid 126-95-4 1509-81-5 1555-56-2 17603-42-8 2,3-Hydroxy-1-propyl dihydrogen phosphate 28917-82-0 3-Glycerophosphate 57-03-4 626-73-3 927-20-8 EINECS 200-307-1 GLYCEROL-3-PHOSPHATE Glycerol alpha-phosphate Glycerol, 1-(dihydrogen phosphate) (8CI) Glycerophosphoric acid NSC 9231 alpha-Glycerophosphoric acid alpha-Phosphoglycerol
pdb file: 148805.pdb
sdf file: 148805.sdf
directory: 148805

4-26-00-03629 (Beilstein Handbook Reference) 5'-Adenylphosphoric acid 5'-Adp 58-64-0 84412-16-8 ADENOSINE, 5'-(TRIHYDROGEN PYROPHOSPHATE) ADP ADP (nucleotide) Adenosindiphosphorsaeure Adenosine 5'-(trihydrogen diphosphate) Adenosine 5'-diphosphate Adenosine 5'-diphosphoric acid Adenosine 5'-pyrophosphate Adenosine 5'-pyrophosphoric acid Adenosine diphosphate Adenosine diphosphoric acid Adenosine pyrophosphate Adenosine-5'-diphosphat Adenosine-5'-diphosphate Ado-5'-P-P BRN 0067722 EINECS 200-392-5
pdb file: 148877.pdb
sdf file: 148877.sdf
directory: 148877

5'-UMP 5'-URIDYLIC ACID 5-24-06-00173 (Beilstein Handbook Reference) 53624-79-6 58-97-9 81795-92-8 BRN 0047486 EINECS 200-408-0 UMP UMP (nucleic acid) Uridine 5'-(dihydrogen phosphate) Uridine 5'-monophosphate Uridine 5'-phosphate Uridine 5'-phosphoric acid Uridine monophosphate Uridine phosphate Uridylic acid
pdb file: 148891.pdb
sdf file: 148891.sdf
directory: 148891

(4-Carboxylatophenyl)chloromercurate(1-), hydrogen (4-Carboxyphenyl)chloromercury 107296-30-0 130973-93-2 136969-76-1 139116-12-4 145757-52-4 172906-39-7 4-Carboxyphenylmercuric chloride 4-Chloromercuribenzoic acid 4-Chloromercuriobenzoic acid 59-85-8 75344-65-9 77329-67-0 92421-68-6 AI3-15315 Benzoic acid, p-(chloromercuri)- Chloromercuribenzoate Chloromercuribenzoic acid EINECS 200-442-6 Mercurate(1-), (4-carboxylatophenyl)chloro-, hydrogen Mercury, (4-carboxyphenyl)chloro- Mercury, (p-carboxyphenyl)chloro- NSC 32866 P-(CHLOROMERCURI)BENZOIC ACID PCMB USAF D-3 p-Carboxyphenylmercuric chloride p-Chlormercuribenzoic acid p-Chloro-mercuric benzoic acid p-Chloromercuribenzoic acid p-Chloromercurybenzoic acid
pdb file: 148919.pdb
sdf file: 148919.sdf
directory: 148919

11002-78-1 3',5'-AMP 37839-81-9 4-26-00-03618 (Beilstein Handbook Reference) 60-92-4 Adenosine 3',5'-cyclic monophosphate Adenosine 3',5'-cyclophosphate Adenosine 3',5'-monophosphate Adenosine 3',5'-phosphate Adenosine 3',5'-phosphate monohydrate Adenosine cyclic 3',5'-monophosphate Adenosine cyclic 3',5'-phosphate Adenosine cyclic monophosphate Adenosine, cyclic 3',5'-(hydrogen phosphate) BRN 0052645 CCRIS 4291 CYCLIC-3',5'-(HYDROGEN PHOSPHATE)ADENOSINE EINECS 200-492-9 NSC 94017 cAMP cyclic 3',5'-AMP cyclic 3',5'-Adenylic acid cyclic AMP cyclic Adenosine 3',5'-monophosphate cyclic Adenosine 3',5'-phosphate
pdb file: 148964.pdb
sdf file: 148964.sdf
directory: 148964

162756-82-3 4-26-00-03615 (Beilstein Handbook Reference) 47286-65-7 47287-97-8 5'-AMP 5'-Adenylic acid 53624-78-5 61-19-8 67583-85-1 A5MP ADENOSINE 5'-PHOSPHATE AMP AMP (VAN) AMP (nucleotide) Adenosine 5'-(dihydrogen phosphate) Adenosine 5'-monophosphate Adenosine 5'-monophosphoric acid Adenosine 5'-phosphoric acid Adenosine monophosphate Adenosine phosphate Adenosine phosphate [USAN:BAN:INN] Adenosine, mono(dihydrogen phosphate) (ester) Adenosine-5-monophosphoric acid Adenosini phosphas [INN-Latin] Adenovite Adenylic acid Adenylic acid (VAN) BRN 0054612 Cardiomone EINECS 200-500-0 Ergadenylic acid Fosfato de adenosina [INN-Spanish] HSDB 3281 Lycedan Monophosphadenine Muscle adenylic acid Muskeladenosin-phosphorsaeure Muskeladenylsaeure My-B-Den Myoston NSC 20264 NSC-20264 Phosaden Phosphaden Phosphate d'adenosine [INN-French] Phosphentaside Vitamin B8
pdb file: 148970.pdb
sdf file: 148970.sdf
directory: 148970

162756-87-8 1beta-Ribofuranosylcytosine 5'-phosphate, d- 293738-08-6 4-25-00-03673 (Beilstein Handbook Reference) 5'-CMP 5'-CYTIDYLIC ACID 55679-92-0 63-37-6 BRN 0046982 CMP (nucleotide) Cytidine 3'-(dihydrogen phosphate) Cytidine 5'-(dihydrogenphosphate) Cytidine 5'-monophosphate Cytidine 5'-monophosphoric acid Cytidine 5'-phosphate Cytidine 5'-phosphoric acid Cytidine monophosphate Cytidylic acid EINECS 200-556-6
pdb file: 149026.pdb
sdf file: 149026.sdf
directory: 149026

4-25-00-03675 (Beilstein Handbook Reference) 5'-CDP 63-38-7 BRN 0063920 CDP CYTIDINE, 5'-(TRIHYDROGEN PYROPHOSPHATE) Cytidine 5'-(trihydrogen diphosphate) Cytidine 5'-diphosphate Cytidine 5'-diphosphoric acid Cytidine 5'-pyrophosphate Cytidine 5'-pyrophosphoric acid Cytidine coenzyme Cytidine diphosphate Cytidine-5'-diphosphate EINECS 200-557-1
pdb file: 149027.pdb
sdf file: 149027.sdf
directory: 149027

4-24-00-01222 (Beilstein Handbook Reference) 5'-UTP 63-39-8 BRN 0071520 EINECS 200-558-7 URIDINE 5'-TRIPHOSPHATE UTP Uridine 5'-(tetrahydrogen triphosphate) Uridine 5'-triphosphoric acid Uridine triphosphate Uteplex
pdb file: 149028.pdb
sdf file: 149028.sdf
directory: 149028

141-53-7 15843-02-4 15907-03-6 27115-36-2 3349-06-2 3495-35-0 3495-36-1 4464-23-7 540-69-2 544-17-2 544-18-3 544-19-4 556-63-8 557-39-1 557-41-5 590-29-4 592-89-2 63182-21-8 64-18-6 68134-59-8 68310-83-8 70179-79-2 7056-83-9 7360-53-4 8006-93-7 811-54-1 82069-14-5 992-98-3 AI3-24237 Acide formique [French] Acido formico [Italian] Add-F Ameisensaeure [German] Aminic acid Bilorin C1 acid CCRIS 6039 Collo-bueglatt Collo-didax EINECS 200-579-1 EPA Pesticide Chemical Code 214900 FEMA No. 2487 FORMIC ACID Formic acid (natural) Formic acid [UN1779] [Corrosive] Formira Formisoton Formylic acid HSDB 1646 Hydrogen carboxylic acid Kwas metaniowy [Polish] Kyselina mravenci [Czech] Methanoic acid Mierenzuur [Dutch] Myrmicyl RCRA waste no. U123 RCRA waste number U123 Spirit of formic acid UN1779
pdb file: 149047.pdb
sdf file: 149047.sdf
directory: 149047

65-31-6 EINECS 200-607-2 HSDB 806 NICOTINE TARTRATE NSC 97238 Nicotine acid tartrate Nicotine bitartrate Nicotine dihydrogen ditartrate Nicotine ditartrate Nicotine hydrogen tartarate Nicotine hydrogen tartrate Nicotine tartrate (VAN) Nicotine tartrate [UN1659] [Poison] Nicotine tartrate dihydrate Nicotine, tartrate (1:2) Nicotine-D-bitartrate Nikotinbitartrat [German] Pyridine, 3-(1-methyl-2-pyrrolidinyl)-, (S)-, (R-(R*,R*))-2,3-dihydroxybutanedioate (1:2) Pyridine, 3-(1-methyl-2-pyrrolidinyl)-, (S)-, (R-(R*,R*))-2,3-dihydroxybutanedioate (1:2) (9CI) Tartrate de nicotine [French] UN1659
pdb file: 149076.pdb
sdf file: 149076.sdf
directory: 149076

4-25-00-03676 (Beilstein Handbook Reference) 5'-CTP 65-47-4 BRN 0071190 CTP CYTIDINE, 5'-(TETRAHYDROGEN TRIPHOSPHATE) Cytidine 3'-triphosphate Cytidine 5'-(tetrahydrogen triphosphate) Cytidine 5'-triphosphoric acid Cytidine triphosphate Cytidine-5'-triphosphate Deoxycytosine triphosphate EINECS 200-611-4
pdb file: 149079.pdb
sdf file: 149079.sdf
directory: 149079

75-13-8 Hydrogen isocyanide ISOCYANATE Isocyanic acid
pdb file: 149292.pdb
sdf file: 149292.sdf
directory: 149292

159457-40-6 19803-43-1 512-42-5 562-54-9 75-93-4 EINECS 200-916-2 MONOMETHYL SULFATE Methoxysulfonic acid Methyl hydrogen sulphate Methyl sulfate Methylsulfuric acid Sulfuric acid, monomethyl ester
pdb file: 149359.pdb
sdf file: 149359.sdf
directory: 149359

50762-79-3 78039-41-5 83-86-3 Acide fytique [INN-French] Acido fitico [INN-Spanish] Acidum fyticum [INN-Latin] Alkalovert Alkovert CCRIS 4513 EINECS 201-506-6 Fytic acid Hexakis(dihydrogen phosphate) myo-inositol (9CI) INOSITOL, HEXAKIS(DIHYDROGEN PHOSPHATE), myo- Inosithexaphosphorsaure [German] Inositol hexaphosphate NSC 269896 Phytate Phytic acid Saure des phytins [German] myo-Inosistol hexakisphosphate myo-Inositol hexaphosphate myo-Inositol, hexakis(dihydrogen phosphate)
pdb file: 149744.pdb
sdf file: 149744.sdf
directory: 149744

5'-GTP 86-01-1 BRN 1201437 EINECS 201-647-3 GTP GUANOSINE TRIPHOSPHATE Guanosine 5'-(tetrahydrogen triphosphate) Guanosine 5'-triphosphate Guanosine 5'-triphosphoric acid
pdb file: 149830.pdb
sdf file: 149830.sdf
directory: 149830

(2-Hydroxyethyl)trimethylammonium bitartrate 2-Hydroxy-N,N,N-trimethylethanaminium 2,3-dihydroxybutanedioate, (R-(R*,R*))- 36231-32-0 56614-94-9 87-67-2 Butanedioic acid, 2,3-dihydroxy- (R-(R*,R*))-, ion(1-), 2-hydroxy-N,N,N-trimethylethanaminium CHOLINE BITARTRATE Choline bitartrate, anhydrous Choline hydrogen tartrate Choline tartrate Choline, tartrate (1:1) Choline, tartrate (1:1) salt EINECS 201-763-4 Ethanaminium, 2-hydroxy-N,N,N-trimethyl-, salt with (2R,3R)-2,3-dihydroxybutanedioic acid (1:1) Ethanaminium, 2-hydroxy-N,N,N-trimethyl-, salt with (R-(R*,R*))-2,3-dihydroxybutanedioic acid (1:1) Ethanaminium, 2-hydroxy-N,N,N-trimethyl-, salt with (theta-(theta,theta))-2,3-dihydroxybutanedioic acid (1:1) HSDB 983 Tartaric acid, ion(1-), choline
pdb file: 149905.pdb
sdf file: 149905.sdf
directory: 149905

(Orthoborato(3-)-O)phenylmercurate(2-), dihydrogen 102-98-7 Boric acid, phenylmercury deriv. Caswell No. 656C Dihydrogen (orthoborato(3-)-O)phenylmercurate(2-) EINECS 203-068-1 EPA Pesticide Chemical Code 066005 Exomycol gel Famosept Fenosept Formasept Mercurate(2-), (orthoborato(3-)-O)phenyl-, dihydrogen Mercurate(2-), (orthoborato(3-)-O)phenyl-, dihydrogen (9CI) Mercurate(2-), (orthoboroato(3-)-O)phenyl, dihydrogen Mercury, (dihydrogen borato)phenyl- Mercury, (dihydrogen orthoborato)phenyl- (8CI) Mercury, (orthoborato(1-)-O)phenyl- Merfen Merphen Metasol BT NSC 163948 PHENYLMERCURIC BORATE PMB PMB (VAN) Phenyl mercuric borate Phenylmercuriborate Phenylmercuric borate (VAN) Phenylmercury borate Ryfen Spidox Spidoxol
pdb file: 150710.pdb
sdf file: 150710.sdf
directory: 150710

107-56-2 15874-48-3 27205-99-8 2929-95-5 32474-89-8 39384-04-8 7481-27-8 Aerofloat 211 CP 41348 Diisopropyl phosphorodithioate EINECS 203-503-5 HSDB 5379 Isopropyl aerofloat Isopropyl phosphorodithioate (6CI,7CI) NSC 15258 O,O-Bis(1-methylethyl) phosphorodithioate O,O-DIISOPROPYL DITHIOPHOSPHATE O,O-Diisopropyl dithiophosphoric acid O,O-Diisopropyl hydrogen dithiophosphate O,O-Diisopropyl hydrogen phophorothioate O,O-Diisopropyl hydrogen phosphorodithioate O,O-Diisopropyl phosphorodithioate O,O-Diisopropylphosphorodithioic acid Phosphorodithioic acid, O,O-bis(1-methylethyl) ester Phosphorodithioic acid, O,O-diisopropyl ester Phosphorodithioic acid, O,O-diisopropyl ester (8CI)
pdb file: 150983.pdb
sdf file: 150983.sdf
directory: 150983

107-66-4 16298-74-1 25238-98-6 35837-53-7 38491-08-6 4-01-00-01530 (Beilstein Handbook Reference) 72283-56-8 AI3-07849 BRN 0607224 DIBUTYL PHOSPHATE DP 4 (coupling agent) Di-n-butyl hydrogen phosphate Di-n-butyl phosphate Di-n-butylphosphoric acid Dibutyl acid phosphate Dibutyl hydrogen phosphate EINECS 203-509-8 HSDB 2513 Phosphoric acid, dibutyl ester
pdb file: 150987.pdb
sdf file: 150987.sdf
directory: 150987

(Hydrogen N-glycoloylarsanilato)oxobismuth 116-49-4 Amoebicon Arsanilic acid, N-glycoloyl-, bismuth deriv Bismuth glycollylarsanilate Bismuth glycolyl arsanilate Bismuth p-glycolylaminophenylarsonate Bismuth p-glycolylarsanilate Bismuth, ((4-((hydroxyacetyl)amino)phenyl)arsonato(1-))oxo- Bismuth, (hydrogen N-glycoloylarsanilato)oxo- (8CI) Bismuthoxy-p-N-glycolylarsanilate Bismuthyl N-glycolylarsanilate Broxolin Chemo Puro Dysentulin EINECS 204-143-1 GLYCOBIARSOL Glicobiarsol [INN-Spanish] Glycobiarsol [INN] Glycobiarsolum [INN-Latin] Milibis NSC 221709 Viasept Wintodon
pdb file: 151450.pdb
sdf file: 151450.sdf
directory: 151450

117-68-0 3'-GUANYLIC ACID 6027-83-4 97416-83-6 EINECS 204-202-1 Guanosine 3'-(dihydrogen phosphate)
pdb file: 151480.pdb
sdf file: 151480.sdf
directory: 151480

1,2,3,4-Tetrahydro-2-methyl-1,4-dioxo-2-naphthalenesulfonic acid sodium salt 130-36-9 130-37-0 2,3-Dihydro-2-methyl-1,4-naphthoquinone-2-sulfonate sodium 2-Methyl-1,4-naphthoquinone sodium bisulfite 2-Methyl-1,4-naphthoquinone sodium hydrogen sulfite 2-Methylnaphthoquinone sodium hydrogen sulfite 2-Naphthalenesulfonic acid, 1,2,3,4-tetrahydro-2-methyl-1,4-dioxo-, sodium salt 8012-53-1 8017-97-8 8028-24-8 8053-08-5 Bisulfite sodique de menadione [INN-French] Bisulfito sodico de menadiona [INN-Spanish] CCRIS 7112 Dohyfral EINECS 204-987-0 Golagen K Hemoklot Hetroge K premix Hetrogen K Hykinone Ido-K K-Trombina Kalzon Kavitamin Kavitan Kawitan Klotogen Klotogen F Klotogen F 16 Klotogen F 227 MENADIONE SODIUM SULFONATE MSBC Menachinonum natrium bisulfurosum Menadione sodio bisolfito [DCIT] Menadione sodium bisulfite Menadione sodium bisulfite anhydrous Menadione sodium hydrogen sulfite Menadioni natrii bisulfis [INN-Latin] Menadioni natrii hydrogensulfis Menaphthone sodium bisulfite
pdb file: 151696.pdb
sdf file: 151696.sdf
directory: 151696

1,4-NAPHTHALENEDIOL, 2-METHYL-, BIS(DIHYDROGEN PHOSPHATE), TETRASODIUM 1,4-Naphthalenediol, 2-methyl-, bis(dihydrogen phosphate), tetrasodium salt 1,4-Naphthalenediol, 2-methyl-, diphosphate, tetrasodium salt 131-13-5 1:4-Naphthaquinol-bisdisodium phosphate 2-Methyl-1,4-naphthaquinol bis(disodium phosphate) 2-Methyl-1,4-naphthohydroquinone diphosphoric acid ester tetrasodium salt 84-98-0 EINECS 205-012-1 Kappadione Kipca water soluble Menadiol sodium diphosphate Menadiol sodium diphosphate anhydrous [USAN] Menadiol tetrasodium diphosphate Menadione diphosphate tetrasodium salt Menadione sodium phosphate Phosphoric acid, diester with 2-methyl-1,4-naphthalenediol, tetrasodium salt Procoagulo Sodium menadione diphosphate Synkavit Synkavite Synkayvite Tetrasodium 2-methyl-1,4-naphthahydroquinone diphosphoric acid ester Tetrasodium 2-methyl-1,4-naphthalenediol bis(dihydrogen phosphate) Tetrasodium 2-methyl-1,4-naphthalenediol diphosphate Tetrasodium 2-methyl-1,4-naphthohydroquinone diphosphate Tetrasodium 2-methyl-1,4-naphthylenebis(phosphate) Thylokay
pdb file: 151711.pdb
sdf file: 151711.sdf
directory: 151711

1,2-Benzenedicarboxylic acid, monobutyl ester 131-70-4 4-09-00-03175 (Beilstein Handbook Reference) 5423-38-1 AI3-01768 BRN 2051402 Butyl hydrogen phthalate EINECS 205-036-2 MBP MONOBUTYL PHTHALATE Mono-n-butyl phthalate NSC 8479 Phthalic acid, monobutyl ester
pdb file: 151730.pdb
sdf file: 151730.sdf
directory: 151730

125685-10-1 138-15-8 2-Aminopentanedioic acid hydrochloride 56-86-0 Acidalin Acidogen Acidoride Acidothyn Acidulin Aciglumin Acigluminum Aclor Antalka DRG-0194 EINECS 205-315-9 Feracid Flamithin Flanithin GLUTAMIC ACID HYDROCHLORIDE Gastuloric Glusatin Glutamic acid hydrogen chloride Glutamic acid, L-, hydrochloride Glutamic acid, hydrochloride, L- Glutamidin Glutamidine Glutan hcl Glutan hydrochloride Glutan-HCl Glutasin HSDB 490 Hydrionic Hypochylin L-Glutamic acid monohydrochloride L-Glutamic acid, hydrochloride Muriamic NSC 9239 Pepsdol alpha-Aminopentanedioic acid, hydrochloride, L-
pdb file: 151893.pdb
sdf file: 151893.sdf
directory: 151893

(Ethylenedinitrilo)-tetraacetic acid disodium salt 104244-09-9 139-33-3 1892-64-4 37341-71-2 42615-28-1 60-00-4 69772-70-9 ACETIC ACID, (ETHYLENEDINITRILO)TETRA-, DISODIUM SALT AI3-18049 CBC 50152966 CCRIS 3658 Cheladrate Chelaplex III Chelaton 3 Chelaton III Chelest 200 Chelest B Clewat N Complexon III DR-16133 Dinatrium ethylendiamintetraacetat [Czech] Diso-Tate Disodium (ethylenedinitrilo)tetraacetate Disodium (ethylenedinitrilo)tetraacetic acid Disodium EDTA Disodium N,N'-1,2-ethanediylbis(N-(carboxymethyl)glycine) Disodium diacid ethylenediaminetetraacetate Disodium dihydrogen ethylenediaminetetraacetate Disodium dihydrogen(ethylenedinitrilo)tetraacetate Disodium edathamil Disodium edetate Disodium edta, anhydrous Disodium ethylenediamine-N,N,N',N'-tetraacetate Disodium ethylenediaminetetraacetate Disodium ethylenediaminetetraacetic acid Disodium salt of EDTA Disodium sequestrene Disodium tetracemate Disodium versenate Disodium versene Dotite 2NA E.D.T.A. disodique [French] EDTA disodium EDTA disodium salt EINECS 205-358-3 Edathamil disodium Edetate
pdb file: 151915.pdb
sdf file: 151915.sdf
directory: 151915

140-45-4 Allegan Arsanilic acid, N-glycoloyl-, monosodium salt Arsonic acid, (4-((hydroxyacetyl)amino)phenyl)-, monosodium salt (9CI) EINECS 205-415-2 Quarcyl SODIUM GLYCARSAMIDE Sodium N-glycolylarsanilate Sodium hydrogen (4-((hydroxyacetyl)amino)phenyl)arsonate Sodium p-N-glycolylarsanilate
pdb file: 151952.pdb
sdf file: 151952.sdf
directory: 151952

146-14-5 16426-55-4 1H-Purin-6-amine, flavin dinucleotide 1H-Purin-6-amine, flavine dinucleotide 4-26-00-03632 (Beilstein Handbook Reference) ADENOSINE 5'-(TRIHYDROGEN PYROPHOSPHATE), 5'-5'-ESTER with RIBOFLAVINE Adenine-flavin dinucleotide Adenine-flavine dinucleotide Adenine-riboflavin dinuceotide Adenine-riboflavin dinucleotide Adenine-riboflavine dinucleotide BRN 0078150 EINECS 205-663-1 FAD Flamitajin B Flanin F Flavin adenin dinucleotide Flavin adenin dinucleotide [JAN] Flavin adenine dinucleotide Flavin-adenine dinucleotide Flavinat Flavine adenosine diphosphate Flavine-adenine dinucleotide Flavitan Flaziren (free acid) Isoalloxazine-adenine dinucleotide NSC 112207 Riboflavin 5'-(trihydrogen diphosphate), 5'-5'-ester with adenosine Riboflavin 5'-(trihydrogen diphosphate), P'-5'-ester with adenosine Riboflavin 5'-adenosine diphosphate Riboflavin-adenine dinucleotide Riboflavine-adenine dinucleotide
pdb file: 152122.pdb
sdf file: 152122.sdf
directory: 152122

150-38-9 8014-66-2 97928-92-2 AI3-18050 Acetic acid, (ethylenedinitrilo)tetra-, trisodium salt CCRIS 294 EDTA EDTA trisodium salt EDTA trisodium salt (trihydrate) EINECS 205-758-8 ETHYLENEDIAMINE TETRAACETIC ACID (EDTA) Edetate Trisodium [USAN] Edetate trisodium Ethylenediamineacetic acid trisodium salt Ethylenediaminetetraacetic acid, trisodium salt Ethylenediaminetetraacetic acid, trisodium salt, trihydrate Glycine, N,N'-1,2-ethanediylbis(N-(carboxymethyl)-, trisodium salt Glycine, N,N'-1,2-ethanediylbis(N-(carboxymethyl)-, trisodium salt, monohydrate N,N'-1,2-Ethanediylbis(N-(carboxymethyl)glycine), trisodium salt NCI-C03974 Nevanaid-B powder Perma kleer 50, trisodium salt Sequestrene Na3 Sequestrene trisodium Sequestrene trisodium salt Trilon AO Trinatrium ethylendiamintetraacetat [Czech] Trisodium EDTA Trisodium edetate Trisodium ethylenediamine tetraacetate Trisodium ethylenediaminetetraacetate Trisodium ethylenediaminetetraacetate trihydrate Trisodium hydrogen (ethylenedinitrilo)tetraacetate Trisodium hydrogen ethylene diaminetetraacetate Trisodium hydrogen ethylenediaminetetraacetate Trisodium hydrogen(ethylenedinitrilo)tetraacetate
pdb file: 152184.pdb
sdf file: 152184.sdf
directory: 152184

151-41-7 2044-56-6 2235-54-3 22397-58-6 3-01-00-02186 (Beilstein Handbook Reference) 3097-08-3 38344-88-6 4706-78-9 BRN 1710530 DODECYL SULFATE Dodecansulfonic acid, hydroxy- Dodecyl hydrogen sulfate Dodecyl hydrogen sulphate Dodecylsulfuric acid EINECS 205-791-8 HSDB 936 Lauryl sulfate Lauryl sulfuric acid Lauryl sulphate Monododecyl hydrogen sulfate N-Dodecyl sulfate Sulfuric acid, monododecyl ester
pdb file: 152213.pdb
sdf file: 152213.sdf
directory: 152213

133708-36-8 151-50-8 15745-74-1 4-02-00-00050 (Beilstein Handbook Reference) 60195-52-0 AI3-28749 BRN 4652394 Caswell No. 688A Cyanide of potassium Cyanide salts Cyanure de potassium [French] EINECS 205-792-3 EPA Pesticide Chemical Code 599600 HSDB 1245 Hydrocyanic acid, potassium salt Hydrogen cyanide and cyanide salts Kalium cyanid [German] M-44 capsules (potassium cyanide) POTASSIUM CYANIDE Potassium cyanide (K(CN)) Potassium cyanide K(CN) Potassium cyanide [UN1680] [Poison] RCRA waste no. P098 RCRA waste number P098 UN1680
pdb file: 152214.pdb
sdf file: 152214.sdf
directory: 152214

1068-22-0 1068-23-1 298-06-6 3338-24-7 3454-66-8 4-01-00-01354 (Beilstein Handbook Reference) 40219-16-7 BRN 0507407 Di-O-ethyl dithiophosphate Diethyl dithiophosphate Diethyl phosphorodithioate Dithiophosphoric acid, O,O-diethyl ester EINECS 206-055-9 HSDB 5558 Kyselina O,O-diethyldithiofosforecna [Czech] NSC 171184 O,O'-Diethyl hydrogen dithiophosphate O,O-DIETHYL PHOSPHORODITHIOATE O,O-Diethyl dithiophosphate O,O-Diethyl dithiophosphoric acid ester O,O-Diethyl hydrogen phosphorodithioate O,O-Diethyl thiolothionophosphate O,O-Diethyl-S-hydrogen phosphorodithioate O,O-Diethyldithiophosphate Phosphordithioic acid, O,O-diethyl ester Phosphorodithioic acid, O,O-diethyl ester
pdb file: 152471.pdb
sdf file: 152471.sdf
directory: 152471

141-65-1 2-Ethyl-1-hexanol hydrogen phosphate 298-07-7 4-01-00-01786 (Beilstein Handbook Reference) 4971-46-4 4971-47-5 AI3-23072 BIS(2-ETHYLHEXYL) PHOSPHATE BRN 1712988 Bis(2-ethylhexyl) hydrogen phosphate Bis(2-ethylhexyl) phosphoric acid Bis(2-ethylhexyl)hydrogen phosphate Bis(2-ethylhexyl)orthophosphoric acid Bis(2-ethylhexyl)phosphate Bis(2-ethylhexyl)phosphoric acid Bis(2-ethylhexyl)phosphoric acid ester D 2EHPA Dehpa extractant Di(2-ethylhexyl) orthophosphoric acid Di(2-ethylhexyl) phosphate Di(2-ethylhexyl) phosphoric acid Di(2-ethylhexyl)orthophosphoric acid Di(2-ethylhexyl)phosphate Di(2-ethylhexyl)phosphoric acid Di-(2-ethylhexyl) acid phosphate Di-2(ethylhexyl)phosphoric acid Di-2-ethylhexyl hydrogen phosphate EINECS 206-056-4 Escaid 100 HSDB 341 Hdehp Hydrogen bis(2-ethylhexyl) phosphate Kyselina di-(2-ethylhexyl)fosforecna [Czech] Phosphoric acid, bis(2-ethylhexyl) ester
pdb file: 152472.pdb
sdf file: 152472.sdf
directory: 152472

1-Isonicotinyl-2-isopropylhydrazine phosphate 1-Isopropyl-2-isonicotinylhydrazine phosphate 305-33-9 4-Pyridinecarboxylic acid, 2-(1-methylethyl)hydrazide, phosphate (1:1) (9CI) AI3-62177 EINECS 206-164-1 ISONICOTINIC ACID, 2-ISOPROPYLHYDRAZIDE, PHOSPHATE Iproniazid as phosphate Iproniazid dihydrogen phosphate Iproniazid phosphate Iproniazid phosphate (VAN) Iproniazide phosphate Isonicotinic acid, 2-isopropylhydrazide, phosphate (1:1) (8CI) Isoproniazid phosphate Marsilid phosphate NSC 81850
pdb file: 152574.pdb
sdf file: 152574.sdf
directory: 152574

2,2,2-Trichloroethanol dihydrogen phosphate 2,2,2-Trichloroethanol, dihydrogen phosphate 2,2,2-Trichloroethyl dihydrogen phosphate 2,2,2-Trichloroethyl phosphate 306-52-5 7246-20-0 8060-81-9 BRN 1841552 EINECS 206-185-6 Ethanol, 2,2,2-trichloro-, dihydrogen phosphate HSDB 3276 Phosphoric acid, 2,2,2-trichloroethyl ester Sch 10159 TRICLOFOS Trichlophos Trichlorethyl phosphate Trichloroethanol 1-phosphate Trichloroethanol-1-phosphate Trichloroethyl dihydrogen phosphate Trichloroethyl phosphate Trichloryl Triclofosa [INN-Spanish] Triclofoso [DCIT] Triclofosum [INN-Latin] Tricloryl Triclos
pdb file: 152590.pdb
sdf file: 152590.sdf
directory: 152590

3-Chloro-4-methyl-umbelliferone bis(2-chloroethyl)phosphate 3-Chloro-7-hydroxy-4-methyl-2H-1-benzopyran-2-one bis(chloroethyl)phosphate 3-Chloro-7-hydroxy-4-methylcoumarin bis(2-chloroethyl)phosphate 321-55-1 96H60 AI3-50680 BRN 1271357 COUMARIN, 3-CHLORO-7-HYDROXY-4-METHYL-, BIS(2-CHLOROETHYL) PHOSPHATE Di-(2-chloroethyl) 3-chloro-4-methylcoumarin-7-yl phosphate Di-(2-chloroethyl)-3-chloro-4-methyl-7-coumarinyl phosphate EINECS 206-289-1 Ethanol, 2-chloro-, hydrogen phosphate, ester with 3-chloro-7-hydroxy-4-methylcoumarin Ethanol, 2-chloro-, phosphate diester, ester with 3-chloro-7-hydroxy-4-methylcoumarin Eustidil Galloxon Galoxone Haloxon Haloxon [BAN:INN] Haloxona [INN-Spanish] Haloxone [INN-French] Haloxonum [INN-Latin] Helmirane Helmiron Helmirone Loxon Luxon O,O-Bis(2-chloroethyl) O-(3-chloro-4-methyl-7-coumarinyl) phosphate O,O-Di(2-chloroethyl)-O-(3-chloro-4-methylcoumarin-7-yl)phosphate Phosphoric acid, bis(2-chloroethyl) 3-chloro-4-methyl-2-oxo-2H-1-benzopyran-7-yl ester Phosphorsaeure-O,O-di-(2-chlorethyl)-O-(3'-chlor-4'-mehyl-cumarin-7-yl)ester
pdb file: 152667.pdb
sdf file: 152667.sdf
directory: 152667

32348-90-6 32348-91-7 330-13-2 4-Nitrophenyl dihydrogen phosphate 4264-83-9 54306-27-3 EINECS 206-353-9 NSC 404086 Nitrophenylphosphate P-NITROPHENYL PHOSPHATE Phenol, p-nitro-, dihydrogen phosphate Phosphoric acid, mono(4-nitrophenyl) ester Phosphoric acid, mono(p-nitrophenyl) ester (8CI) p-Nitrophenyl dihydrogen phosphate
pdb file: 152714.pdb
sdf file: 152714.sdf
directory: 152714

16980-89-5 19436-29-4 3',5'-Cyclic AMP dibutyrate 362-74-3 AMP N6-2'-O-dibutyrate AMP, cyclic dibutyryl Actosin Adenosine, N-(1-oxobutyl)-, cyclic 3',5'-(hydrogen phosphate) 2'-butanoate (9CI) BRN 0871714 BUCLADESINE Bucladesina [Spanish] Bucladesine [INN] Bucladesinum [Latin] Butyramide, N-(9-beta-D-ribofuranosyl-9H-furin-6-yl)-, cyclic 3',5'-(hydrogen phosphate) 2'-butyrate Butyramide, N-(9-beta-D-ribofuranosyl-9H-purin-6-yl)-, cyclic 3',5'-(hydrogen phosphate) 2'-butyrate (8CI) CCRIS 2053 Cyclic AMP N(sup 6),2'-O-dibutyrate Cyclic AMP dibutyrate Cyclic N6-dibutyryl-AMP Cyclic dibutyryl AMP DBC-AMP DT 5621 Dibutyl cyclic AMP Dibutyryl 3',5'-cyclic AMP Dibutyryl acid, AMP Dibutyryl adenosine 3',5'-cyclic phosphate Dibutyryl adenosine 3',5'-monophosphate Dibutyryl adenosine cyclic 3',5'-monophosphate Dibutyryl adenosine cyclic monophosphate Dibutyryl cAMP Dibutyryl cyclic 3',5'-adenylic acid Dibutyryl cyclic AMP Dibutyryl cyclic adenosine 3',5'-monophosphate Dibutyryl cyclic adenosine monophosphate
pdb file: 152900.pdb
sdf file: 152900.sdf
directory: 152900

2'-Deoxythymidine 5'-monophosphate 365-07-1 5'-TMP 5'-Thymidylic acid 5'-dTMP 5-Methyl-dUMP Deoxy TMP Deoxyribosylthymine monophosphate Deoxythymidine 5'-monophosphate Deoxythymidine 5'-phosphate Deoxythymidine monophosphate Deoxythymydilic acid NSC 46713 THYMIDYLIC ACID TMP (VAN) TMP (nucleotide) Thymidine 5'-monophosphate Thymidine 5'-phosphate Thymidine 5'-phosphoric acid Thymidine mononucleotide Thymidine monophosphate Thymidine phosphate Thymidine, mono(dihydrogen phosphate) (ester) Thymidine-5'-monophosphoric acid dTMP
pdb file: 152914.pdb
sdf file: 152914.sdf
directory: 152914

3'-Adenylic acid, 5'-(dihydrogen phosphate), 5'-anhydride with sulfuric acid 3'-Phosphoadenosine-5'-phosphosulfate 3'-Phosphoadenylyl sulfate 3-Phosphoadenosine 5'-phosphosulfate 4-26-00-03662 (Beilstein Handbook Reference) 482-67-7 APS Adenosine, 3',5'-bis(dihydrogen phosphate), 5'-monoanhydride with sulfuric acid (8CI) Adenosine, 3',5'-diphosphate, 5'-anhydride with sulfuric acid BRN 0073511 PAPS PHOSPHOADENOSINE PHOSPHOSULFATE
pdb file: 153460.pdb
sdf file: 153460.sdf
directory: 153460

130385-38-5 1H-Indol-3-ol, hydrogen sulfate (ester) 2642-37-7 3-Indoxyl sulfate 3-Indoxylsulfuric acid 487-94-5 INDICAN Indican (metabolic indican) Indican (metabolic indolyl sulfate) Indoxyl sulfate Indoxylsulfuric acid
pdb file: 153517.pdb
sdf file: 153517.sdf
directory: 153517

526-94-3 77034-67-4 Butanedioic acid, 2,3-dihydroxy- (2R,3R)-, monosodium salt Butanedioic acid, 2,3-dihydroxy- (theta-(theta,theta))-, monosodium salt Butanedioic acid, 2,3-dihydroxy-, (R-(R*,R*))-, monosodium salt EINECS 208-400-9 Monobasic sodium tartrate Monosodium L-(+)-tartrate Monosodium tartrate Natrium hydrogen-(2R,3R)-tartrat Natriumtartrat [German] Sodium acid tartrate Sodium bitartrate Sodium hydrogen tartrate TARTARIC ACID, SODIUM SALT Tartaric acid, monosodium salt
pdb file: 153990.pdb
sdf file: 153990.sdf
directory: 153990

533-96-0 8014-64-0 Carbonic acid, sodium salt (2:3) EINECS 208-580-9 HSDB 769 Magadi soda SODIUM SESQUICARBONATE SQ 810 Snowflake crystals Sodium carbonate (3:2) Trisodium hydrogendicarbonate Trona Urao
pdb file: 154095.pdb
sdf file: 154095.sdf
directory: 154095

4-Chloromercuribenzenesulfonate 554-77-8 AI3-51823 Chloromercuriphenylsulfonate Mercurate(1-), chloro(4-sulfonatophenyl)-, hydrogen Mercury, chloro(4-sulfophenyl)- P-CHLOROMERCURIPHENYLSULFONIC ACID PCMBS p-Chloromercuribenzenesulfonate p-Chloromercuriphenylsulfonate
pdb file: 154433.pdb
sdf file: 154433.sdf
directory: 154433

585-54-6 ARSANILIC ACID, N-ACETYL-, SODIUM SALT Arsacetin sodium salt Arsonic acid, (4-(acetylamino)phenyl)-, monosodium salt (9CI) EINECS 209-558-1 Monosodium (4-(acetylamino)phenyl)arsonate Sodium acetylarsanilate Sodium hydrogen (4-(acetamido)phenyl)arsonate
pdb file: 154756.pdb
sdf file: 154756.sdf
directory: 154756

2870-30-6 31636-06-3 4-01-00-01339 (Beilstein Handbook Reference) 598-02-7 AI3-17002 BRN 1704113 DIETHYLPHOSPHORIC ACID Diethyl acid phosphate Diethyl hydrogen phosphate Diethyl phosphate Diethyl phosphoric acid EINECS 209-912-5 Ethyl phosphate, (ETO)2(HO)PO Ethyl phosphate, di- NSC 97178 O,O-Diethyl hydrogen phosphate Phosphoric acid, diethyl ester
pdb file: 155011.pdb
sdf file: 155011.sdf
directory: 155011

4-02-00-01960 (Beilstein Handbook Reference) 626-86-8 ADIPIC ACID, MONOETHYL ESTER AI3-11210 BRN 1769469 EINECS 210-966-7 Ethyl hydrogen adipate Hexanedioic acid, monoethyl ester Hexanoic acid, monoethyl ester (9CI) Monoethyl adipate Monoethyl hexanedioate Monoethyladipic acid ester NSC 8877
pdb file: 155618.pdb
sdf file: 155618.sdf
directory: 155618

5-Carbomethoxypentanoic acid 627-91-8 AI3-01772 Adipic acid monomethyl ester Adipic acid, monomethyl ester (8CI) EINECS 211-019-0 Hexanedioic acid, monomethyl ester MONOMETHYLHEXANEDIOATE Methyl 5-carboxypentanoate Methyl hemiadipate Methyl hydrogen adipate Monomethyl 1,6-hexanedioate Monomethyl adipate NSC 55113 NSC 9389
pdb file: 155651.pdb
sdf file: 155651.sdf
directory: 155651

5,6-Dihydro-9,10-dimethoxybenzo(g)-1,3-benzodioxolo(5,6-a)quinolizinium sulfate 633-66-9 Acid berberine sulfate BERBINIUM, 7,8,13,13a-TETRADEHYDRO-9,10-DIMETHOXY-2,3-(METHYLENEDIOXY)-, SULFATE Benzo(g)-1,3-benzodioxolo(5,6-a)quinolizinium, 5,6-dihydro-9,10-dimethoxy-, sulfate (1:1) (9CI) Berberine bisulfate Berberine hydrogen sulfate Berberine hydrogen sulphate Berberine sulfate (1:1) Berberine sulfate [JAN] Berberine sulphate Berbinium, 7,8,13,13a-tetradehydro-9,10-dimethoxy-2,3-(methylenedioxy)-, sulfate (1:1) EINECS 211-196-4 NSC 150444 Siarczanu berberyny [Polish]
pdb file: 155774.pdb
sdf file: 155774.sdf
directory: 155774

100147-02-2 4-06-00-01330 (Beilstein Handbook Reference) 4043-96-3 645-15-8 BNPP BRN 2064857 Bis(4-nitrophenyl) hydrogen phosphate Bis(4-nitrophenyl) phosphate Bis(4-nitrophenyl)phosphate Bis(p-nitrophenyl) phosphate DI-P-NITROPHENYL HYDROGEN PHOSPHATE Di-p-nitrophenyl phosphate EINECS 211-434-7 NSC 59824 Phenol, p-nitro-, hydrogen phosphate Phosphoric acid bis(p-nitrophenyl) ester Phosphoric acid, bis(4-nitrophenyl) ester Phosphoric acid, bis(p-nitrophenyl) ester Phosphorsaeure-bis-(p-nitro-phenylester) [German] p-Nitrophenyl monohydrogen phosphate
pdb file: 155905.pdb
sdf file: 155905.sdf
directory: 155905

(3-beta)-3-(Sulfooxy)androst-5-en-17-one 1095-56-3 17-Ketoandrost-5-en-3beta-yl sulfate 3-O-Sulfodehydroepiandrosterone 3beta-Hydroxyandrost-5-en-17-one-3-sulfate 5-Androsten-3beta-sulfate-17-one 601-36-5 651-48-9 Androst-5-en-17-on-3beta-yl sulfuric acid Androst-5-en-17-one, 3-(sulfooxy)-, (3-beta)- Androst-5-en-17-one, 3-(sulfooxy)-, (3beta)- Androst-5-en-17-one, 3-beta-hydroxy-, hydrogen sulfate CCRIS 6746 DEHYDROEPIANDROSTERONE SULFATE DHEA sulfate Dehydroandrosterone sulfate Dehydroepiandrosterone 3-sulfate Dehydroepiandrosterone monosulfate Dehydroisoandrosterone sulfate Dehydroisoandrosterone-3-sulfate Prasterone sulfate
pdb file: 155924.pdb
sdf file: 155924.sdf
directory: 155924

2'-DEOXY-5'-ADENYLIC ACID 2'-Deoxy-5'-adenosine monophosphate 2'-Deoxy-AMP 2'-Deoxyadenosine 5'-(dihydrogen phosphate) 2'-Deoxyadenosine 5'-phosphate 2'-Deoxyadenosine monophosphate 2'-Deoxyadenylic acid 2'-dAMP 2922-74-9 29576-96-3 5'-Adenylic acid, 2'-deoxy- (9CI) 653-63-4 75688-15-2 87578-08-3 Adenosine, 2'-deoxy-, 5'-(dihydrogen phosphate) (8CI) Deoxy-5'-adenylic acid Deoxy-AMP Deoxyadenosine 5'-monophosphate Deoxyadenosine 5'-phosphate Deoxyadenylic acid EINECS 211-503-1 NSC 77680 NSC 82625 PdA (VAN) dAMP
pdb file: 155929.pdb
sdf file: 155929.sdf
directory: 155929

32348-89-3 3279-54-7 62698-52-6 701-64-4 EINECS 211-857-7 MONOPHENYL PHOSPHATE Phenyl dihydrogen phosphate Phenylphosphate Phosphoric acid, monophenyl ester
pdb file: 156136.pdb
sdf file: 156136.sdf
directory: 156136

1066-97-3 16001-68-6 26377-29-7 28867-26-7 34247-29-5 4-01-00-01264 (Beilstein Handbook Reference) 756-80-9 BRN 0635993 Dimethyl phosphodithionate Dimethyl phosphorodithioate Dimethyldithiophosphoric acid EINECS 212-053-9 HSDB 5750 Kwas dwumetylo-dwutiofosforowy [Polish] Kyselina O,O-dimethyldithiofosforcna [Czech] Methyl phosphorodithioate (6CI,7CI) O,O'-Dimethyl hydrogen dithiophosphate O,O-DIMETHYL DITHIOPHOSPHATE O,O-Dimethyl dithiophosphoric acid O,O-Dimethyl hydrogen dithiophosphate O,O-Dimethyl phosphorodithioate O,O-Dimethyl phosphorodithioic acid O,O-Dimethyldithiophosphate O,O-Dimethylphosphorodithioate Phosphorodithioic acid, O,O-dimethyl ester
pdb file: 156308.pdb
sdf file: 156308.sdf
directory: 156308

4-01-00-01329 (Beilstein Handbook Reference) 762-04-9 BRN 0605759 DIETHYL HYDROGEN PHOSPHITE Diethoxyphosphine oxide Diethyl acid phosphite Diethyl phosphite Diethyl phosphonate Diethylfosfit [Czech] EINECS 212-091-6 Ethyl phosphonate ((EtO)2HPO) HSDB 2591 Hydrogen diethyl phosphite NSC 2665 O,O-Diethyl phosphonate Phosphonic acid diethyl ester Phosphonic acid, diethyl ester Phosphorous acid, diethyl ester
pdb file: 156327.pdb
sdf file: 156327.sdf
directory: 156327

4-01-00-01258 (Beilstein Handbook Reference) 812-00-0 BRN 1701224 Dihydrogen methyl phosphate EINECS 212-379-1 METHYL PHOSPHATE Methyl dihydrogen phosphate Methyl phosphate, (MeO)(HO)2PO Monomethyl dihydrogen phosphate Monomethyl phosphate NSC 41908 O-Methyl phosphate Phosphoric acid, monomethyl ester
pdb file: 156483.pdb
sdf file: 156483.sdf
directory: 156483

32586-82-6 4-01-00-01259 (Beilstein Handbook Reference) 813-78-5 AI3-15058 BRN 1702242 DIMETHYL PHOSPHATE DMP Dimethyl hydrogen phosphate EINECS 212-389-6 Methyl phosphate ((MeO)2(HO)PO) NSC 2676 O,O-Dimethyl hydrogen phosphate O,O-Dimethyl phosphate Phosphoric acid, dimethyl ester
pdb file: 156487.pdb
sdf file: 156487.sdf
directory: 156487

4-06-00-00714 (Beilstein Handbook Reference) 838-85-7 BRN 1379164 DIPHENYL PHOSPHATE Diphenyl hydrogen phosphate EINECS 212-657-2 NSC 6518 Phenyl hydrogen phosphate Phenyl phosphate ((PhO)2(HO)PO) Phosphoric acid, diphenyl ester
pdb file: 156637.pdb
sdf file: 156637.sdf
directory: 156637

2-Methyl-2-thiopseudourea sulfate 2-Methyl-2-thiopseudourea sulfate (2:1) 2986-19-8 72046-63-0 867-44-7 AI3-50026 Bis(2-methylisothiouronium) sulphate Carbamimidothioic acid, methyl ester, sulfate (2:1) Carbamimidothioic acid, methyl-, sulfate (2:1) EINECS 212-759-7 METHYL THIURONIUM SULFATE (2:1) Methylcarbamimidothioate sulfate (2:1) Methylthiopseudourea sulfate NSC 516 Pseudourea, 2-methyl-2-thio-, hydrogen sulfate Pseudourea, 2-methyl-2-thio-, sulfate (2:1) S-Methylisothiourea hemisulfate S-Methylisothiourea sulfate S-Methylisothiourea sulfate (2:1) S-Methylthiouronium sulfate (2:1)
pdb file: 156703.pdb
sdf file: 156703.sdf
directory: 156703

35-04-1 6381-58-4 868-14-4 Acid potassium tartrate Butanedioic acid, 2,3-dihydroxy- (2R,3R)-, monopotassium salt Butanedioic acid, 2,3-dihydroxy- (theta-(theta,theta))-, monopotassium salt Butanedioic acid, 2,3-dihydroxy-, (R-(R*,R*))-, monopotassium salt Butanedioic acid, 2,3-dihydroxy-, (R-(R*,R*))-, monopotassium salt (9CI) CCRIS 7329 Cream of tartar Cremor tartari EINECS 212-769-1 Faccla Faccula Faecla Faecula HSDB 1264 Monopotassium 2,3-dihydroxybutanedioate, (R-(R*,R*))- Monopotassium tartrate NSC 155080 POTASSIUM ACID TARTRATE Potassium L-bitartrate Potassium L-tartrate (kc4H5O6) Potassium acid salt of L-(+)-tartaric acid Potassium bitartrate Potassium bitartrate [USAN] Potassium hydrogen tartrate Potassium tartrate Potassium tartrate (KHC4H4O6) Tartar Tartar cream Tartaric acid, monopotassium salt
pdb file: 156706.pdb
sdf file: 156706.sdf
directory: 156706

868-85-9 Bis(hydroxymethyl)phosphine oxide CCRIS 1354 DIMETHYL HYDROGEN PHOSPHITE Dimethoxyphosphine oxide Dimethyl acid phosphite Dimethyl hydrogen phosphonate Dimethyl phosphite Dimethyl phosphonate Dimethylester kyselini fosforite [Czech] Dimethylester kyseliny fosforite [Czech] Dimethylfosfit [Czech] Dimethylfosfonat [Czech] Dimethylhydrogenphosphite EINECS 212-783-8 HSDB 2593 Hydrogen dimethyl phosphite Methyl phosphonate ((MeO)2HPO) NCI-C54773 Phosphonic acid, dimethyl ester
pdb file: 156714.pdb
sdf file: 156714.sdf
directory: 156714

133915-55-6 144233-13-6 180915-17-7 2053-10-3 2152-08-1 53743-83-2 57523-69-0 75-92-3 870-72-4 AI3-23356 EINECS 212-800-9 Formaldehyde sodium bisulfite Formaldehyde sulfite sodium salt Formaldehyde, compd with monosodium sulfite (1:1) Formaldehyde, compd with sodium hydrogen sulfate (1:1) Formaldehyde, compd. with monosodium sulfite Formaldehyde-sodium bisulfite compound Formbis HSDB 5766 Hydroxymethanesulfonic acid monosodium salt Hydroxymethanesulfonic acid, monosodium salt Methanesulfonic acid, hydroxy-, monosodium salt Methanesulfonic acid, hydroxy-, sodium salt Methylolsulfonic acid sodium salt Monosodium hydroxymethanesulfonate NSC 2441 SODIUM FORMALDEHYDE BISULFITE Sodium formaldehydebisulfite Sodium hydroxymethane sulfonate Sodium hydroxymethanesulfonate Sodium hydroxymethanesulphonate Sodium hydroxymethylsulfonate Sulfuric acid, monosodium salt, compd with formaldehyde (1:1) Sulfurous acid, monosodium salt, compd with formaldehyde (1:1)
pdb file: 156722.pdb
sdf file: 156722.sdf
directory: 156722

1,2-Benzenedicarboxylic acid, monopotassium salt 877-24-7 88-99-3 AI3-51765 EINECS 212-889-4 Hydrogen potassium phthalate PHTHALIC ACID, POTASSIUM SALT Phthalic acid, monopotassium salt Potassium acid phthalate Potassium biphthalate Potassium hydrogen phthalate
pdb file: 156764.pdb
sdf file: 156764.sdf
directory: 156764

1032-65-1 1beta-Deoxyribofuranosylcytosine-5'-phosphate,d 5'-Cytidylic acid, 2'-deoxy- Cytidine 5'-(dihydrogen phosphate) DEOXYCYTIDINE MONOPHOSPHATE EINECS 213-849-9
pdb file: 157261.pdb
sdf file: 157261.sdf
directory: 157261

10361-29-2 1066-33-7 114459-02-8 40861-29-8 758-14-5 AMMONIUM BICARBONATE Acid ammonium carbonate Ammonium acid carbonate Ammonium bicarbonate (1:1) Ammonium hydrogen carbonate Ammonium hydrogencarbonat Ammonium hydrogencarbonate CCRIS 7327 Carbonic acid, monoammonium salt EINECS 213-911-5 HSDB 491 Monoammonium carbonate
pdb file: 157316.pdb
sdf file: 157316.sdf
directory: 157316

(2-Ethylhexyl)orthophosphate 1-Hexanol, 2-ethyl-, dihydrogen phosphate (7CI) 1-Hexanol, 2-ethyl-, phosphate (6CI) 1070-03-7 163447-53-8 2-ETHYLHEXYL DIHYDROGEN PHOSPHATE 2-Ethylhexyl acid phosphate 2-Ethylhexyl phosphate EINECS 213-967-0 Ethylhexyl acid phosphate HSDB 2594 Mono(2-ethylhexyl) phosphate Mono(2-ethylhexyl)phosphate NSC 41916 NSC 62313 Phosphoric acid, mono(2-ethylhexyl) ester
pdb file: 157351.pdb
sdf file: 157351.sdf
directory: 157351

1071-23-4 2-AMINOETHYL PHOSPHATE 2-Aminoethyl dihydrogen phosphate Colamine phosphate EINECS 213-988-5 Ethanol, 2-amino-, dihydrogen phosphate (ester) Ethanol, 2-amino-, phosphate Ethanolamine O-phosphate Ethanolamine phosphate Mono(2-aminoethyl) phosphate NSC 254167 O-Phosphoethanolamine O-Phosphorylethanolamine Pe 104 Phosphoethanolamine Phosphonoethanolamine Phosphoric acid, 2-aminoethyl phenyl ester Phosphoryethanolamine Phosphorylethanolamine
pdb file: 157361.pdb
sdf file: 157361.sdf
directory: 157361

(4-Carboxylatophenyl)hydroxymercurate(1-) hydrogen (p-Carboxyphenyl)hydroxymercury 1126-48-3 MERCURY, (p-CARBOXYPHENYL)HYDROXY- Mercurate(1-), (4-carboxylatophenyl)hydroxy-, hydrogen (9CI) p-Hydroxymercuribenzoate p-Hydroxymercuribenzoic acid
pdb file: 157597.pdb
sdf file: 157597.sdf
directory: 157597

1-Tetradecanol, hydrogen sulfate, sodium salt 1191-50-0 22088-37-5 7-Ethyl-2-methyl-4-hendecanol sulfate sodium salt EINECS 214-737-2 Monotetradecylsulfate sodium salt Myristyl sulfate, sodium salt NSC 139032 Natri tetradecylsulfas Natrii tetradecyclis sulfas [INN-Latin] Natrii tetradecylsulfas Niaproof 4 S.T.D. SODIUM TETRADECYL SULFATE STDS Sodium myristyl sulfate Sodium tetradecyl sulphate Sodium tetradecylsulfate Sulfuric acid, monotetradecyl ester, sodium salt Sulfuric acid, myristyl ester, sodium salt Tesapon K 14 Tetradecilsulfato sodico [INN-Spanish] Tetradecyl sodium sulfate Tetradecyl sulfate de sodium [INN-French] Tetradecyl sulfate, sodium salt Texapon K 14 natrii tetracylis sulfas
pdb file: 157766.pdb
sdf file: 157766.sdf
directory: 157766

1,2,3-Propanetriol, mono(dihydrogen phosphate), dipotassium salt, trihydrate 1319-70-6 Dipotassium 1,2,3-propanetriol mono(dihydrogen phosphate) trihydrate Dipotassium glycerophosphate trihydrate Glycerophosphoric acid, dipotassium salt, trihydrate POTASSIUM GLYCEROPHOSPHATE Potassium glycerophosphate trihydrate
pdb file: 158090.pdb
sdf file: 158090.sdf
directory: 158090

(29H,31H-Phthalocyaninedisulfonato(4-)-N29,N30,N31,N32)cuprate(2-) disodium 1330-38-7 20234-67-7 37279-62-2 Acid Blue 87 Aizen Primula Turquoise Blue GL Amafast Turquoise 8GGL Amanil Fast Turquoise Amanil Fast Turquoise LB Arlazol Fast Turquoise Blue 6GN Atlantic Fast Turquoise LGA Belamine Fast Turquoise LGL C.I. 74180 C.I. Acid Blue 87 C.I. DIRECT BLUE 86 C.I. Direct Blue 86 (6CI) CI 74180 Calcodur Turquoise GL Chlorantine Fast Turquoise VLL Chrom Leather Turquoise Blue GLL Copper(dihydrogen phthalocyaninedisulfonato(2)) disodium salt Copper, (dihydrogen phthalocyaninedisulfonato(2-))-, disodium salt (7CI,8CI) Cuprate(2), (29H,31H-phthalocyaninedisulfonato(4-)-N29,N30,N31,N32)-, disodium Cuprate(2-), (29H,31H-phthalocyanine-C,C-disulfonato(4-)-N29,N39,N31,N32)-, disodium Cuprate(2-), (29H,31H-phthalocyanine-C,C-disulfonato(4-)-kappaN29,kappaN30,kappaN31,kappaN32)-, disodium Cuprate(2-), (29H,31H-phthalocyanine-C,C-disulphonato(4-)-N(sup 29),N(sup 30),N(sup 31), N(sup 32))-, disodium Cuprofix Blue Green B Cuprofix Blue Green
pdb file: 158171.pdb
sdf file: 158171.sdf
directory: 158171

1,2,3-Propanetriol, mono(dihydrogen phosphate), potassium salt 1335-34-8 29352-18-9 Glycerol, mono(dihydrogen phosphate), potassium salt Glycerophosphoric acid, potassium salt HSDB 1232 POTASSIUM GLYCEROPHOSPHATE
pdb file: 158210.pdb
sdf file: 158210.sdf
directory: 158210

1336-80-7 2-Hydroxy-1,2,3-propanetricarboxylic acid, iron complex 2-Hydroxy-N,N,N-trimethylethanaminium triaqua(2-hydroxy-1,2,3-tricarboxylatoferrate, (OC-6-44) Chelate prepared by reacting equimolar quantities of freshly precipitated ferric hydroxide with choline dihydrogen citrate EINECS 215-649-7 ETHANAMINIUM, 2-HYDROXY-N,N,N-TRIMETHYL-, HYDROXY(2-HYDROXY-1,2,3-PROPANETRICARB Ethanaminium, 2-hydroxy-N,N,N-trimethyl-, (OC-6-44)-triaqua(2-hydroxy-1,2,3-propanetricarboxylato(4-))ferrate(1-) Ethanaminium, 2-hydroxy-N,N,N-trimethyl-, hydroxy(2-hydroxy-1,2,3-propanetricarboxylato(4-))ferrate(1-) Ferrate(1-), triaqua(2-hydroxy-1,2,3-propanetricarboxylato(4-))-, (oc-6-44)-, 2-hydroxy-N,N,N-trimethylethanaminium Ferric choline citrate Ferricholinatum Ferrocholinate Ferrocholinate [INN] Ferrocholinate citrate Ferrocholinatum [INN-Latin] Ferrocolinato [INN-Spanish] Iron 2-hydroxy-1,2,3-propanetricarboxylate complex Iron choline citrate Iron choline citrate complex Iron-choline citrate complex
pdb file: 158221.pdb
sdf file: 158221.sdf
directory: 158221

1,4-Benzenedicarboxylic acid, monomethyl ester 1679-64-7 4-(Carbomethoxy)benzoic acid 4-Methoxycarbonylbenzoic acid Acetic acid, (4-carboxyphenyl)- EINECS 216-849-7 HSDB 5849 HYDROGEN METHYL TEREPHTHALATE Homoterephthalic acid Methyl hydrogen terephthalate Methyl terephthalate Monomethyl terephthalate NSC 210838 Terephthalic acid, monomethyl ester Terephthalic acid, monomethyl ester (8CI) p-Carboxy-alpha-toluic acid
pdb file: 158824.pdb
sdf file: 158824.sdf
directory: 158824

1809-19-4 4-01-00-01525 (Beilstein Handbook Reference) BRN 1099706 Butyl alcohol, hydrogen phosphite Butyl phosphonate ((BuO)2HPO) DIBUTYL HYDROGEN PHOSPHITE Di-n-butyl hydrogen phosphite Dibutoxyphosphine oxide Dibutyl hydrogen phosphite (VAN) Dibutyl hydrogen phosphonate Dibutyl phosphite Dibutyl phosphite (VAN) Dibutyl phosphonate Dibutylfosfit [Czech] EINECS 217-316-1 HSDB 2597 Mobil DBHP NSC 2668 Phosphonic acid, dibutyl ester Phosphorous acid, dibutyl ester Phosphorous acid, dibutyl ester (VAN)
pdb file: 159039.pdb
sdf file: 159039.sdf
directory: 159039

1809-20-7 4-01-00-01475 (Beilstein Handbook Reference) BRN 1703675 DIISOPROPYLPHOSPHITE Diisopropyl hydrogen phosphite Diisopropyl hydrogen phosphonate Diisopropyl phosphite Diisopropyl phosphonate Diisopropylphosphine oxide Diisopropylphosphonate EINECS 217-317-7 Isopropyl phosphonate Isopropyl phosphonate ((C3H7O)2HPO) NSC 82344 O,O-Diisopropyl phosphite O,O-Diisopropyl phosphonate Phosphonic acid, bis(1-methylethyl) ester Phosphonic acid, diisopropyl ester
pdb file: 159040.pdb
sdf file: 159040.sdf
directory: 159040

1832-54-8 IMPA ISOPROPYL METHYLPHOSPHONATE Isopropyl methylphosphonic acid Monoisopropyl methylphosphonate O-Isoproyl hydrogen methylphosphonate Phosphonic acid, methyl isopropyl ester Phosphonic acid, methyl, monoisopropyl ester Phosphonic acid, methyl-, mono(1-methylethyl) ester
pdb file: 159076.pdb
sdf file: 159076.sdf
directory: 159076

1847-55-8 295327-05-8 9-OCTADECENYLSULFONIC ACID, SODIUM SALT 9-Octadecen-1-ol, hydrogen sulfate, sodium salt 9-Octadecen-1-ol, hydrogen sulfate, sodium salt, (9Z)- 9-Octadecen-1-ol, hydrogen sulfate, sodium salt, (Z)- EINECS 217-430-1 Sodium (Z)-octadec-9-enyl sulphate Sodium oleyl sulfate cis-9-Octadecenyl sulfate, sodium salt
pdb file: 159099.pdb
sdf file: 159099.sdf
directory: 159099

(Ethylenedinitrilo)tetraacetate dipotassium salt 2001-94-7 60-00-4 96420-48-3 ACETIC ACID, (ETHYLENEDINITRILO)TETRA-, DIPOTASSIUM SALT Ca2EDTA Dipotassium EDTA Dipotassium dihydrogen ethylenediaminetetraacetate Dipotassium ethylenediaminetetraacetate EINECS 217-895-0 Edetate dipotassium anhydrous Glycine, N,N'-1,2-ethanediylbis(N-(carboxymethyl)-, dipotassium salt N,N'-1,2-Ethanediylbis(N-(carboxymethyl)glycine), dipotassium salt
pdb file: 159428.pdb
sdf file: 159428.sdf
directory: 159428

(1,1'-Biphenyl)-3-sulfonic acid, 4,4'-diamino- 2051-89-0 4,4'-Diamino(1,1'-biphenyl)-3-sulphonic acid 4-14-00-02806 (Beilstein Handbook Reference) 4:4'-Diamino-3-diphenylyl hydrogen sulfate BIPHENYL-3-SULFONIC ACID, 4,4'-DIAMINO- BRN 3532578 Benzidine, 3-sulfo- Benzidine-3-sulfuric acid Benzidine-3-sulphuric acid EINECS 218-132-4
pdb file: 159586.pdb
sdf file: 159586.sdf
directory: 159586

2079-78-9 60-26-4 AMMONIUM, HEXAMETHYLENEBIS(TRIMETHYL-, TARTRATE (1:2) EINECS 218-207-1 Esonium Esotensyl Hexamethonium bitartrate Hexamethonium tartrate Hexamethonium tartrate [BAN] Hexamethylenebistrimethylammonium di(hydrogen tartrate) N,N-Hexamethylenebis(trimethylammonium) di(hydrogen tartrate) Tartaric acid, hexamethylenebis(trimethylammonium)salt (2:1) Vegolysen-T
pdb file: 159634.pdb
sdf file: 159634.sdf
directory: 159634

11138-19-5 161006-30-0 2235-43-0 6419-19-8 Aminotri(methylenephosphonic acid) pentasodium salt Aminotri(methylenephosphonic acid), pentasodium salt Aminotris(methylenephoshonic acid) pentasodium salt Aminotris(methylphosphonic acid), pentasodium salt Dequest 2006 EINECS 218-791-8 HSDB 5870 Kenrox 106 Nitrilo(methylenephosphonic acid), pentasodium salt Nitrilotri(methylenephosphonic acid), pentasodium salt Nitrilotris(methylenephosphonic acid) pentasodium salt PENTASODIUM NITRILOTRIS(METHYLENEPHOSPHONATE) Pentasodium (nitrilotris(methylene))trisphosphonate Pentasodium aminotrimethylene phosphonate Pentasodium aminotris(methylphosphonic acid) Pentasodium hydrogen C,C',C''-nitrilotris(methylphosphonate) Pentasodium(nitrilotris(methylene))triphosphonate Phosphonic acid, (nitrilotris(methylene))tri-, pentasodium salt Phosphonic acid, (nitrilotris(methylene))tris-, pentasodium salt
pdb file: 159924.pdb
sdf file: 159924.sdf
directory: 159924

2253-43-2 69941-00-0 DI-N-PROPYLPHOSPHORODITHIOIC ACID Dipropyl dithiophosphate Dipropyl phosphorodithioate EINECS 218-847-1 HSDB 2600 O,O-Dipropyl dithiophosphate O,O-Dipropyl hydrogen dithiophosphate O,O-Dipropyl phosphorodithioate O,O-Dipropyl phosphorodithiotic acid O,O-Dipropyldithiophosphoric acid Phosphorodithioic acid, O,O-dipropyl ester
pdb file: 159958.pdb
sdf file: 159958.sdf
directory: 159958

124-58-3 2321-53-1 Ammonium hydrogen methylarsonate Ammonium methanearsonate Ansar 157 Arsonic acid, methyl-, monoammonium salt Caswell No. 580C EPA Pesticide Chemical Code 013808 MAMA METHANEARSONIC ACID, MONOAMMONIUM SALT Methanearsonic acid, ammonium salt Methylarsonat monoamonny [Czech] Methylarsonic acid ammonium salt Monoammonium methanearsonate USAF AN-16
pdb file: 160068.pdb
sdf file: 160068.sdf
directory: 160068

2465-65-8 4486-42-4 5852-63-1 5871-17-0 DEPTh DETP DETP (ester) Diethyl hydrogen phosphorothionate Diethyl phosphorothionate Diethyl phosphothionate Ethyl phosphorothioate ((EtO)2(HS)PO) O,O-DIETHYL PHOSPHOROTHIOATE O,O-Diethyl hydrogen phosphorothioate O,O-Diethyl phosphorothiolate O,O-Diethyl phosphorothionate O,O-Diethyl thiophosphate Phosphorothioic acid, O,O-diethyl ester
pdb file: 160364.pdb
sdf file: 160364.sdf
directory: 160364

122392-55-6 12640-88-9 2-(3-((4-Amino-9,10-dihydro-3-sulpho-9,10-dioxoanthracen-4-yl)amino)benzenesulphonyl)vinyl disodium sulphate 2-Anthracenesulfonic acid, 1-amino-9,10-dihydro-4-(m-((2-hydroxyethyl)sulfonyl)anilino)-9,10-dioxo-, hydrogen sulfate (ester), disodium salt 2-Anthracenesulfonic acid, 1-amino-9,10-dihydro-4-(m-((2-hydroxyethyl)sulfonyl)anilino-9,10-dioxo-, hydrogen sulfate (ester), disodium salt 2-Anthracenesulfonic acid, 1-amino-9,10-dihydro-9,10-dioxo-4-((3-((2-(sulfooxy)ethyl)sulfonyl)phenyl)amino)-, disodium salt 2580-78-1 90598-99-5 95145-50-9 C.I. 61200 C.I. Reactive Blue 19 C.I. Reactive Blue 19, disodium salt CCRIS 3736 CI 61200 CI REACTIVE BLUE 19 CI Reactive Blue 19, disodium salt Cavalite Brilliant Blue R EINECS 219-949-9 HSDB 5534 Reactive Blue 19 Remalan Brilliant Blue R Remazol brilliant blue R
pdb file: 160580.pdb
sdf file: 160580.sdf
directory: 160580

14520-48-0 2616-64-0 30329-32-9 3545-73-1 5918-40-1 UDPGA URIDINE DIPHOSPHATE GLUCURONIC ACID Udp glucuronic acid Udp-glucuronic acid Uridine 5'-diphospho-glucuronic acid Uridine diphosphoglucuronic acid Uridinediphosphoglucuronic acid alpha-D-Glucopyranuronic acid, 1-P'-ester with uridine 5'-(trihydrogen diphosphate)
pdb file: 160632.pdb
sdf file: 160632.sdf
directory: 160632

2642-37-7 3-Indoxylsulfuric acid, potassium salt 487-94-5 EINECS 220-145-5 INDOL-3-OL, HYDROGEN SULFATE (ester), POTASSIUM SALT Indican Indol-3-ol, potassium sulfate Indol-3-yl potassium sulfate Indol-3-yl sulfate, potassium salt Potassium indol-3-yl sulfate Potassium indol-3-yl sulphate Urinary indican
pdb file: 160682.pdb
sdf file: 160682.sdf
directory: 160682

(1-Hydroxyethylidene)diphosphonic acid, trisodium salt 2666-14-0 DIPHOSPHONIC ACID, (1-HYDROXYETHYLIDENE)-, TRISODIUM SALT EINECS 220-200-3 Ethane-1-hydroxy-1,1-diphosphonic acid, trisodium salt Phosphonic acid, (1-hydroxyethylidene)bis-, trisodium salt Trisodium etidronate Trisodium hydrogen (1-hydroxyethylidene)bisphosphonate
pdb file: 160722.pdb
sdf file: 160722.sdf
directory: 160722

1,2,3-Propanetricarboxylic acid, 2-hydroxy-, diammonium salt 2-Hydroxy-1,2,3-propanetricarboxylic acid, diammonium salt 3012-65-5 AI3-26173 AmmCitrate Ammonium citrate, dibasic Ammonium monohydrogen citrate Ammonium monohydrogencitrat Citric acid, diammonium salt DIAMMONIUM CITRATE Diammonium 2-hydroxy-1,2,3-propanetricarboxylate Diammonium citrate (secondary) Diammonium hydrogen 2-hydroxypropane-1,2,3-tricarboxylate Diammonium hydrogen citrate Dibasic ammonium citrate EINECS 221-146-3 HSDB 300 Microstop
pdb file: 161242.pdb
sdf file: 161242.sdf
directory: 161242

150815-54-6 24739-34-2 3063-71-6 31921-05-8 CMP acetylneuraminic acid CYTIDINE MONOPHOSPHATE N-ACETYLNEURAMINIC ACID Cmp-nana D-glycero-beta-D-galacto-2-Nonulopyranosonic acid, 5-(acetylamino)-3,5-dideoxy-, 2-(hydrogen 5'-cytidylate)
pdb file: 161337.pdb
sdf file: 161337.sdf
directory: 161337

3095-65-6 526-93-2 AMMONIUM BITARTRATE Ammonium hydrogen tartrate Butanedioic acid, 2,3-dihydroxy- (2R,3R)-, monoammonium salt EINECS 221-442-2
pdb file: 161393.pdb
sdf file: 161393.sdf
directory: 161393

2-(Diethylamino)ethyl tetrahydro-alpha-(1-naphthylmethyl)-2-furanpropionate oxalate (1:1) 2-FURANPROPIONIC ACID, TETRAHYDRO-alpha-(1-NAPHTHYLMETHYL)-, 2-(DIETHYLAMINO)ETH 2-Furanpropanoic acid, tetrahydro-alpha-(1-naphthalenylmethyl)-, 2-(diethylamino)ethyl ester, ethanedioate (1:1) 2-Furanpropionic acid, tetrahydro-alpha-(1-naphthylmethyl)-, 2-(diethylamino)ethyl ester, oxalate (1:1) 26263-44-5 3200-06-4 Diethyl(2-(2-(1-naphthylmethyl)-3-(tetrahydro-2-furyl)propionyloxy)ethyl)ammonium hydrogen oxalate Dubimax Dusodril EINECS 221-703-0 EU-1806 Gevatran Iridus LS 121 NSC 225233 Nafronyl acid oxalate Nafronyl oxalate Nafronyl oxalate [USAN] Naftidrofuryl oxalate Naphtidrofuryl oxalate Praxilene
pdb file: 161558.pdb
sdf file: 161558.sdf
directory: 161558

3387-36-8 5'-UMP disodium 5'-URIDYLIC ACID, DISODIUM SALT 5'-Uridylic acid, disodium salt (8CI)(9CI) CCRIS 6562 Disodium 5'-UMP Disodium 5'-uridylate Disodium UMP Disodium uridine 5'-monophosphate Disodium uridine 5'-phosphate Disodium uridine-5'-monophosphate EINECS 222-211-9 NSC 20257 Uridine 5'MP, disodium salt Uridine, 5'-dihydrogen phosphate, disodium salt Uridine-5-monophosphate disodium salt
pdb file: 161800.pdb
sdf file: 161800.sdf
directory: 161800

(2-((Dichloroacetyl)amino)-3-hydroxy-3-(4-nitrophenyl)propyl) hydrogen (R-(R*,R*))-succinate 3544-94-3 4-13-00-02756 (Beilstein Handbook Reference) 982-57-0 BRN 3228488 CHLORAMPHENICOL SUCCINATE CPSA Chloramphenicol acid succinate Chloramphenicol hemisuccinate Chloramphenicol hydrogen succinate Chloramphenicol monosuccinate Chloromycetin succinate Chronicin foam EINECS 222-590-0 Kemicetine succinate Levomycetin hemisuccinate Levomycetin succinate Paraxin succinate Succinato de cloranfenicol [Spanish] Succinic acid, alpha-monoester with D-threo-(-)-2,2-dichloro-N-(beta-hydroxy-alpha-(hydroxymethyl)-p-nitrophenethyl)acetamide
pdb file: 162017.pdb
sdf file: 162017.sdf
directory: 162017

10-(3-(Dimethylamino)propyl)phenothiazin-2-yl methyl ketone maleate (1:1) 2-Acetyl-10-(3-(dimethylamino)propyl)phenothiazine, maleate 2664-15-5 3598-37-6 61-00-7 A 23051 Acepromazine hydrogen maleate Acepromazine maleate Acepromazine maleate [USAN] Acepromazine monomaleate Acetylpromazine maleate (1:1) Anatran EINECS 222-748-9 Ethanone, 1-(10-(3-(dimethylamino)propyl)-10H-phenothiazin-2-yl)-, (Z)-2-butenedioate (1:1) KETONE, 10-(3-(DIMETHYLAMINO)PROPYL)PHENOTHIAZIN-2-YL METHYL, MALEATE (1:1) Maleate acide de l'acetyl 3-dimethylamino 3-propyl-10-phenothiazine [French] NSC 264522 Notensil maleate Phenothiazine, 2-acetyl-10-(3-(dimethylamino)propyl)-, maleate Plegicil Sedalin Soprontin
pdb file: 162128.pdb
sdf file: 162128.sdf
directory: 162128

16059-99-7 3615-82-5 Calcium-magnesium phytate EINECS 222-798-1 Eviunis Forglesan Fosforo de Angeli INOSITOL, HEXAKIS(DIHYDROGEN PHOSPHATE), CALCIUM MAGNESIUM SALT, myo- Inophosphan Inositocalcium Phosbiose Phytic acid calcium magnesium salt Phytin Phytocalcium Phytophosphine myo-Inositol, hexakis(dihydrogen phosphate), calcium magnesium salt
pdb file: 162175.pdb
sdf file: 162175.sdf
directory: 162175

103-22-0 131749-47-8 148240-01-1 3658-48-8 4-01-00-01785 (Beilstein Handbook Reference) BIS(2-ETHYLHEXYL) HYDROGEN PHOSPHITE BRN 1711893 Bis(2-ethylhexyl) phosphite Bis(2-ethylhexyl) phosphonate Bis(2-ethylhexyl) phosphonic acid Chelex H 8 Di-2-ethylhexyl hydrogen phosphite Di-2-ethylhexyl phosphite Diisooctyl phosphite EINECS 222-904-6 HSDB 2607 NSC 2664 Phosphonic acid, bis(2-ethylhexyl) ester Phosphorous acid, bis(2-ethylhexyl) ester
pdb file: 162242.pdb
sdf file: 162242.sdf
directory: 162242

3724-89-8 CYSTEAMINE-S-PHOSPHORIC ACID SODIUM SALT Cistaphos Cystafos Cystaphos Cystaphos sodium salt EINECS 223-079-5 Ethanethiol, 2-amino-, dihydrogen phosphate (ester), monosodium salt Ethanethiol, 2-amino-, dihydrogen phosphate(ester), monosodium salt Ethanethiol, 2-amino-, dihydrogen phosphate, monosodium salt Monosodium beta-aminoethyl thiophosphate NSC 87174 Phosphocysteamine Phosphorothioic acid, S-(2-aminoethyl) ester, monosodium salt S-(2-Aminoethyl) thiophosphate monosodium salt S-(2-Aminoethyl)thiophosphate monosodium salt Sodium beta-aminoethyl thiophosphate Sodium hydrogen -S-(2-aminoethyl)thiophosphate Sodium hydrogen S-(2-aminoethyl) phosphorothioic acid Sodium hydrogen S-(2-aminoethyl)phosphorothioate Sodium hydrogen S-(2-aminoethyl)phosphorothioic acid Tsistafos Tsistafos (cystafos) WR 638
pdb file: 162418.pdb
sdf file: 162418.sdf
directory: 162418

(2-(Diethylthiophosphor-S-yl)ethyl)diethylammonium hydrogen oxalate 3734-97-2 78-53-5 AI3-20993 Amiton hydrogen oxalate Amiton oxalate Caswell No. 333E Chipman R-6,199 Citram EINECS 223-100-8 ENT 20,993 EPA Pesticide Chemical Code 057301 Hydrogen oxalate of amiton O,O-Diethyl S-(2-ethyl-N,N-diethylamino)phosphorothioate hydrogen oxalate O,O-Diethyl S-(beta-diethylamino)ethyl phosphorothiolate hydrogen oxalate O,O-Diethyl-S-(2-diethylamino)ethylphosphorothioate hydrogen oxalate Phosphorothioic acid, S-(2-(diethylamino)ethyl) O,O-diethyl ester, ethanedioate (1:1) Phosphorothioic acid, S-(2-(diethylamino)ethyl) O,O-diethyl ester, oxalate (1:1) S-(2-(Diethylamino)ethyl) O,O-diethyl phosphorothioate hydrogen oxalate S-(2-Diethylaminoethyl) O,O-diethylphosphorothioate hydrogenoxalate TETRAM Tetram 75 Tetram monooxalate Tetram, acid oxalate
pdb file: 162440.pdb
sdf file: 162440.sdf
directory: 162440

1206 Blue 145087-80-5 25305-78-6 3844-45-9 70992-30-2 73319-02-5 82526-32-7 83155-13-9 Acid Sky Blue A Aizen Food Blue No. 2 Ammonium, ethyl(4-(p-(ethyl(m-sulfobenzyl)amino)-alpha-(o-sulfophenyl)benzylidene)-2,5-cyclohexadien-1-ylidene)(m-sulfobenzyl)-, hydroxide, inner salt, disodium salt Benzenemethanaminium, N-ethyl-N-(4-((4-(ethyl((3-sulfophenyl)methyl)amino)phenyl)(2-sul- fophenyl)methylene)-2,5-cyclohexadien-1-ylidene)-3-sulfo-, hydroxide, inner salt, disodium salt Benzenemethanaminium, N-ethyl-N-(4-((4-(ethyl((3-sulfophenyl)methyl)amino)phenyl)(2-sulfophenyl)methylene)-2,5-cyclohexadien-1-ylidene)-3-sulfo-, hydroxide, inner salt, disodium salt Benzenemethanaminium, N-ethyl-N-(4-((4-(ethyl((3-sulfophenyl)methyl)amino)phenyl)(2-sulfophenyl)methylene)-2,5-cyclohexadien-1-ylidene)-3-sulfo-, inner salt, disodium salt Blue 1206 Brilliant Blue FCF Brilliant Blue FCF supra C.I. ACID BLUE 9, DISODIUM SALT C.I. Food Blue 2 CCRIS 97 Canacert Brilliant Blue FCF Cosmetic Blue Lake Dihydrogen (ethyl)(4-(4-(ethyl(3-sulphonatobenzyl)amino)-2'-sulphonatobenzhydrylidene)cyclohexa-2,5-dien-1-ylidene)(3-sulphonatobenzyl)ammonium, disodium salt Dolkwal Brilliant Blue EINECS 223-339-8 FD & C Blue no. 1 FD and C Blue No. 1 FD&C Blue No. 1
pdb file: 162593.pdb
sdf file: 162593.sdf
directory: 162593

11beta,17,21-Trihydroxypregn-4-ene-3,20-dione 21-(dihydrogen phosphate) 21-Hydrocortisonephosphoric acid 3863-59-0 CORTISOL, 21-(DIHYDROGEN PHOSPHATE) Corphos Cortisol 21-phosphate Cortisol phosphate Cortisol, phosphate (salt) EINECS 223-382-2 Hydrocortisone 21-(dihydrogen phosphate) Hydrocortisone 21-phosphate Hydrocortisone cortisol 21-(dihydrogen phosphate) Hydrocortisone phosphate Hydrocortisone-21-phosphate NSC 529660 Pregn-4-ene-3,20-dione, 11,17-dihydroxy-21-(phosphonooxy)-, (11-beta)- (9CI)
pdb file: 162624.pdb
sdf file: 162624.sdf
directory: 162624

3900-04-7 EINECS 223-451-7 HEXYL PHOSPHATE HSDB 2608 Hexyl dihydrogen phosphate Monohexyl dihydrogen phosphate Monohexyl phosphate Phosphoric acid, monohexyl ester
pdb file: 162669.pdb
sdf file: 162669.sdf
directory: 162669

3991-73-9 4-01-00-01762 (Beilstein Handbook Reference) AI3-15053 BRN 1707496 EINECS 223-638-3 HSDB 2610 MONOOCTYL PHOSPHATE Monooctylphosphoric acid Octyl dihydrogen phosphate Octylphosphate Phosphoric acid, monooctyl ester
pdb file: 162760.pdb
sdf file: 162760.sdf
directory: 162760

120246-47-1 2,5,7,8-Tetramethyl-2-(4,8,12-trimethyltridecyl)-6-chromanyl hydrogen succinate, (+)- 4345-03-3 53532-12-0 55134-51-5 6-Chromanol, 2,5,7,8-tetramethyl-2-(4,8,12-trimethyltridecyl)-, hydrogen succinate, (+)- Butanedioic acid, mono((2R)-3,4-dihydro-2,5,7,8-tetramethyl-2-((4R,8R)-4,8,12-trimethyltridecyl)-2H-1-benzopyran-6-yl) ester Butanedioic acid, mono(3,4-dihydro-2,5,7,8-tetramethyl-2-(4,8,12-trimethyltridecyl)-2H-1-benzopyran-6-yl) ester, (2R-(2R*( Butanedioic acid, mono(3,4-dihydro-2,5,7,8-tetramethyl-2-(4,8,12-trimethyltridecyl)-2H-1-benzopyran-6-yl) ester, (2R-(2R*(4R*,8R*)))- CCRIS 4734 D-ALPHA-TOCOPHERYL SUCCINATE D-alpha tocopheryl acid succinate EINECS 224-403-8 Mono(2,5,7,8-tetramethyl-2-(4,8,12-trimethyltridecyl)-6-chromanyl) succinate, (+)- Mono(3,4-dihydro-2,5,7,8-tetramethyl-2-(4,8,12-trimethyltridecyl)-2H-1-benzopyran-6-yl) butanedioate, (2R-(2R*(4R*,8R*)))- NSC 173849 Succinic acid, mono(2,5,7,8-tetramethyl-2-(4,8,12-trimethyltridecyl)-6-chromanyl) ester, (+)- Succinic acid, mono(2,5,7,8-tetramethyl-2-(4,8,12-trimethyltridecyl)-6-chromanyl) ester, (+)- (8CI) Tocopherol acid succinate, alpha- Vitamin E hemisuccinate Vitamin E succinate Vitamine E succinate alpha-Tocopherol acid succinate, D- alpha-Tocopherol hemisuccinate alpha-Tocopherol, succinate (6CI) alpha-Tocopheryl acid succinate alpha-Tocopheryl hydrogen succinate alpha-Tocopheryl succinate alpha-Tocopheryl succinate, D- d-alpha-Tocopherol acid succinate d-alpha-Tocopheryl acid succinate
pdb file: 163174.pdb
sdf file: 163174.sdf
directory: 163174

1,2-Benzenedicarboxylic acid, monomethyl ester (9CI) 4376-18-5 AI3-02332 D 3 D 3 (VAN) EINECS 224-476-6 MONOMETHYL PHTHALATE Methyl hydrogen phthalate Methyl phthalate (VAN) Monomethyl 1,2-benzenedicarboxylate NSC 8281 Phthalic acid, monomethyl ester (8CI) o-(Methoxycarbonyl)benzoic acid
pdb file: 163214.pdb
sdf file: 163214.sdf
directory: 163214

(2-Ethylhexyl) hydrogen phthalate 1,2-Benzenedicarboxylic acid, mono(2-ethylhexyl) ester (9CI) 2-Ethylhexyl hydrogen phthalate 25425-73-4 4376-20-9 BAR 1 CCRIS 1742 EINECS 224-477-1 MONO-2-ETHYLHEXYL PHTHALATE Mono(2-ethylhexyl) phthalate Mono(2-ethylhexyl)phthalate Mono-(2-ethylhexyl)phthalate Monoethylhexyl phthalate Phthalate, mono(2-ethylhexyl) Phthalic acid, 2-ethylhexyl ester (6CI,7CI) Phthalic acid, mono-(2-ethylhexyl) ester
pdb file: 163215.pdb
sdf file: 163215.sdf
directory: 163215

1-Propanol, 2-chloro-, hydrogen phosphate, ester with 3-chloro-7-hydroxy-4-methylcoumarin 4482-85-3 COUMARIN, 3-CHLORO-7-HYDROXY-4-METHYL-, BIS(2-CHLOROPROPYL)PHOSPHATE Phosphoric acid, 3-chloro-4-methyl-2-oxo-2H-1-benzopyran-7-yl bis(2-chloropropyl) ester
pdb file: 163385.pdb
sdf file: 163385.sdf
directory: 163385

1-Propylphosphonic acid 4-04-00-03542 (Beilstein Handbook Reference) 4672-38-2 BRN 1747443 DIHYDROGEN PROPYLPHOSPHONATE EINECS 225-121-8 NIA 10656 PPA Phosphonic acid, propyl- Phosphorous acid, monoanhydride with methyl hydrogen 4-morpholinylphosphonate, diethyl ester Propanephosphonic acid Propylphosphonic acid
pdb file: 163592.pdb
sdf file: 163592.sdf
directory: 163592

1-Tetradecanol hydrogen sulfate 1-Tetradecanol, hydrogen sulfate 4754-44-3 EINECS 225-281-9 TETRADECYL SULFATE Tetradecyl hydrogen sulphate Tetradecyl sulfuric acid
pdb file: 163671.pdb
sdf file: 163671.sdf
directory: 163671

4891-15-0 BRN 1898199 EINECS 225-512-3 ESTRAMUSTINE PHOSPHATE Emcyt (free acid) Estra-1,3,5(10)-triene-3,17-diol (17beta)-, 3-(bis(2-chloroethyl)carbamate) 17-(dihydrogen phosphate) (9CI) Estra-1,3,5(10)-triene-3,17beta-diol 3-(bis(2-chloroethyl)carbamate) 17-(dihydrogen phosphate) Estracyt Estradiol, 3-(bis(2-chloroethyl)carbamate) dihydrogen phosphate LS 299 Leo 299 NSC 89199
pdb file: 163789.pdb
sdf file: 163789.sdf
directory: 163789

1,1'-METHYLENEBIS(4-ISOCYANATOCYCLOHEXANE) 1,1-Methylenebis(4-isocyanatocyclohexane) [Diisocyanates] 103072-21-5 107314-16-9 123773-48-8 190601-97-9 201536-77-8 4,4'-Diisocyanatodicyclohexylmethane 4,4'-Methylenedicyclohexyl diisocyanate 5124-30-1 68966-63-2 73156-15-7 88504-76-1 BRN 2217800 Bis(4-isocyanatocyclohexyl)methane CP 99173 Cyclohexane, 1,1'-methylenebis(4-isocyanato- Dicyclohexylmethane 4,4'-diisocyanate Dicyclohexylmethane-4,4'-diisocyanate EINECS 225-863-2 HSDB 7189 Hydrogenated MDI Hylene W Isocyanic acid, methylenedi-4,1-cyclohexylene ester Methylene bis(4-cyclohexylisocyanate) Methylene bis-(4-cyclohexylisocyanate) Methylenebis(4-cyclohexylisocyanate) Nacconate H 12
pdb file: 163976.pdb
sdf file: 163976.sdf
directory: 163976

1-Propanol, 2,3-dibromo-, dihydrogen phosphate 1-Propanol, 2,3-dibromo-, phosphate (1:1) 2,3-DIBROMOPROPYLPHOSPHATE 2,3-Dibromo-1-propanol dihydrogen phosphate 2,3-Dibromopropyl dihydrogen phosphate 43110-33-4 5324-12-9 85771-01-3 AI3-19168 EINECS 226-192-8 Mono(2,3-dibromopropyl)phosphate Mono(2,3-dibromopropyl)phosphoric acid NSC 2862 Phosphoric acid, mono(2,3-dibromopropyl) ester
pdb file: 164144.pdb
sdf file: 164144.sdf
directory: 164144

2,7-Naphthalenedisulfonic acid, 4-amino-5-hydroxy-, monosodium salt 4-AMINO-5-HYDROXY-2,7-NAPHTHALENEDISULFONIC ACI* 4-Amino-5-hydroxy-2,7-naphthalenedisulfonic acid, monosodium 5460-09-3 8-Amino-1-naphthol-3,6-disulfonic acid monosodium salt Ash acid CCRIS 8903 EINECS 226-736-4 H acid monosodium salt NSC 8632 Sodium hydrogen 4-amino-5-hydroxynaphthalene-2,7-disulphonate
pdb file: 164344.pdb
sdf file: 164344.sdf
directory: 164344

10279-69-3 12392-58-4 3-Hydroxy-4-((2-hydroxy-1-naphthalenyl)azo)-7-nitro-1-naphthalenesulfonic acid, monosodium salt, chromium complex 34464-60-3 5610-64-0 ACID BLACK 52 C.I. Acid Black 52 CI 15711 Chromate(3-), bis(3-hydroxy-4-((2-hydroxy-1-naphthalenyl)azo)-7-nitro-1-naphthalenesulfonato(3-))-, disodium hydrogen EINECS 227-029-3 HSDB 4205
pdb file: 164532.pdb
sdf file: 164532.sdf
directory: 164532

1,3-Cyclopentanedicarboxylic acid, 1,2,2-trimethyl-, 1-(1-(4-methylphenyl)ethyl) ester, compd. with 2,2'-iminobis(ethanol) (1:1) 1,3-Cyclopentanedicarboxylic acid, 1,2,2-trimethyl-, 1-(1-(4-methylphenyl)ethyl)ester, compd. with 2,2'-iminobis(ethanol)(1:1) 1-(p,alpha-Dimethylbenzyl) camphorate compound with 2,2'-iminodiethanol (1:1) 5634-42-4 Benzyl alcohol, p,alpha-dimethyl-, 3-hydrogen (+)-camphorate, compd. with 2,2'-iminodiethanol (1:1) Biliphorin Biliphorine CAMPHORIC ACID, 1-(p,alpha-DIMETHYLBENZYL) ESTER, compd. with 2,2'-IMINODIETHANO Camphoric acid, 1-(p,alpha-dimethylbenzyl) ester, compd. with 2,2'-iminodiethanol (1:1) Camphoric acid, p,alpha-dimethylbenzyl ester, compd. with 2,2'-iminodiethanol Diethanolamine p-tolylmethylcarbinol camphorate Diethanolamine salt of the mono-(+)-camphoric acid ester of p-tolylmethylcarbinol EINECS 227-081-7 Ethanol, 2,2'-iminobis-, 1-(1-(4-methylphenyl)ethyl) 1,2,2-trimethyl-1,3-cyclopentanedicarboxylate (salt) Ethanol, 2,2'-iminodi-, 1-(p,alpha-dimethylbenzyl)camphorate (salt) Gallogen Gallogen (choleretic) Hepasynthyl Hepatoxane Licarbin Lymethol Syncuma Synthobilin Tocamphyl Tocamphyl [USAN:INN] Tocamphylum [INN-Latin] Tocanfil [INN-Spanish] Tolylmethyl carbinol mono-D-camphoric acid
pdb file: 164561.pdb
sdf file: 164561.sdf
directory: 164561

108064-10-4 13020-80-9 3-(3-CARBOXY-1-OXOPROPOXY)-11-OXOOLEAN-12-EN-2*- 3-beta-(3-Carboxypropionyloxy)-11-oxo-olean-12-en-30-oic acid 3beta-(3-Carboxypropionyloxy)-11-oxo-olean-12-en-30-saeure 3beta-Hydroxy-11-oxoolean-12-en-30-saeure hydogensuccinat 5697-56-3 60093-85-8 7421-40-1 Biogastrone Bioral Carbenoxolona [INN-Spanish] Carbenoxolone Carbenoxolonum [INN-Latin] EINECS 227-174-2 Olean-12-en-29-oic acid, 3-(3-carboxy-1-oxopropoxy)-11-oxo-, (3beta,20beta)- Olean-12-en-30-oic acid, 3-beta-hydroxy-11-oxo-, hydrogen succinate
pdb file: 164621.pdb
sdf file: 164621.sdf
directory: 164621

5798-43-6 BISMUTH SODIUM TRIGLYCOLLAMATE Bismut natrium triglycollamat Bismuth Sodium Triglycollamate [USAN] Bismuth, oxo(dihydrogen nitrilotriacetato)-, sodium salt, compd. with disodium nitrilotriacetate (1:3) Bistrimate Heptanatrium-bismut(III)-oxid-tetrahydrogen-tetrakis(nitrilotriacetat) Nitriloacetic acid bismuth complex sodium salt
pdb file: 164740.pdb
sdf file: 164740.sdf
directory: 164740

5810-88-8 BIS(2-ETHYLHEXYL) PHOSPHORODITHIOATE BRN 1913062 Bis(2-ethylhexyl) dithiophosphate Bis(2-ethylhexyl) hydrogen dithiophosphate Di-2-ethylhexylphosphorodithioic acid EINECS 227-376-0 HSDB 2612 O,O'-Di(2-ethylhexyl) dithiophosphoric acid O,O-Bis(2-ethylhexyl) dithiophosphate O,O-Bis(2-ethylhexyl) hydrogen dithiophosphate O,O-Bis(2-ethylhexyl) hydrogen phosphorothioate O,O-Bis(2-ethylhexyl) phosphorodithioate Phoslex DT 8 Phosphorodithioic acid, O,O-bis(2-ethylhexyl) ester
pdb file: 164758.pdb
sdf file: 164758.sdf
directory: 164758

5827-03-2 AI3-24725 CARBAMIC ACID, DIETHYLDITHIO-, ANHYDROSULFIDE with O,O-DIISOPROPYLPHOSPHORODITHI Carbamic acid, diethyldithio-, anhydrosulfide with O,O-diisopropylphosphorodithioate Carbamodithioic acid, diethyl-, anhydrosulfide with O,O-bis(1-methylethyl) hydrogen phosphorodithioate Diethyldithiocarbamic anhydride of O,O-diisopropyl thionophosphoric acid Diethyldithiocarbamic phosphorodithioic anhydrosulfide, O,O-diisopropyl ester Diisopropyl ester of dithiocarbamyl phosphorothioic acid ENT 24,725 Holcomb compound 326 N,N-Diethylthiocarbamyl O,O-diisopropyldithiophosphate O,O-Diiospropyl dithiophosphoric acid ester of N,N-diethyldithiocarbamic anhydrosulfide O,O-Diisopropyl-S-diethyldithiocarbamoylphosphorodithioate S-Diethylthiocarbamoyl O,O-diisopropyl phosphorothioate
pdb file: 164775.pdb
sdf file: 164775.sdf
directory: 164775

5827-04-3 CARBAMIC ACID, DIETHYLDITHIO-, ANHYDROSULFIDE with O,O-DIPROPYLPHOSPHORODITHIOAT Carbamic acid, diethyldithio-, anhydrosulfide with O,O-dipropylphosphorodithioate, compd. with hydrogen sulfide (1:1) Compound 325 Holcomb compound 325 O,O-Diisopropyl S-(diethylthiocarbamyl)thiothionophosphate hydrosulfide O,O-Diisopropyl-S-(diethylthiocarbamyl)phosphorodithioate hydrosulfide
pdb file: 164776.pdb
sdf file: 164776.sdf
directory: 164776

5863-46-7 Benzenemethanaminium, N-(4-((4-(diethylamino)-2-methylphenyl)(4-(ethyl((3-sulfophenyl)methyl)amino)phenyl)methylene)-2,5-cyclohexadien-1-ylidene)-N-ethyl-3-sulfo-, hydroxide, inner salt, sodium salt Benzenemethanaminium, N-(4-((4-(diethylamino)-2-methylphenyl)(4-(ethyl((3-sulfophenyl)methyl)amino)phenyl)methylene)-2,5-cyclohexadien-1-ylidene)-N-ethyl-3-sulfo-, inner salt, sodium salt C.I. ACID BLUE 15, SODIUM SALT EINECS 227-511-3 Hydrogen (4-((4-(diethylamino)-o-tolyl)(4-(ethyl(3-sulphonatobenzyl)amino)phenyl)methylene)cyclohexa-2,5-dien-1-ylidene)(ethyl)(3-sulphonatobenzyl)ammonium, sodium salt
pdb file: 164829.pdb
sdf file: 164829.sdf
directory: 164829

5892-48-8 97-44-9 Arsonic acid, (3-(acetylamino)-4-hydroxyphenyl)-, monosodium salt (9CI) EINECS 227-573-1 Sodium N-acetyl-4-hydroxy-m-arsanilate Sodium acetarsone Sodium hydrogen (3-acetamido-4-hydroxyphenyl)arsonate m-ARSANILIC ACID, N-ACETYL-4-HYDROXY-, SODIUM SALT
pdb file: 164856.pdb
sdf file: 164856.sdf
directory: 164856

124-58-3 5902-95-4 CMA Calar Calcium acid methanearsonate Calcium acid methyl arsonate Calcium bis(hydrogen methylarsonate) Calcium bis(methylarsonate) Calcium hydrogen methanearsonate Calcium hydrogen methylarsonate Calcium methanearsonate Caswell No. 136D EINECS 227-598-8 Methanearsonic acid, calcium salt (2:1) Super crab-E-rad-calar Super dal-E-rad Super dal-E-rad-calar USAF AN-11
pdb file: 164866.pdb
sdf file: 164866.sdf
directory: 164866

6209-50-3 METHENAMINE SULFOSALICYLATE Salicylic acid, hydrogen sulfate, compd. with hexamethylene tetramine (1:1)
pdb file: 165227.pdb
sdf file: 165227.sdf
directory: 165227

60-00-4 6381-92-6 ACETIC ACID, (ETHYLENEDINITRILO)TETRA-, DISODIUM SALT, DIHYDRATE Collyrium Fresh-Eye Drops Disodium (ethylenedinitrilo)tetraacetate dihydrate Disodium EDTA dihydrate Disodium dihydrogen ethylenediaminetetraacetate dihydrate Disodium edetate dihydrate Disotate EDTA disodium dihydrate Edetate Disodium [USAN:BAN] Ethylenediaminetetraacetic acid disoium salt dihydrate Glycine, N,N'-1,2-ethanediylbis(N-(carboxymethyl)-, disodium salt, dihydrate
pdb file: 165479.pdb
sdf file: 165479.sdf
directory: 165479

6408-22-6 C.I. ACID BLACK 84 Chromate(7-), bis(4-(hydroxy-kappaO)-3-((2-(hydroxy-kappaO)-5-nitro-3-sulfophenyl)azo-kappaN1)-6-((sulfomethyl)amino)-2-naphthalenesulfonato(5-))-, hexasodium hydrogen Chromate(7-), bis(4-hydroxy-3-((2-hydroxy-5-nitro-3-sulfophenyl)azo)-6-((sulfomethyl)amino)-2-naphthalenesulfonato(5-))-, hexasodium hydrogen EINECS 229-050-3 Hexasodium hydrogen bis(4-hydroxy-3-((2-hydroxy-5-nitro-3-sulphophenyl)azo)-6-((sulphomethyl)amino)naphthalene-2-sulphonato(5-))chromate(7-)
pdb file: 165501.pdb
sdf file: 165501.sdf
directory: 165501

6408-31-7 Bucolan Red GRE C.I. 18800 C.I. ACID RED 183 C.I. Acid Red 183 (8CI) Chromate(2-), (5-chloro-3-((4,5-dihydro-3-methyl-5-(oxo-kappaO)-1-(3-sulfophenyl)-1H-pyrazol-4-yl)azo-kappaN1)-2-(hydroxy-kappaO)benzenesulfonato(4-))hydroxy-, disodium, (T-4)- Chromate(5-), bis(5-chloro-3-((4,5-dihydro-3-methyl-5-oxo-1-(3-sulfophenyl)-1H-pyrazol-4-yl)azo)-2-hydroxybenzenesulfonato(4-))-, tetrasodium hydrogen (9CI) Chrome Intra Red GRE Chromolan Red GRE Disodium (5-chloro-3-((4,5-dihydro-3-methyl-5-oxo-1-(3-sulphophenyl)-1H-pyrazol-4-yl)azo)-2-hydroxybenzene-1-sulphonato(4-))hydroxychromate(2-) EINECS 229-054-5 Efdolan Red GRN Gycolan Red GRL Inochrome Red 3J NSC 324571 Neolan Red GRE Nyasol Red GGS Palatine Fast Red GREN Pilate Fast Red GREN Super Fast Red GRE Tertroxane Red G Vitrolan Red GRE
pdb file: 165502.pdb
sdf file: 165502.sdf
directory: 165502

1,2,4-DITHIAZOLIDINE-3-THIONE, 5-IMINO- 1,2,4-Dithiazole-3-thione, 5-amino- 3H-1,2,4-Dithiazole-3-thione, 5-amino- (8CI)(9CI) 4-27-00-06755 (Beilstein Handbook Reference) 5-Amino-3H-1,2,4-dithiazole-3-thione 5-Imino-1,2,4-dithiazolidine-3-thione 6846-35-1 AI3-61346 BRN 0112403 EINECS 229-933-3 Isoperthiocyanic acid NSC 65248 Xanthahydrogen Xanthane hydride Xanthanohydrogen
pdb file: 165860.pdb
sdf file: 165860.sdf
directory: 165860

7057-92-3 AI3-23305 DI-N-DODECYL PHOSPHATE Didodecyl hydrogen phosphate Didodecyl phosphate Didodecylphosphoric acid Dilauryl acid phosphate Dilauryl phosphate Dodecyl phosphate ((C12H25O)2(HO)PO) EINECS 230-341-2 ELA HSDB 2614 NSC 12427 Ortholeum 162 Phosphonic acid, didodecyl ester Phosphoric acid, didodecyl ester
pdb file: 166043.pdb
sdf file: 166043.sdf
directory: 166043

4-04-00-03524 (Beilstein Handbook Reference) 7305-61-5 BRN 1749049 Ethylphosphonic acid ethyl ester O-ETHYL ETHYLPHOSPHONATE O-Ethyl ethanephosphonic acid O-Ethyl hydrogen ethylphosphonate Phosphonic acid, ethyl-, ethyl ester Phosphonic acid, ethyl-, monoethyl ester
pdb file: 166291.pdb
sdf file: 166291.sdf
directory: 166291

7308-25-0 CARBONIC ACID, DITHIO-, O-DECYL ESTER, POTASSIUM SALT Carbonodithioic acid, O-decyl ester, potassium salt (9CI) Dithiocarbonic acid O-decyl ester potassium salt EINECS 230-763-7 O-Decyl hydrogen dithiocarbonate , potassium salt Potassium decylxanthate Xanthic acid, decyl-, potassium salt
pdb file: 166293.pdb
sdf file: 166293.sdf
directory: 166293

4-09-00-00948 (Beilstein Handbook Reference) 7334-48-7 BENZOIC ACID, ANHYDRIDE with DIETHYL HYDROGEN PHOSPHATE BRN 2055366 Benzoic acid, anhydride with diethyl phosphate Benzoyl diethyl phosphate O,O-Diethyl O-benzoyl phosphate
pdb file: 166311.pdb
sdf file: 166311.sdf
directory: 166311

(1-Hydroxyethane-1,1-diyl)diphosphonic acid disodium salt (1-Hydroxyethylidene)diphosphonic acid, disodium salt 1-HYDROXYETHANE-1,1-DIPHOSPHONATE, DISODIUM SALT 1-Hydroxyethylidene-1,1-diphosphonic acid disodium salt 187285-10-5 7414-83-7 Didronel Didronel R Diphos Disodium (1-hydroxyethylidene)diphosphonate Disodium 1-hydroxyethylidene phosphonate Disodium dihydrogen (1-hydroxyethylidene)bisphosphonate Disodium dihydrogen (1-hydroxyethylidene)diphosphonate Disodium ethane-1-hydroxy-1,1-diphosphonate Disodium ethanol-1,1-diphosphonate Disodium ethydronate Disodium etidronate EINECS 231-025-7 Ethane-1-hydroxy-1,1-diphosphonate, disodium salt Ethane-1-hydroxy-1,1-diphosphonic acid, disodium salt Etidronate Disodium [USAN:JAN] Etidronate disodium Etidronic acid disodium Etidronsaeure dinatriumsalz Phosphonic acid, (1-hydroxyethylidene)bis-, disodium salt Phosphonic acid, (1-hydroxyethylidene)di-, disodium salt SM-5600 Sodium ethidronate Sodium ethydronate Sodium etidronate
pdb file: 166421.pdb
sdf file: 166421.sdf
directory: 166421

18-beta-Glycyrrhetinic acid hydrogen succinate, disodium salt 3-O-(beta-Carboxypropionyl)-11-oxo-18-beta-olean-12-en-30-oic acid, disodium salt 3-beta-Hydroxy-11-oxoolean-12-en-30-oic acid hydrogen succinate, disodium salt 3beta-Hydroxy-11-oxoolean-12-en-30-oic acid hydrogen succinate disodium salt 5697-56-3 7421-40-1 Biogastrone CARBENOXOLONE SODIUM Carbenoxolon-dinatrium Carbenoxolone disodium Carbenoxolone sodium [USAN:JAN] Carbenoxolone, disodium salt Disodium glycyrrhetinyl succina Duogastrone EINECS 231-044-0 Glycyrrhetinic acid hydrogen succinate, disodium salt Neogel Olean-12-en-29-oic acid, 3-(3-carboxy-1-oxopropoxy)-11-oxo, disodium salt, (3beta,20beta)- Olean-12-en-29-oic acid, 3-(3-carboxy-1-oxopropoxy)-11-oxo-, disodium salt, (3-beta,20-beta)- Olean-12-en-30-oic acid, 3-beta-hydroxy-11-oxo-, hydrogen succinate, disodium salt Pyrogastrone Sanodin Sodium 3-beta-hydroxy-11-oxo-12-oleanen-30-oate sodium succinate Sodium carbenoxolone Terulcon tabletten Ulcus-tablinen
pdb file: 166425.pdb
sdf file: 166425.sdf
directory: 166425

148560-76-3 7558-79-4 7632-05-5 Acetest CCRIS 5931 Caswell No. 778 DISODIUM PHOSPHATE DSP Dibasic sodium phosphate Disodium acid orthophosphate Disodium acid phosphate Disodium hydrogen phosphate Disodium hydrogen phosphate, anhydrous Disodium hydrogenorthophosphate Disodium hydrophosphate Disodium monohydrogen phosphate Disodium orthophosphate Disodium phosphate, anhydrous Disodium phosphoric acid EINECS 231-448-7 EPA Pesticide Chemical Code 076403 Exsiccated sodium phosphate FEMA No. 2398 FEMA Number 2398 HSDB 376 Natriumphosphat [German] Phosphate of soda Phosphoric acid, disodium salt Soda phosphate Sodium acid phosphate, anhydrous Sodium hydrogen phosphate Sodium monohydrogen phosphate Sodium monohydrogen phosphate (2:1:1) Sodium orthophosphate, secondary Sodium phosphate Sodium phosphate (NaHPO4) Sodium phosphate, dibasic Sodium phosphate,
pdb file: 166718.pdb
sdf file: 166718.sdf
directory: 166718

1333-80-8 7558-80-7 7632-05-5 89140-32-9 Acid sodium phosphate EINECS 231-449-2 HSDB 738 MSP Monobasic sodium phosphate Monosodium dihydrogen orthophosphate Monosodium dihydrogen phosphate Monosodium hydrogen phosphate Monosodium monophosphate Monosodium orthophosphate Monosodium phosphate Monosodium phosphate, anhydrous Monosorb XP-4 Phosphoric acid, monosodium salt Primary sodium phosphate SODIUM DIHYDROGEN PHOSPHATE Sodium acid phosphate Sodium biphosphate anhydrous Sodium dihydrogen monophosphate Sodium dihydrogen orthophosphate Sodium dihydrogen phosphate (1:2:1) Sodium dihydrogen phosphate (NaH2PO4) Sodium dihydrogen phosphate, anhydrous Sodium dihydrogenorthophosphate Sodium monobasic phosphate (NaH2PO4) Sodium orthophosphate, primary Sodium phosphate Sodium phosphate (Na(H2PO4)) Sodium phosphate (NaH2PO4) Sodium phosphate monobasic anhydrous Sodium phosphate, monobasic Sodium primary phosphate Uro-phosphate
pdb file: 166719.pdb
sdf file: 166719.sdf
directory: 166719

57414-01-4 69098-86-8 7631-90-5 89830-27-3 91829-63-9 AI3-08582 Bisulfite de sodium [French] CCRIS 3950 Caswell No. 750 EINECS 231-548-0 EPA Pesticide Chemical Code 078201 Fr-62 HSDB 724 Hydrogen sodium sulfite Hydrogen sulfite sodium Monosodium sulfite NSC 60680 SODIUM BISULFITE Sodium acid sulfite Sodium bisulfite (1:1) Sodium bisulfite (NaHSO3) Sodium bisulfite [JAN] Sodium bisulphite Sodium hydrogen sulfite Sodium hydrogen sulfite solution (45 or less) Sodium hydrogen sulfite, solution Sodium hydrogensulphite (aqueous solution) Sodium hydrosulfite(DOT) Sodium metabisulfite Sodium sulfite (NaHSO3) Sodium sulhydrate Sulfurous acid, monosodium salt Uantax SBS
pdb file: 166775.pdb
sdf file: 166775.sdf
directory: 166775

178560-73-1 28602-75-7 7664-38-2 Acide phosphorique [French] Acido fosforico [Italian] Acidum phosphoricum CCRIS 2949 Caswell No. 662 EINECS 231-633-2 EPA Pesticide Chemical Code 076001 Evits FEMA No. 2900 Fosforzuuroplossingen [Dutch] HSDB 1187 Hydrogen phosphate NSC 80804 ORTHOPHOSPHORIC ACID Phosphoric acid Phosphoric acid [UN1805] [Corrosive] Phosphoric acid, ortho- Phosphorsaeure Phosphorsaeureloesungen [German] Sonac UN1805 Wc-reiniger White phosphoric acid o-Phosphoric acid
pdb file: 166830.pdb
sdf file: 166830.sdf
directory: 166830

119540-51-1 127529-01-5 140623-70-7 7664-93-9 Acide sulfurique [French] Acido solforico [Italian] Acido sulfurico [Spanish] Acidum sulfuricum BOV Battery acid Caswell No. 815 Dihydrogen sulfate Dipping acid EINECS 231-639-5 EPA Pesticide Chemical Code 078001 Electrolyte acid HSDB 1811 Hydrogen sulfate Mattling acid Oil of vitreol Oil of vitriol SULFURIC ACID Schwefelsaeure Schwefelsaeureloesungen [German] Sulfuric acid [Strong inorganic acid mists containing sulfuric acid] Sulfuric acid contained in strong inorganic acid mists Sulfuric acid with
pdb file: 166833.pdb
sdf file: 166833.sdf
directory: 166833

10039-56-2 14529-89-6 15883-32-6 174571-46-1 7681-53-0 EINECS 231-669-9 HSDB 6032 Hypophosphorous acid monosodium salt Monosodium hypophosphite Natriumhypophosphit [German] Phosphinic acid monosodium salt Phosphinic acid, sodium salt SODIUM HYPOPHOSPHITE Sodium hydrogen phosphite (NaH2PO2) Sodium hydrophosphite Sodium hypophosphite (NaH2PO2) Sodium phosphinate Sodium phosphinate (NaH2PO2)
pdb file: 166857.pdb
sdf file: 166857.sdf
directory: 166857

218625-70-8 7697-37-2 78989-43-2 Acide nitrique [French] Acido nitrico [Italian] Acido nitrico [Spanish] Acidum nitricum Aqua fortis Azotic acid Azotowy kwas [Polish] EINECS 231-714-2 Engraver's acid HSDB 1665 Hydrogen nitrate Kyselina dusicne [Czech] NITRIC ACID Nital Nitric acid (70 or less) Nitric acid (HNO3) 94.5 by weight or more HNO3 Nitric acid (conc 80 or greater) Nitric acid (greater than 70 ) Nitric acid (red fuming) Nitric acid other than red fuming with
pdb file: 166885.pdb
sdf file: 166885.sdf
directory: 166885

10124-31-9 7722-76-1 AI3-26062 Ammonium acid phosphate Ammonium biphosphate Ammonium diacid phosphate Ammonium dihydrogen orthophosphate Ammonium dihydrogen phosphate Ammonium dihydrogen phosphate ((NH4)H2PO4) Ammonium dihydrogenorthophosphate Ammonium dihydrophosphate Ammonium monobasic phosphate Ammonium monobasic phosphate (NH4H2PO4) Ammonium monophosphate Ammonium orthophosphate dihydrogen Ammonium phosphate (NH4H2PO4) Ammonium phosphate (monobasic) Ammonium phosphate, monobasic Ammonium phosphate, primary Ammonium primary phosphate Dihydrogen ammonium phosphate EINECS 231-764-5 HSDB 1229 MONOAMMONIUM PHOSPHATE Monoammonium acid phosphate Monoammonium dihydrogen orthophosphate Monoammonium dihydrogen phosphate Monoammonium dihydrogen phosphate ((NH4)H2PO4) Monoammonium hydrogen phosphate Monoammonium orthophosphate Monobasic ammonium phosphate NSC 57633 Phosphoric acid, monoammonium salt Primary ammonium phosphate VTI 57
pdb file: 166915.pdb
sdf file: 166915.sdf
directory: 166915

127229-27-0 57077-96-0 7782-79-8 Azoimide Diazoimide EINECS 231-965-8 HYDRAZOIC ACID Hydrogen azide Hydronitric acid Stickstoffwasserstoffsaeure [German] Triazoic acid
pdb file: 167043.pdb
sdf file: 167043.sdf
directory: 167043

7782-95-8 DISODIUM DIHYDROGEN HYPOPHOSPHATE Disodium dihydrogen subphosphate Disodium hypophosphate EINECS 231-972-6 HSDB 374 Hypophosphoric acid, disodium salt Sodium acid hypophosphate Sodium dihydrogen hypophosphate
pdb file: 167048.pdb
sdf file: 167048.sdf
directory: 167048

11140-60-6 7783-00-8 CCRIS 5530 EINECS 231-974-7 HSDB 6065 Hydrogen Selenite Monohydrated selenium dioxide RCRA waste no. U204 RCRA waste number U204 SELENIOUS ACID Selenious acid (H2SeO3) Selenite Selenium dioxide Selenium dioxide, monohydrated Selenous acid
pdb file: 167049.pdb
sdf file: 167049.sdf
directory: 167049

44071-93-4 64006-53-7 7783-20-2 82168-61-4 AMMONIUM SULFATE Actamaster Ammonium hydrogen sulfate Ammonium sulfate ((NH4)2SO4) Ammonium sulfate (2:1) Ammonium sulfate (solution) Ammonium sulfate solution Ammonium sulfate, solution Ammonium sulphate Caswell No. 048 Diammonium sulfate Diammonium sulphate Dolamin EINECS 231-984-1 EPA Pesticide Chemical Code 005601 HSDB 471 Mascagnite NSC 77671 Sulfatom ammoniya [Russian] Sulfuric acid diammonium salt Sulfuric acid, diammonium salt
pdb file: 167054.pdb
sdf file: 167054.sdf
directory: 167054

10124-31-9 7783-28-0 AI3-25349 Akoustan A Ammonium hydrogen phosphate solution Ammonium monohydrogen orthophosphate Ammonium orthophosphate dibasic Ammonium phosphate ((NH4)2(HPO4)) Ammonium phosphate [USAN] Ammonium phosphate, dibasic Ammonium phosphate, secondary Caswell No. 286C Coaltrol LPA 445 DIAMMONIUM PHOSPHATE Diammonium acid phosphate Diammonium hydrogen orthophosphate Diammonium hydrogen phosphate Diammonium hydrogenorthophosphate Diammonium monohydrogen phosphate Diammonium orthophosphate Dibasic ammonium phosphate EINECS 231-987-8 Fyrex HSDB 301 Hydrogen diammonium phosphate K2 (phosphate) Pelor Phos-Chek 202A Phos-Chek 259 Phosphoric acid, diammonium salt Secondary ammonium phosphate
pdb file: 167056.pdb
sdf file: 167056.sdf
directory: 167056

14034-76-5 37196-28-4 7784-40-9 Acid lead arsenate Acid lead orthoarsenate Arsenate of lead Arsenic acid (H3AsO4), lead(2+) salt (1:1) Arsenic acid, lead(2+) salt (1:1) Arsenic acid, lead(2+) salt(1:1) Arsinette Caswell No. 525 Dibasic lead arsenate Diplumbic hydrogen arsenate EINECS 232-064-2 EPA Pesticide Chemical Code 013503 Gypsine HSDB 1648 LEAD ARSENATE Lead acid arsenate Lead arsenate (standard) Lead arsenate, basic Lead hydrogen arsenate Lead hydrogenarsenate Lead(2+) monohydrogen arsenate Lead(II) arsenate NAT Schultenite Ortho L40 dust Plumbous arsenate Schultenite Standard lead arsenate
pdb file: 167088.pdb
sdf file: 167088.sdf
directory: 167088

72067-67-5 7784-41-0 Arsenic acid (H3AsO4), monopotassium salt Arsenic acid, monopotassium salt EINECS 232-065-8 HSDB 1235 Macquer's salt Monopotassium arsenate Monopotassium dihydrogen arsenate POTASSIUM ARSENATE Potassium acid arsenate Potassium arsenate [UN1677] [Poison] Potassium arsenate, monobasic Potassium dihydrogen arsenate Potassium dihydrogen arsenate (KH2AsO4) Potassium dihydrogenarsenate Potassium hydrogen arsenate Potassium hydrogen arsenate (KH2AsO4) UN1677
pdb file: 167089.pdb
sdf file: 167089.sdf
directory: 167089

7784-44-3 Ammonium acid arsenate Ammonium arsenate [UN1546] [Poison] Arsenic acid, diammonium salt DIAMMONIUM ARSENATE Diammonium hydrogen arsenate Diammonium hydrogenarsenate Diammonium monohydrogen arsenate Dibasic ammonium arsenate EINECS 232-067-9 Secondary ammonium arsenate UN1546
pdb file: 167091.pdb
sdf file: 167091.sdf
directory: 167091

6298-64-2 7789-79-9 CALCIUM HYPOPHOSPHITE Calcium dihydrogen hypophosphite Calcium hypophosphite (Ca(H2PO2)2) Calcium phosphinate Calcium phosphinate (Ca(H2PO2)2) EINECS 232-190-8 HSDB 987 NSC 41872 Phosphinic acid, calcium salt
pdb file: 167138.pdb
sdf file: 167138.sdf
directory: 167138

7803-63-6 AMMONIUM BISULFATE Ammonium hydrogen sulfate [UN2506] [Corrosive] Ammonium hydrogensulphate EINECS 232-265-5 Sulfuric acid, monoammonium salt UN2506
pdb file: 167180.pdb
sdf file: 167180.sdf
directory: 167180

3038-76-4 34464-19-2 8076-65-1 Asparkam Aspartic acid, monopotassium salt, mixt. with potassium hydrogen (T-4)-bis(aspartato(2-)-kappaN,kappaO1)magnesate(2-) DL-Aspartic acid, magnesium potassium salt DL-Aspartic acid, monopotassium salt, mixt. with potassium hydrogen (T-4)-bis(DL-aspartato(2-)-N,O(sup 1))magnesate (2-) DL-Aspartic acid, monopotassium salt, mixt. with potassium hydrogen (T-4)-bis(DL-aspartato(2-)-N,O1)magnesate(2-) Magnesium potassium aspartate POTASSIUM MAGNESIUM ASPARTATE Panangin Potassium magnesium hydrogen DL-aspartate Tromcardin
pdb file: 167360.pdb
sdf file: 167360.sdf
directory: 167360

11121-04-3 113096-26-7 116958-77-1 119764-46-4 124124-10-3 12627-22-4 12627-23-5 128835-50-7 1335-73-5 134364-63-9 136752-27-7 150502-17-3 152157-39-6 156107-97-0 171544-36-8 181434-79-7 185461-11-4 199605-58-8 214976-60-0 216958-79-1 26183-44-8 32057-62-8 37325-23-8 39390-84-6 39450-08-3 42504-27-8 51059-21-3 53663-56-2 56572-89-5 57762-43-3 57762-59-1 66747-17-9 73651-68-0 74349-47-6 76724-02-2 9004-82-4 98112-64-2 Avirol 100E Conco Sulfate WE Cycloryl NA Dodecanol, ethoxylated, monoether with sulfuric acid, sodium salt Elfan 242 Elfan NS 242 Elfan NS 243 Empicol ESB 3 Empicol ESB 30 Empimin KSN Empimin KSN 27 Empimin KSN 60 Empimin KSN 70 Etoxon EPA Glycols, polyethylene, mono(hydrogen sulfate), dodecyl ether, sodium salt HSDB 752 Laureth-8 carboxylic acid, sodium salt Maprofix 60S Maprofix ES PEG-12
pdb file: 167439.pdb
sdf file: 167439.sdf
directory: 167439

11120-14-2 24967-93-9 25322-46-7 56480-79-6 9007-28-7 9046-20-2 9062-29-7 9082-07-9 9088-44-2 CHONDROITIN SULFATES Chondroitin polysulfate Chondroitin sulfate Chondroitin sulfuric acid Chondroitin sulfuric acids Chondroitin sulphate Chondroitin, hydrogen sulfate Chonsurid EINECS 232-696-9
pdb file: 167470.pdb
sdf file: 167470.sdf
directory: 167470

1,4-Bis(2-ethylhexyl) 2-sulphosuccinate 1,4-Bis(2-ethylhexyl) sulfosuccinate 10041-19-7 123344-03-6 128-49-4 147-89-7 19149-47-4 21954-86-9 30673-56-4 577-11-7 Butanedioic acid, sulfo-, 1,4-bis(2-ethylhexyl) ester DOCUSATE Dioctyl sulfosuccinic acid Docusate hydrogen EINECS 233-124-0
pdb file: 167644.pdb
sdf file: 167644.sdf
directory: 167644

10088-45-6 Methyl phenylphosphonate O-METHYL HYDROGEN PHENYLPHOSPHONIC ACID Phenylphosphonic acid, monomethyl ester
pdb file: 167700.pdb
sdf file: 167700.sdf
directory: 167700

10099-72-6 2-Butenedioic acid, mono(2-(2-hydroxyethoxy)ethyl) ester Diethylene glycol, mono(hydrogen maleate) MALEIC ACID, MONO(2-(2-HYDROXYETHOXY)ETHYL) ESTER Maleic acid, mono(hydroxyethoxyethyl) ester Mono-2-(2-hydroxyethoxy)ethylester kyseliny maleinove [Czech]
pdb file: 167711.pdb
sdf file: 167711.sdf
directory: 167711

10099-73-7 2-Butenedioic acid, mono(2-hydroxypropyl) ester 2-Hydroxypropyl hydrogen maleate EINECS 233-244-3 MALEIC ACID, MONO(2-HYDROXYPROPYL) ESTER Mono-(2-hydroxypropyl)ester kyseliny maleinove [Czech] Mono-(2-hydroxypropyl)maleate
pdb file: 167712.pdb
sdf file: 167712.sdf
directory: 167712

10102-05-3 14846-30-1 EINECS 233-265-8 Hydrogen tetranitropalladate (II) NITRIC ACID, PALLADIUM(2+) SALT Palladium dinitrate Palladium nitrate
pdb file: 167722.pdb
sdf file: 167722.sdf
directory: 167722

10127-05-6 Bucolan Yellow 6G Bucolan Yellow EL C.I. 19010 C.I. ACID YELLOW 54 C.I. Acid Yellow 54 (8CI) Calcofast Leather Yellow N Calcofast Wool Pink N Calcofast Wool Yellow N Chromacyl Yellow N Chromate(5-), bis(2-((4,5-dihydro-3-methyl-1-(2-methyl-4-sulfophenyl)-5-oxo-1H-pyrazol-4-yl)azo)-4-sulfobenzoato(4-))-, tetrasodium hydrogen (9CI) Chrome Intra Yellow EL Chromolan Yellow ELN Chromolan Yellow N Disodium (2-((4,5-dihydro-3-methyl-5-oxo-1-(4-sulpho-o-tolyl)-1H-pyrazol-4-yl)azo)-4-sulphobenzoato(4-))hydroxychromate(2-) EINECS 233-355-7 Fenapal Yellow EL Glycolan Yellow BEL Inochrome Yellow JLN NSC 326203 Neolan Yellow BE Nyasol Fast Yellow GLN Palatine Fast Yellow ELN Palatine Yellow ELNA-CF Pharmalan Yellow EL Pilate Fast Yellow ELN Stenamina Yellow B Super Fast Yellow ELNA Ultralan Yellow G Vitrolan Yellow BE Yamada Neo
pdb file: 167760.pdb
sdf file: 167760.sdf
directory: 167760

10192-30-0 17026-44-7 AMMONIUM BISULFITE Ammonium acid sulfite Ammonium bisulfite (NH4HSO3) Ammonium bisulfite solution Ammonium bisulfite solution (70 or less) Ammonium hydrogen sulfite Ammonium hydrogensulphite Ammonium hydrosulfite Ammonium monosulfite Ammonium sulfite, hydrogen EINECS 233-469-7 HSDB 486 Monoammonium sulfite Sulfurous acid, monoammonium salt
pdb file: 167821.pdb
sdf file: 167821.sdf
directory: 167821

12247-12-0 12264-18-5 1892-65-5 ACETIC ACID, (ETHYLENEDINITRILO)TETRA-, CALCIUM (II) COMPLEX Calciate(2-), ((ethylenedinitrilo)tetraacetato)-, dihydrogen (8CI) Calcium EDTA complex Calcium dihydrogen ethylenediaminetetraacetate EINECS 235-534-5
pdb file: 168317.pdb
sdf file: 168317.sdf
directory: 168317

117216-04-3 12392-64-2 19154-31-5 51312-00-6 6505-92-6 Acid blue 193 C.I. ACID BLUE 161 Chromate(3-), bis(3-hydroxy-4-((2-hydroxy-1-naphthalenyl)azo)-1-naphthalenesulfonato(3-))-, disodium hydrogen Disodium hydrogen bis(3-hydroxy-4-((2-hydroxy-1-naphthyl)azo)naphthalene-1-sulphonato(3-))chromate(3-) EINECS 235-628-6
pdb file: 168323.pdb
sdf file: 168323.sdf
directory: 168323

(Dihydrogen(ethylenedinitrilo)tetraacetato)mercury (Ethylenedinitrilo)tetraacetic acid mercury complex 12558-92-8 15954-89-9 ACETIC ACID, (ETHYLENEDINITRILO)TETRA-, MERCURY(II) COMPLEX Hydrogen ((ethylenedinitrilo)tetraacetato)mercurate(II) Mercury(II) EDTA complex Mercury, (dihydrogen(ethylenedinitrilo)tetraacetato)- (8CI)
pdb file: 168331.pdb
sdf file: 168331.sdf
directory: 168331

12715-61-6 56780-57-5 C.I. ACID YELLOW 151 CCRIS 769 Cobaltate(2-), bis(2-((5-(aminosulfonyl)-2-(hydroxy-kappaO)phenyl)azo-kappaN1)-3-(oxo-kappaO)-N-phenylbutanamidato(2-))-, dihydrogen Cobaltate(2-), bis(2-((5-(aminosulfonyl)-2-hydroxyphenyl)azo)-3-oxo-N-phenylbutanamidato(2-))-, dihydrogen Dihydrogen bis(2-((5-(aminosulphonyl)-2-hydroxyphenyl)azo)-3-oxo-N-phenylbutyramidato(2-))cobaltate(2-) EINECS 235-786-6
pdb file: 168355.pdb
sdf file: 168355.sdf
directory: 168355

13150-00-0 2-(2-(2-(Dodecyloxy)ethoxy)ethoxy)ethanol hydrogen sulfate sodium salt 60267-60-9 92593-72-1 Dodecyltriethoxy sulfate EINECS 236-091-0 Ethanesulfonic acid, 2-(2-(2-(dodecyloxy)ethoxy)ethoxy)-, sodium salt Ethanol, 2-(2-(2-(dodecyloxy)ethoxy)ethoxy)-, hydrogen sulfate, sodium salt Ethanol, 2-(2-(2-(dodecyloxy)ethoxy)ethoxy)-, sulfate ester, monosodium salt HSDB 5056 SODIUM LAURYL TRIOXYETHYLENE SULFATE Sodium 2-(2-(2-(dodecyloxy)ethoxy)ethoxy)ethyl sulphate Sodium lauryl alcohol triglycol ether sulfate Sodium lauryl tri(oxyethyl) sulfate Sodium lauryl triethoxy sulfate Sodium lauryl(triethylene glycol) sulfate Sulfuric acid, mono(2-(2-(2-(dodecyloxy)ethoxy)ethoxy)ethyl) ester, sodium salt Triethylene glycol dodecyl ether sulfate sodium salt Triethylene glycol monododecyl ether sulfate sodium salt
pdb file: 168517.pdb
sdf file: 168517.sdf
directory: 168517

1-(2-Phenyl-2-dimethylaminoaethyl)-4-aethoxycarbonyl-4-phenylpiperidin di(hydrogenmaleat) 1-(beta-(Dimethylamino)phenethyl)-4-phenylisonipecotic acid ethyl ester maleate (1:2) 13451-56-4 ISONIPECOTIC ACID, 1-(beta-(DIMETHYLAMINO)PHENETHYL)-4-PHENYL-, ETHYL ESTER, MAL Isonipecotic acid, 1-(beta-(dimethylamino)phenethyl)-4-phenyl-, ethyl ester, maleate (1:2)
pdb file: 168764.pdb
sdf file: 168764.sdf
directory: 168764

13474-03-8 5'-ADENYLIC ACID, SODIUM SALT 5'-Amp sodium salt AMP sodium salt Adenosine 5'-(dihydrogen phosphate), sodium salt Adenosine 5'-monophosphate sodium salt NaAmp Sodium AMP Sodium adenosine-5'-monophosphate
pdb file: 168799.pdb
sdf file: 168799.sdf
directory: 168799

13590-71-1 171674-38-7 BRN 0969466 EINECS 237-027-4 Methyl hydrogenphosphonate Methyl phosphonate ((MeO)(OH)HPO) Methylester kyseliny fosforite [Czech] Methylfosfit [Czech] Methylfosfonat [Czech] Monomethyl phosphite Monomethyl phosphonate Monomethylfosfit [Czech] PHOSPHONIC ACID, MONOMETHYL ESTER Phosphorous acid, methyl ester
pdb file: 168872.pdb
sdf file: 168872.sdf
directory: 168872

13598-15-7 35089-00-0 BERYLLIUM PHOSPHATE Beryllium hydrogen phosphate (1:1) Beryllium phosphate (BeHPO4) Beryllium phosphate [Beryllium and beryllium compounds] HSDB 348 Phosphoric acid, beryllium salt (1:1) Phosphorous acid, beryllium salt
pdb file: 168877.pdb
sdf file: 168877.sdf
directory: 168877

13598-36-2 DIHYDROGEN PHOSPHATE Dihydroxyphosphine oxide EINECS 237-066-7 Orthophosphorus acid Phosphonic acid Phosphorous acid Phosphorus trihydroxide Trihydroxyphosphine
pdb file: 168878.pdb
sdf file: 168878.sdf
directory: 168878

13780-03-5 13846-18-9 CALCIUM BISULFITE Calcium bisulfite, solution Calcium dithionite or calcium hydrosulfite [UN1923] [Spontaneously combustible] Calcium hydrogen sulfite Calcium hydrogensulphite Calcium sulfite (Ca(HSO3)2) (7CI) EINECS 237-423-7 Sulfurous acid, calcium salt (2:1) UN1923
pdb file: 169010.pdb
sdf file: 169010.sdf
directory: 169010

(2-Carboxyphenyl)hydroxymercury (o-Carboxyphenyl)hydroxymercury 14066-61-6 Benzoic acid, o-(hydroxymercuri)- (7CI) EINECS 237-918-8 MERCURY, (o-CARBOXYPHENYL)HYDROXY- Mercurate(1-), (benzoato(2-)-C2,O1)hydroxy-, hydrogen Mercury, (2-carboxyphenyl)hydroxy- (9CI) o-Hydroxymercuribenzoic acid o-Hydroxymercuriobenzoic acid
pdb file: 169176.pdb
sdf file: 169176.sdf
directory: 169176

14306-25-3 CCRIS 3271 EINECS 238-242-6 Hexakis(dihydrogen phosphate) myo-inositol sodium salt (9CI) INOSITOL, HEXAKIS(DIHYDROGEN PHOSPHATE) SODIUM SALT, myo- Inositol hexaphosphate sodium salt Myo-Inositol, hexakis(dihydrogen phosphate), sodium salt Phytic acid sodium salt Sodium inositol hexaphosphate Sodium phytate
pdb file: 169331.pdb
sdf file: 169331.sdf
directory: 169331

1-(2-Phenyl-2-piperidinoaethyl)-4-aethoxycarbonyl-4-phenylpiperidin di(hydrogenmaleat) 14771-43-8 4-Phenyl-1-(beta-piperidinophenethyl)isonipecotic acid ethyl ester maleate (1:2) ISONIPECOTIC ACID, 4-PHENYL-1-(beta-PIPERIDINOPHENETHYL)-, ETHYL ESTER, MALEATE Isonipecotic acid, 4-phenyl-1-(beta-piperidinophenethyl)-, ethyl ester, maleate (1:2)
pdb file: 169553.pdb
sdf file: 169553.sdf
directory: 169553

15120-17-9 7631-89-2 ARSENENIC ACID, SODIUM SALT Arsenic acid (HASO3), sodium salt (8CI) EINECS 239-171-3 Sodium arsenate (NaAsO3) Sodium metaarsenate Sodium monohydrogen arsenate
pdb file: 169705.pdb
sdf file: 169705.sdf
directory: 169705

15467-20-6 ACETIC ACID, NITRILOTRI-, DISODIUM SALT Disodium hydrogen nitrilotriacetate Disodium nitrilotriacetate EINECS 239-484-5 Glycine, N,N-bis(carboxymethyl)-, disodium salt Kiresuto NTB N,N-Bis(carboxymethyl)glycine disodium salt Nitrilotriacetic acid, disodium salt Nitrilotriacetic acid,disodium salt
pdb file: 169916.pdb
sdf file: 169916.sdf
directory: 169916

15489-90-4 Bovine hemin Dihydrogen hydroxy(3,8,13,17-tetramethyl-7,12-divinyl-21H,23H-porphine-2,18-dipropionato(4-)-N21,N22,N23,N24)ferrate(2-) EINECS 239-518-9 Ferrihemate Ferriheme Ferriheme hydroxide Ferrihemic acid Ferriporphyrin hydroxide Ferriprotoporphyrin IX hydroxide Ferriprotoporphyrin basic Hematin Hydroxy(dihydrogen protoporphyrin IX-ato(2-))iron Hydroxyhemin IRON, (DIHYDROGEN 3,7,12,17-TETRAMETHYL-8,13-DIVINYL-2,18-PORPHINEDIPROPIONATO(2 Iron, (dihydrogen 3,7,12,17-tetramethyl-8,13-divinyl-2,18-porphinedipropionato(2-))-hydroxy- Phenodin Protohematin
pdb file: 169945.pdb
sdf file: 169945.sdf
directory: 169945

16331-85-4 39406-88-7 69514-84-7 Arsenic acid (H3AsO4), monocesium salt (8CI,9CI) Arsenic acid cesium salt CAESIUM ARSENATE CDA CDA (frequency multiplier) Cesium arsenate Cesium dihydrogen arsenate
pdb file: 170357.pdb
sdf file: 170357.sdf
directory: 170357

16715-59-6 ACETOACETIC ACID, ETHYL ESTER, CALCIUM COMPLEX (2:1) Bis(hydrogen acetoacetato)calcium diethyl ester Calcium bis(2-ethoxycarbonyl-1-methylvinyl oxide) Calcium ethyl acetoacetate Calcium ethyl acetylacetonate Calcium, bis(ethyl-3-oxobutanoato-O(sup 1),O(sup 3)-, (T-4)- (9CI) Calcium, bis(hydrogen acetoacetato)-, diethyl ester (8CI) EINECS 240-769-1 Ethyl acetoacetate calcium salt Ethyl calcioacetoacetate
pdb file: 170522.pdb
sdf file: 170522.sdf
directory: 170522

102931-96-4 122141-73-5 127408-00-8 1303-67-9 133097-00-4 133951-38-9 13767-36-7 140148-87-4 16872-11-0 172515-29-6 172908-18-8 183135-74-2 191665-41-5 36835-64-0 65814-43-9 67116-13-6 72802-72-3 74618-51-2 81586-24-5 96958-96-2 Borate(1-), tetrafluoro-, hydrogen Borofluoric acid CCRIS 2309 EINECS 240-898-3 FLUOROBORIC ACID (BF4.H) Fluoboric acid Fluoboric acid (H(BF4)) Fluoroboric acid Fluoroboric acid [UN1775] [Corrosive] HSDB 2083 Hydrofluoboric acid Hydrogen tetrafluoroborate Hydrogen tetrafluoroborate(1-) Tetrafluoroboric acid UN1775
pdb file: 170618.pdb
sdf file: 170618.sdf
directory: 170618

1303-50-0 1335-28-0 13682-60-5 13682-61-6 13682-62-7 137355-36-3 14337-12-3 147142-02-7 15189-51-2 16903-35-8 16961-25-4 172825-39-7 31113-23-2 52562-86-4 81853-52-3 90907-74-7 91947-07-8 AURATE(1-), TETRACHLORO-, HYDROGEN Aurate(1-), tetrachloro-, hydrogen, (SP-4-1)- Auric acid Brown gold chloride Chlorauric acid Chloroauric acid EINECS 240-948-4 Gold tetrachloride, acid Gold trichloride hydrochloride Gold trichloride, acid Gold trichloride,acid Hydrogen tetrachloroaurate(1-) Hydrogen tetrachloroaurate(III) Tetrachloroaurate(1-) hydrogen Tetrachloroauric acid
pdb file: 170631.pdb
sdf file: 170631.sdf
directory: 170631

16903-35-8 16961-25-4 39357-88-5 Aurate(1-), tetrachloro-, hydrogen, trihydrate (8CI) Aurate(1-), tetrachloro-, hydrogen, trihydrate, (SP-4-1)- (9CI) Auric chloride, hydrochloride, trihydrate GOLD CHLORIDE, HYDROCHLORIDE, TRIHYDRATE Gold acid chloride trihydrate
pdb file: 170661.pdb
sdf file: 170661.sdf
directory: 170661

12225-25-1 17095-24-8 2,7-Naphthalenedisulfonic acid, 3,6-(bis(4-((2-hydroxyethyl)sulfonyl)phenyl)bis(azo))-5-amino-4-hydroxy-, di(hydrogen sulfate) ester, tetrasodium salt 2,7-Naphthalenedisulfonic acid, 4-amino-5-hydroxy-3,6-bis((4-((2-(sulfooxy)ethyl)sulfonyl)phenyl)azo)-, tetrasodium salt 2,7-Naphthalenedisulfonic acid, 4-amino-5-hydroxy-3,6-bis((p-((2-hydroxyethyl)sulfonyl)phenyl)azo)-, 3,6-bis(hydrogen sulfate) (ester), tetrasodium salt 4-Amino-5-hydroxy-3,6-bis((4-((2-(sulfooxy)ethyl)sulfonyl)phenyl)azo)-2,7-naphthalenedisulfonic acid tetrasodium salt 72528-69-9 90598-98-4 C.I. 20505 C.I. REACTIVE BLACK 5 Cavalite Black B Celmazol Black B Diamira Black B Drimarene Black R/K 3B EINECS 241-164-5 Intracron Black VS-B Levafix Black E-B Primazin Black BN Reactive Black 5 Remazol Black GF Remazol black B Sumifix Black B Tetrasodium 4-amino-5-hydroxy-3,6-bis((4-((2-(sulphonatooxy)ethyl)sulphonyl)phenyl)azo)naphthalene-2,7-disulphonate
pdb file: 170754.pdb
sdf file: 170754.sdf
directory: 170754

12261-26-6 12262-61-2 15275-07-7 15954-99-1 17099-81-9 22977-12-4 39019-76-6 Acetic acid, (ethylenedinitrilo)tetra-, iron salt EINECS 241-171-3 Ethylenediamine tetraacetic acid, iron (III) salt Ethylenediaminetetraacetic acid, Fe(III) chelate Fe(III)-EDTA complex (1:1) Ferrate(1-), ((N,N'-1,2-ethanediylbis(N-((carboxy-kappaO)methyl)glycinato-kappaN,kappaO))(4-))-, hydrogen, (OC-6-21)- Ferrate(1-), ((N,N'-1,2-ethanediylbis(N-(carboxymethyl)glycinato))(4-)-N,N',O,O',ON,ON')-, hydrogen, (OC-6-21)- Ferrate(1-), ((ethylenedinitrilo)tetraacetato)-, hydrogen (8CI) Ferric EDTA Ferric ethylenediaminetetraacetic acid Ferric-EDTA Hydrogen ((N,N'-ethylenebis(N-(carboxymethyl)glycinato))(4-)-N,N',O,O',ON,ON')ferrate(1-) Hydrogen ((ethylenedinitrilo)tetraacetato)ferrate(III) (6CI,7CI) IRON, (HYDROGEN(ETHYLENEDINITRILO)TETRAACETATO)-
pdb file: 170764.pdb
sdf file: 170764.sdf
directory: 170764

1,2,3-Propanetriol, 2-(dihydrogen phosphate) 1,3-Hydroxy-2-propyl dihydrogen phosphate 1301-70-8 17181-54-3 58409-70-4 819-83-0 EINECS 241-228-2 GLYCEROL-2-PHOSPHATE beta-Glycerophosphoric acid
pdb file: 170844.pdb
sdf file: 170844.sdf
directory: 170844

17230-86-3 4-Thia-1-azabicyclo(3.2.0)heptane-2-carboxylic acid, 6-((carboxyphenylacetyl)amino)-3,3-dimethyl-7-oxo-, monopotassium salt, (6S-(2alpha,5alpha,6beta))- CARBENICILLIN POTASSIUM Carbenicillin potassium [USAN] EINECS 241-269-6 GS 3159 N-(2-Carboxy-3,3-dimethyl-7-oxo-4-thia-1-azabicyclo(3.2.0)hept-6-yl)-2-phenylmalonamic acid 2-(potassium salt) Potassium hydrogen (2S-(2alpha,5alpha,6beta))-6-(carboxylatophenylacetamido)-3,3-dimethyl-7-oxo-4-thia-1-azabicyclo(3.2.0)heptane-2-carboxylate
pdb file: 170874.pdb
sdf file: 170874.sdf
directory: 170874

15-Hydroxy-2-((2-O-(3-methyl-1-oxobutyl)-3,4-di-O-sulfo-beta-D-glucopyranosyl)oxy)-19-norkaur-16-en-18-oic acid dipotassium salt, (2beta,4alpha,15alpha)- 17754-44-8 19-Norkaur-16-en-18-oic acid, 15-hydroxy-2-((2-O-(3-methyl-1-oxobutyl)-3,4-di-O-sulfo-beta-D-glucopyranosyl)oxy)-, (2beta,4alpha,15alpha)- 19-Norkaur-16-en-18-oic acid, 15-hydroxy-2-((2-O-(3-methyl-1-oxobutyl)-3,4-di-O-sulfo-beta-D-glucopyranosyl)oxy)-, dipotassium salt, (2beta,4alpha,15alpha)- ATRACTYLOSIDE Atractylate de potassium [French] Atractylin (C30 glucoside) Attrattiloside [Italian] Dipotassium hydrogen 15alpha-hydroxy-2beta-((2-O-isovaleryl-3,4alpha-di-O-sulphonato-beta-D-glucopyranosyl)oxy)-19-norkaur-16-en-18-oate EINECS 241-744-8 Potassium atractylate
pdb file: 171164.pdb
sdf file: 171164.sdf
directory: 171164

18109-81-4 2-(2-(Diethylamino)ethoxy)-ethyl 2-phenylbutyrate citrate 2-(2-(Diethylamino)ethoxy)ethyl 2-phenylbutyrate citrate (1:1) 2-Phenylbutyric acid 2-(2-(diethylamino)ethoxy)ethyl ester citrate Abbott 36581 Acodeen BUTYRIC ACID, 2-PHENYL-, 2-(2-(DIETHYLAMINO)ETHOXY)ETHYL ESTER, CITRATE Benzeneacetic acid, alpha-ethyl-2-(2-(diethylamino)ethoxy)ethyl ester, 2-hydroxy-1,2,3-propanetricarboxylate (1:1) Butamirate Butamirate citrate Butamirate citrate [USAN] Butamyrate citrate Diethyl(2-(2-(2-phenylbutyroyloxy)ethoxy)ethyl)ammonium dihydrogencitrate EINECS 242-006-8 HH-197 Phenyl acetic acid diethylaminoethoxyethanol ester citrate Sincodeen Sincodex Sincodin Sincodix Sinecod alpha-Ethylbenzeneacetic acid 2-(2-(diethylamino)ethoxy)ethyl ester citrate alpha-Ethylbenzeneacetic acid, 2-(2-(diethylamino)ethoxy)ethyl ester, 2-hydroxy-1,2,3-propanetricarboxylate (1:1)
pdb file: 171305.pdb
sdf file: 171305.sdf
directory: 171305

18672-84-9 4-Amino-2-ethoxy-benzoic acid 2-(diethylamino)ethyl ester hydrogen phosphate BENZOIC ACID, 4-AMINO-2-ETHOXY-, 2-(DIETHYLAMINO)ETHYL ESTER, HYDROGEN PHOSPHATE WIN 3606
pdb file: 171570.pdb
sdf file: 171570.sdf
directory: 171570

1,2,3-Propanetricarboxylic acid, 2-hydroxy-, monosodium salt 18996-35-5 CITRIC ACID, SODIUM SALT Citric acid, monosodium salt (8CI) Citrofluyl EINECS 242-734-6 Monosodium citrate Monosodium dihydrogen citrate Sodium citrate Sodium dihydrogen citrate
pdb file: 171692.pdb
sdf file: 171692.sdf
directory: 171692

1-NAPHTHALENESULFONIC ACID, 5-HYDROXY-6-((m-((2-HYDROXYETHYL)SULFONYL)PHENYL)AZO 1-Naphthalenesulfonic acid, 5-hydroxy-6-((2-methoxy-5-((2-(sulfooxy)ethyl)sulfonyl)phenyl)azo)-, disodium salt 1-Naphthalenesulfonic acid, 5-hydroxy-6-((m-((2-hydroxyethyl)sulfonyl)phenyl)azo)-, hydrogen sulfate (ester), disodium salt 11099-78-8 12769-06-1 19526-81-9 37263-41-5 Disodium 5-hydroxy-6-((2-methoxy-5-((2-(sulphonatooxy)ethyl)sulphonyl)phenyl)azo)naphthalenesulphonate EINECS 243-134-7 Remazol Red B
pdb file: 171936.pdb
sdf file: 171936.sdf
directory: 171936

20223-84-1 21259-76-7 Acetic acid, mercapto-, mercury complex Cyclopentanecarboxylic acid, 3-(((2-methoxypropyl)amino)carbonyl)-1,2,2-trimethyl-, mercury complex HSDB 3356 MERCAPTOMERIN Mercaptomerina [INN-Spanish] Mercaptomerine Mercaptomerine [INN-French] Mercaptomerinum [INN-Latin] Mercurate(2-), (3-(((3-carboxylato-2,2,3-trimethylcyclopentyl)carbonyl)amino)-2-methoxypropyl)((mercapto-kappaS)acetato(2-)-kappaO)-, dihydrogen, (T-4)- Mercurate(2-), (3-(((3-carboxylato-2,2,3-trimethylcyclopentyl)carbonyl)amino)-2-methoxypropyl)(mercaptoacetato(2-)-O,S)-, dihydrogen, (T-4)- Mercury, (3-(3-carboxy-2,2,3-trimethylcyclopentanecarboxamido)-2-methoxypropyl)(hydrogen mercaptoacetato)- N-(gamma-Carboxymethyl-mercapto-mercuri-beta methoxy)propyl camphoramic acid Thiomerin
pdb file: 172219.pdb
sdf file: 172219.sdf
directory: 172219

14239-28-2 14751-07-6 19121-91-6 20369-67-9 25442-53-9 3-Phorbinepropanoic acid, 3,4-didehydro-9-ethenyl-14-ethyl-21-(methoxycarbonyl)-4,8,13,18-tetramethyl-20-oxo-, magnesium complex Magnesate(1-), (3,4-didehydro-9-ethenyl-14-ethyl-21-(methoxycarbonyl)-4,8,13,18-tetramethyl-20-oxo-3-phorbinepropanoato(3-)-N23,N24,N25,N26)-, hydrogen, (SP-4-2)- Magnesate(1-), (3,4-didehydro-9-ethenyl-14-ethyl-21-(methoxycarbonyl)-4,8,13,18-tetramethyl-20-oxo-3-phorbinepropanoato(3-)-kappaN23,kappaN24,kappaN25,kappaN26)-, hydrogen, (SP-4-2)- Magnesium, (dihydrogen 2-vinylpheoporphyrin a5-ato(2))-, methyl ester Magnesium, (dihydrogen 21-carboxy-3,4-didehydro-14-ethyl-4,8,13,18-tetramethyl-20-oxo-9-vinyl-3-phorbinepropionato(2-))-, 21-methyl ester PROTOCHLOROPHYLLIDE Protochlorophyllide a
pdb file: 172305.pdb
sdf file: 172305.sdf
directory: 172305

2-((3-Aminopropyl)amino)-ethanethiol, dihydrogen phosphate ester (9CI) 2-(3-Aminopropylamino)ethyl thiophosphate 20537-88-6 53028-04-9 59178-37-9 63717-27-1 AMIFOSTINE AU-95722 Acide ((amino-3 propylamino)-2 ethyl)-S-phosphorothioique [French] Amifostine [USAN:BAN:INN] Aminopropylaminoethyl thiophosphate Apaetp BRN 2088122 Ethanethiol, 2-((3-aminopropyl)amino)-, dihydrogen phosphate (ester) Ethiofos Ethyol Gammaphos NSC 296961 NSC-296961 Phosphorothioic acid, S-(2-(3-aminopropylamino)ethyl) ester S,2-(3-Aminopropylamino)ethyl-phosphorothioic acid S-(2-((3-Aminopropyl)amino)ethyl) dihydrogen phosphorothioate S-(2-(3-Aminopropylamino)ethyl) phosphorothioate S-2-(3-Aminopropylamino)ethyl phosphorothioic acid S-omega-(3-Aminopropylamino)ethyl dihydrogen phosphorothioate Sapep WR 2721 YM-08310
pdb file: 172354.pdb
sdf file: 172354.sdf
directory: 172354

(3-(3-Carboxy-2,2,3-trimethylcyclopentanecarboxamido)-2-methoxypropyl)(hydrogen mercaptoacetato)mercury disodium salt 20223-84-1 20436-02-6 21259-76-7 51-99-0 Disodium N-(3-(carboxymethylthiomercuri)-2-methoxypropyl)-alpha-camphoramate Diucardyn Diucardyn sodium EINECS 244-298-2 Letorin MERCAPTOMERIN SODIUM Mercaptomerin sodium [BAN] Mercaptomerine sodique Mercurate(2-), (3-(((3-carboxylato-2,2,3-trimethylcyclopentyl)carbonyl)amino)-2-methoxypropyl)(mercaptoacetato(2-)-O,S)-, disodium, (T-4)- Mercurate(2-), (3-(((3-carboxylato-2,2,3-trimethylcyclopentyl)carbonyl-kappaO)amino)-2-methoxypropyl-kappaC)((mercapto-kappaS)acetato(2)-kappaC)-, disodium, (T-4)- Mercury, (3-(((3-carboxy-2,2,3-trimethylcyclopentyl)carbonyl)amino)-2-methoxypropyl)(mercaptoacetato-S)-, disodium salt Mercury, (3-(3-carboxyl-2,2,3-trimethylcyclopentanecarboxamido)-2-methoxypropyl)(hydrogen mercaptoacetao)-, disodium salt N-(gamma-Carboxymethylmercaptomercuri-beta-methoxy)propylcamphoramic acid disodium salt Sodium mercaptomerin Thiomerin sodium
pdb file: 172668.pdb
sdf file: 172668.sdf
directory: 172668

1-BUTANETHIOL, 4-AMINO-, HYDROGEN SULFATE (ester) 21679-16-3 BRN 3081503 Thiosulfuric acid, 4-aminobutyl ester
pdb file: 172835.pdb
sdf file: 172835.sdf
directory: 172835

1-HEXANETHIOL, 6-AMINO-, HYDROGEN SULFATE (ester) 21679-18-5 4-04-00-01787 (Beilstein Handbook Reference) BRN 1773493 Thiosulfuric acid, 6-aminohexyl ester
pdb file: 172836.pdb
sdf file: 172836.sdf
directory: 172836

21921-96-0 BRN 2204649 Ethyl hydrogen 1-propylphosphonate Ethyl hydrogen propylphosphonate Ethyl propylphosphonate Monoethyl propylphosphonate NIA 10637 Niagara 10637 O-ETHYL HYDROGEN PROPYLPHOSPHONATE Phosphonic acid, propyl-, ethyl ester (7CI) Phosphonic acid, propyl-, monoethyl ester
pdb file: 172924.pdb
sdf file: 172924.sdf
directory: 172924

22202-68-2 328-50-7 ALPHA-KETOGLUTARIC ACID, SODIUM SALT EINECS 244-836-6 Sodium hydrogen 2-oxoglutarate
pdb file: 173078.pdb
sdf file: 173078.sdf
directory: 173078

22457-89-2 8088 C.B. BENFOTIAMINE BRN 0771326 BTMP Benfotiamina [INN-Spanish] Benfotiamine [DCF:INN:JAN] Benfotiaminum [INN-Latin] Benphothiamine Benzoic acid, thio-, S-ester with N-((4-amino-2-methyl-5-pyrimidinyl)methyl)-N-(4-hydroxy-2-mercapto-1-methyl-1-butenyl)formamide dihydrogen phosphate (ester) Benzoylthiamine O-monophosphate Benzoylthiamine monophosphate Berdi Betivina Biotamin CB 8088 EINECS 245-013-4 N-((4-Amino-2-methyl-5-pyrimidinyl)methyl)-N-(4-hydroxy-2-mercapto-1-methyl-1-butenyl)formamide S-benzoate O-phosphate Neurostop Nitanevril S-Benzoylthiamine O-monophosphate S-Benzoylthiamine monophosphate Tabiomyl Thiamine monophosphate benzoyl Vitanevril
pdb file: 173204.pdb
sdf file: 173204.sdf
directory: 173204

22560-50-5 BM 06011 Bonefos CLODRONATE DISODIUM Chlodronate sodium Clasteon Clodronate sodium Clodronic acid disodium salt Dichloromethane diphosphonate Dichloromethylene diphosphonate, disodium salt Disodium (dichloromethylene)bisphosphonate Disodium (dichloromethylene)diphosphonate Disodium clodronate Disodium dichloromethylene diphosphonate Disodium dihydrogen (dichloromethylene)diphosphonate Disodium-dichloromethylene-diphosphonate EINECS 245-078-9 Lodronate Loron Mebonat Ossiten Ostac Phosphonic acid, (dichloromethylene)bis-, disodium salt Phosphonic acid, (dichloromethylene)di-, disodium salt (8CI) Sodium clodronate
pdb file: 173222.pdb
sdf file: 173222.sdf
directory: 173222

126-96-5 50933-77-2 Acetic acid dimer, sodium salt Acetic acid, sodium salt (2:1) Acetic acid, sodium salt, compd. with acetic acid (1:1) Acid acetate Dykon EINECS 204-814-9 HSDB 736 SODIUM DIACETATE Sodium acetate (1:2) Sodium acetate, acid Sodium acetate, compd. with acetic acid (1:1) Sodium acid acetate Sodium hydrogen acetate Sodium hydrogen di(acetate) Sodium hydrogen diacetate
pdb file: 173433.pdb
sdf file: 173433.sdf
directory: 173433

(4-Aminophenyl)arsonic acid sodium salt 127-85-5 AI3-29289-X Anhydrous sodium arsanilate Arsamin Arsanilic acid sodium salt Arsanilic acid, monosodium salt Arsinosolvin Arsonic acid, (4-aminophenyl)-, monosodium salt Arsonic acid, (4-aminophenyl)-, monosodium salt (9CI) Atoxyl CCRIS 4715 EINECS 204-869-9 HSDB 5189 Monosodium (4-aminophenyl)arsonate NCI-61176 NCI-C61176 Nuarsol Piglet pro-gen V Pro-Gen sodium Protoxyl SODIUM ARSANILATE Soamin Sodium aminarsonate Sodium aminophenol arsonate Sodium aminophenylarsonate Sodium anilarsonate Sodium aniline-arsonate Sodium arsanilate [UN2473] [Poison] Sodium arsonilate Sodium hydrogen 4-aminophenylarsonate Sodium p-aminobenzenearsonate Sodium p-aminophenylarsonate Sodium p-arsanilate Sodium-analine arsonate Sonate Trypoxyl UN2473
pdb file: 173467.pdb
sdf file: 173467.sdf
directory: 173467

127-95-7 EINECS 204-873-0 Essential salt of lemon Ethanedioic acid, monopotassium salt HSDB 671 Kleesalz [German] Monopotassium oxalate Oxalic acid, monopotassium salt POTASSIUM ACID OXALATE Potassium binoxalate Potassium hydrogen oxalate Potassium oxalate (KHC2O4) Potassium quadroxalate Potassium salt of sorrel Sal Acetosella Salt of sorrel Sorrel salt
pdb file: 173470.pdb
sdf file: 173470.sdf
directory: 173470

23563-78-2 BENZOIC ACID, p-(3-((2-MERCAPTOETHYL)AMINO)PROPYL)AMINO-, ETHYL ESTER, S-ESTER w Benzoic acid, p-(3-((2-mercaptoethyl)amino)propyl)amino-, ethyl ester, S-ester with hydrogen thiosulfate Ethanethiol, 2-(3-(p-ethoxycarbonylanilino)propylamino)-, S-ester with hydrogen thiosulfate S-2-(2-(p-Ethoxycarbonylanilino)propylamino)ethyl hydrogen thiosulfate
pdb file: 174005.pdb
sdf file: 174005.sdf
directory: 174005

24704-41-4 ACETIC ACID, (ETHYLENEDINITRILO)TETRA-, COBALT SALT Cobalt(II) EDTA complex Cobaltate(2-), ((ethylenedinitrilo)tetraacetato)-, dihydrogen Ethylenediamine tetraacetic acid, cobalt salt
pdb file: 174526.pdb
sdf file: 174526.sdf
directory: 174526

11120-35-7 11129-22-9 11129-23-0 177697-01-7 24967-94-0 42616-56-8 9045-59-4 9083-19-6 Chondroitin sulfate B Chondroitin sulfate type B Chondroitinsulfuric acid Chondroitinsulfuric acid B Chondroitinsulfuric acid type B Chondroitinsulfuric acid, type B Chondroitinsulfuric acids, type B DERMATAN SULFATE DS 435 Dermatan 4-sulfate Dermatan hydrogen sulfate Dermatan sulfate, low molecular weight Dermatan sulphate Dermatan, 4-(hydrogen sulfate) Dermatan, hydrogen sulfate (ester) Desmin 370 EINECS 246-552-8 MF 701 MF 701 (polysaccharide) MF701 beta-Heparin
pdb file: 174677.pdb
sdf file: 174677.sdf
directory: 174677

(Z,Z)-Di-9-octadecenyl phosphonate 25088-57-7 DIOLEYL HYDROGEN PHOSPHITE Dioleyl phosphite Dioleyl phosphonate EINECS 246-608-1 HSDB 2602 Phosphonic acid, di-9-octadecenyl ester (Z,Z)-
pdb file: 174711.pdb
sdf file: 174711.sdf
directory: 174711

25103-54-2 65045-91-2 EINECS 246-618-6 Elco 106 HSDB 6158 Isodecanol, hydrogen phosphorodithioate, zinc salt Isodecyl ZDDP Phosphorodithioic acid, O,O-diisodecyl ester, zinc salt ZINC O,O-BISISODECYL DITHIOPHOSPHATE Zdtp Zinc O,O-Diisodecyl dithiophosphate Zinc isodecyl phosphorodithioate Zinc, bis(O,O-diisodecyl phosphorodithioato-S,S')- Zinc, bis(O,O-diisodecyl phosphorodithioato-kappaS,kappaS')-
pdb file: 174715.pdb
sdf file: 174715.sdf
directory: 174715

12084-10-5 13077-29-7 147395-45-7 15954-96-8 25481-21-4 ACETIC ACID, (ETHYLENEDINITRILO)TETRA-, NICKEL(II) COMPLEX Dihydrogen ((N,N'-ethylenebis(N-(carboxymethyl)glycinato))(4-)-N,N',O,O',ON,ON')nickelate(2-) Dihydrogen (ethylenediaminetetraacetato(4-))nickelate (2-) EINECS 247-019-2 Nickel ethylenediaminetetraacetic acid Nickel(II) EDTA complex Nickelate(2-), ((N,N'-1,2-ethanediylbis(N-((carboxy-kappaO)methyl)glycinato-kappaN,kappaO))(4-))-, dihydrogen, (OC-6-21)- Nickelate(2-), ((ethylenedinitrilo)tetraacetato)-, dihydrogen (8CI)
pdb file: 174918.pdb
sdf file: 174918.sdf
directory: 174918

1984-15-2 25681-89-4 Disodium dihydrogen methylenediphosphonate Disodium methylene diphosphonate MEDRONATE DISODIUM Medronate disodium [USAN] Phosphonic acid, methylenebis-, disodium dihydrogen salt
pdb file: 175020.pdb
sdf file: 175020.sdf
directory: 175020

25954-13-6 37337-53-4 59682-52-9 Ammonium ethyl (aminocarbonyl)phosphonate Ammonium ethyl carbamoyl phosphonate Ammonium ethyl carbamoylphosphonate Ammonium ethyl carbamoylphosphonate solution Ammonium, ethyl carbamoylphosphonate Ammonium-aethyl-carbamoyl-phosphonat [German] Caswell No. 465G DPX 1108 EINECS 247-363-3 EPA Pesticide Chemical Code 106701 Ethyl hydrogen (aminocarbonyl)phosphonate (9CI) FOSAMINE Fosamine [ANSI] Fosamine ammonium Fosamine ammonium salt Fosamine-ammonium HSDB 3435 Krenite Krenite brush control agent Phosphonic acid, (aminocarbonyl)-, monoethyl ester, monoammonium salt Phosphonic acid, carbamoyl-, monoethyl ester, ammonium salt
pdb file: 175126.pdb
sdf file: 175126.sdf
directory: 175126

(o-((2-Hydroxy-3-(hydroxymercure)propyl)carbamoyl)phenoxy)acetic acid 26552-50-1 Acetic acid, (o-((2-hydroxy-3-hydroxymercuri)propyl)carbamoyl)phenoxy- EINECS 247-796-8 Hydrogen (3-((alpha-carboxylato-o-anisoyl)amino)-2-hydroxypropyl)hydroxymercurate(1-) Hydroxymercuripropanolamide of o-carboxyphenoxyacetic acid MERCURY, (3-(alpha-CARBOXY-o-ANISAMIDO)-2-HYDROXYPROPYL)HYDROXY- Mercuderamid Mercury, (3-((2-(carboxylatomethoxy)benzoyl)amino)-2-hydroxypropyl)hydroxy-, hydrogen Merurate(1-), (3-((2-(carboxylatomethoxy)benzoyl)amino)-2-hydroxypropyl)hydroxy-, hydrogen Neptal Unephral
pdb file: 175391.pdb
sdf file: 175391.sdf
directory: 175391

(2-Hydroxyethyl) hydrogen maleate 2-Butenedioic acid (2Z)-, mono(2-hydroxyethyl) ester 26560-94-1 4-02-00-02214 (Beilstein Handbook Reference) 7330-07-6 BRN 3662887 EINECS 247-803-4 Ethylene glycol, maleate Ethylene glycol, mono(hydrogen maleate) MALEIC ACID, MONO(2-HYDROXYETHYL) ESTER Maleic acid, 2-hydroxyethyl ester Maleic acid, mono(hydroxyethyl) ester Mono-(2-hydroxyethyl)ester kyseliny maleinove [Czech] Monohydroxyethyl maleate
pdb file: 175392.pdb
sdf file: 175392.sdf
directory: 175392

25155-14-0 27157-94-4 51949-32-7 Cresyl aerofloat EINECS 248-273-7 HSDB 2623 O,O-Bis(methylphenyl) hydrogen dithiophosphate O,O-DITOLYL PHOSPHORODITHIOATE Phosphorodithioic acid, O,O-bis(methylphenyl) ester Phosphorodithioic acid, O,O-ditolyl ester
pdb file: 175557.pdb
sdf file: 175557.sdf
directory: 175557

27215-10-7 30556-15-1 DIISOOCTYL PHOSPHATE Diisooctyl acid phosphate Diisooctyl acid phosphate [UN1902] [Corrosive] Diisooctyl hydrogen phosphate EINECS 248-334-8 HSDB 2783 Isooctanol, hydrogen phosphate Phosphoric acid, diisooctyl ester UN1902
pdb file: 175582.pdb
sdf file: 175582.sdf
directory: 175582

27346-92-5 CINCHONINIC ACID, 2-FORMYL-, 2-(2-HYDROXYETHYL)HYDRAZONE, HYDROGENSULFATE (ester
pdb file: 175624.pdb
sdf file: 175624.sdf
directory: 175624

1-Heptyl 4-(phosphonooxy)benzoate 27864-56-8 BENZOIC ACID, p-HYDROXY-, HEPTYL ESTER, DIHYDROGEN PHOSPHATE Benzoic acid, 4-(phosphonooxy)-, 1-heptyl ester (9CI) PP7 p-Heptoxycarbonylphenyl phosphate
pdb file: 175835.pdb
sdf file: 175835.sdf
directory: 175835

(3,3'-((3,3'-Dihydroxy-1,1'-biphenyl-4,4'-diyl)bis(azo)bis(5-amino-2,7-naphthalenedisulfonato-(O4,O3)))dicopper, tetrasodium salt 10401-50-0 190258-21-0 2,7-Naphthalenedisulfonic acid, 3,3'((3,3'-dihydroxy(1,1'-biphenyl)-4,4'-diyl)bis(azo)bis(5-amino-4-hydroxy-, sodium salt, copper complex 23909-66-2 27569-07-9 28407-37-6 72882-28-1 Amanil Supra Blue 9GL C.I. 24401 C.I. Direct Blue 218 CCRIS 6142 CI Direct Blue 218 Copper, (mu-((tetrahydrogen 3,3'-((3,3'-dihydroxy-4,4'-biphenylene)bis(azo))bis(5-amino-4-hydroxy-2,7-naphthalenedisulfonato))(4-)))di-, tetrasodium salt Cuprate(4-) (mu-((3,3'-((3,3'-dihydroxy(1,1'-biphenyl)-4,4'-diyl)bis(azo))bis(5-amino-4-hydroxy-2,7-naphthalenedisulfonato))(8-)))di-, tetrasodium Cuprate(4-), (mu-((3,3'-((3,3'-di(hydroxy-kappaO)(1,1'-biphenyl)-4,4'-diyl)bis(azo-kappaN1))bis(5-amino-4-(hydroxy-kappaO)-2,7-naphthalenedisulfonato))(8-)))di-, tetrasodium Cuprate(4-), (mu-((3,3'-((3,3'-dihydroxy(1,1'-biphenyl)-4,4'-diyl)bis(azo))bis(5-amino-4-hydroxy-2,7-naphthalenedisulfonato))(8-)))di-, tetrasodium Cuprate(4-), (mu-((3,3'-((3,3'-dihydroxy(1,1'-biphenyl)-4,4'-diyl)bis(azo))bis-(5-amino-4-hydroxy-2,7-naphthalenedisulfonato))(8-)))di-, tetrasodium salt DIRECT BLUE 218 EINECS 249-008-8 Fastusol Blue 9GLP HSDB 4223 NCI C60877 Pontamine Bond Blue B Pontamine Fast Blue 7GLN Solantine Blue 10GL Tetrasodium (mu-((3,3'-((3,3'-dihydroxy(1,1'-biphenyl)-4,4'-diyl)bis(azo))bis(5-amino-4-hydroxynaphthalene-2,7-disulphonato))(8-)))dicuprate(4-)
pdb file: 175987.pdb
sdf file: 175987.sdf
directory: 175987

2-ETHYLHEXYL SODIUM PHOSPHATE 2-Ethylhexyl dihydrogen phosphate, sodium salt 31044-12-9 EINECS 250-443-0 HSDB 2625 Phosphoric acid, mono(2-ethylhexyl) ester, sodium salt
pdb file: 177334.pdb
sdf file: 177334.sdf
directory: 177334

32266-82-3 32838-28-1 BUTYRAMIDE, N-(2-ETHYLHEXYL)-3-HYDROXY-, SUCCINATE (monoester), CALCIUM SALT (2: Butoctamide hydrogen succinate calcium salt Butyramide, N-(2-ethylhexyl)-3-hydroxy-, succinate (monoester), calcium salt (2:1) Calcium N-2-ethylhexyl-beta-oxybutyramide semisuccinate Succinic acid, monoester with N-(2-ethylhexyl)-3-hydroxybutyramide, calcium salt (2:1)
pdb file: 177647.pdb
sdf file: 177647.sdf
directory: 177647

33286-30-5 35988-26-2 35988-42-2 CAT dipotassium salt Carboxyatractyloside Dipotassium carboxyatractyloside Dipotassium dihydrogen 15alpha-hydroxy-2beta-((2-O-isovaleryl-3,4-di-O-sulphonato-beta-D-glucopyranosyl)oxy)kaur-16-ene-18,19-dioate EINECS 251-444-9 Gummiferin KAUR-16-ENE-18,19-DIOIC ACID, 15-HYDROXY-2-((2-O-(3-METHYL-1-OXOBUTYL)-3,4-DI-O- Kaur-16-ene-18,19-dioic acid, 15-hydroxy-2-((2-O-(3-methyl-1-oxobutyl)-3,4-di-O-sulfo-beta-D-glucopyranosyl)oxy)-, dipotassium salt, (2-beta,15-alpha)- Potassium carboxyatractyloside
pdb file: 177913.pdb
sdf file: 177913.sdf
directory: 177913

(1-Ethyl-1-phenyl-2-(3,4,5-trimethoxybenzoyloxy)ethyl)dimethylammonium hydrogen maleate 34140-59-5 39133-32-9 BENZOIC ACID, 3,4,5-TRIMETHOXY-,
pdb file: 178168.pdb
sdf file: 178168.sdf
directory: 178168

15844-52-7 34831-02-2 COPPER (2+) NTA Copper nitrilotriacetate Copper nitrilotriacetic acid Cuprate(1-), (N,N-bis(carboxymethyl)glycinato(3-)-N,O,O',O'')-, hydrogen, (T-4)- EINECS 252-233-4 HSDB 1307 Hydrogen (N,N-bis(carboxymethyl)glycinato(3-)-N,O,O',O'')cuprate(1-)
pdb file: 178369.pdb
sdf file: 178369.sdf
directory: 178369

34831-03-3 EINECS 252-235-5 HSDB 1309 Hydrogen (N,N-bis(carboxymethyl)glycinato(3-)-N,O,O',O'')nickelate(1-) NICKEL (2+) NTA Nickel nitrilotriacetic acid Nickel(2+) NTA Nickelate(1-), (N,N-bis(carboxymethyl)glycinato(3-)-N,O,O',O'')-, hydrogen, (T-4)-
pdb file: 178370.pdb
sdf file: 178370.sdf
directory: 178370

36023-34-4 HEPTANOIC ACID, 3-(4-(8-CHLORO-10,11-DIHYDRODIBENZO(b,f)THIEPIN-10-YL)-1-PIPERAZ Heptanoic acid, 3-(4-(8-chloro-10,11-dihydrodibenzo(b,f)thiepin-10-yl)-1-piperazinyl)propyl ester, (Z)-2-butenedioate (1:2) Oxyclothepin enanthate di(hydrogen maleate)
pdb file: 178722.pdb
sdf file: 178722.sdf
directory: 178722

108964-33-6 115868-70-7 37589-80-3 GTP gamma S GUANOSINE 5'-O-(3-THIOTRIPHOSPHATE) Guanosine 5'-(gamma-S)triphosphate Guanosine 5'-(trihydrogen diphosphate), P'-anhydride with phosphorothioic acid gamma-Thio-GTP
pdb file: 179103.pdb
sdf file: 179103.sdf
directory: 179103

37984-73-9 5-Amino-2-chlorobenzoic acid sulfate AI3-33427 BENZOIC ACID, 5-AMINO-2-CHLORO-, HYDROGEN SULFATE Benzoic acid, 5-amino-2-chloro-, sulfate (1:1)
pdb file: 179174.pdb
sdf file: 179174.sdf
directory: 179174

3-Hydroxy-2-methyl-5-((phosphonooxy)methyl)-4-pyridinecarboxaldehyde monohydrate 3-Hydroxy-5-(hydroxymethyl)-2-methylisonicotinaldehyde 5-phosphate monohydrate 4-Pyridinecarboxaldehyde, 3-hydroxy-2-methyl-5-((phosphonooxy)methyl)-, monohydrate 41468-25-1 PYRIDOXAL-5'-PHOSPHATE MONOHYDRATE Phosphopyridoxal monohydrate Pyridoxal, 5-(dihydrogen phosphate), monohydrate Pyridoxal-5-monophosphoric acid ester monohydrate Pyridoxal-5-phosphate, monohydrate Pyridoxyl phosphate monohydrate
pdb file: 180010.pdb
sdf file: 180010.sdf
directory: 180010

16485-39-5 468-61-1 52432-72-1 BUTYRIC ACID, 2-ETHYL-2-PHENYL-, 2-(2-(DIETHYLAMINO)ETHOXY)ETHYL ESTER, CITRATE Batoril Benzeneacetic acid, alpha,alpha-diethyl-, 2-(2-(diethylamino)ethoxy)ethyl ester, citrate (1:1) Bronchell Dorex EINECS 257-910-8 Ethochlon Hihustan Hustopan Ox Marukofon-A Neobex Oxeladin citrate Oxeladin dihydrogen citrate Oxeladine citrate Pectamol Pectussil Psxeladine Silopentol Tussilisin
pdb file: 181260.pdb
sdf file: 181260.sdf
directory: 181260

53108-50-2 COBALT (2+) NTA Cobalt nitrilotriacetic acid Cobalt(2+) nitrilotriacetic acid Cobaltate(1-), (N,N-bis((carboxy-kappaO)methyl)glycinato(3-)-kappaN,kappaO)-, hydrogen, (T-4)- Cobaltate(1-), (N,N-bis(carboxymethyl)glycinato(3-)-N,O,O',O'')-, hydrogen EINECS 258-368-5 HSDB 1310 Hydrogen (N,N-bis(carboxymethyl)glycinato(3-)-N,O,O',O'')cobaltate(1-)
pdb file: 181456.pdb
sdf file: 181456.sdf
directory: 181456

12169-66-3 12366-05-1 12366-06-2 15200-31-4 20960-01-4 25481-20-3 54453-03-1 82230-89-5 ACETIC ACID, (ETHYLENEDINITRILO)TETRA-, COPPER(II) COMPLEX Caswell No. 240 Copper EDTA complex Copper ethylenediaminetetraacetate Cuprate(2-), ((N,N'-1,2-ethanediylbis(N-((carboxy-kappaO)methyl)glycinato-kappaN,kappaO))(4-))-, dihydrogen, (OC-6-21)- Cuprous ion-edta complex Dihydrogen ((N,N'-ethylenebis(N-(carboxymethyl)glycinato))(4-)-N,N',O,O',ON,ON')cuprate(2-) EINECS 259-169-6 EPA Pesticide Chemical Code 039105
pdb file: 181866.pdb
sdf file: 181866.sdf
directory: 181866

3'-ADENYLIC ACID, SODIUM SALT 54835-81-3 Adenosine 3'-(dihydrogen phosphate), sodium salt Na3AMP
pdb file: 181978.pdb
sdf file: 181978.sdf
directory: 181978

((2-(Diethylamino)ethyl)thio)acetic acid 8-ester with (3aS,4R,5S,6S,8R,9R,9aR,10R)-octahydro-5,8-dihydroxy-4,6,9,10-tetramethyl-6-vinyl-3a,9-propano-3aH-cyclopentacycloocten-1(4H)-one fumarate (1:1) (salt) 14-Deoxy-14-((2-diethylaminoethyl)-mercaptoacetoxy)-mutilin hydrogen fumarate 14-Desossi-14-((2-dietilaminoetil)mercapto-acetossi)mutilin idrogeno fumarato [Italian] 55297-96-6 56193-13-6 81723hfu 89708-74-7 Acetic acid, ((2-(diethylamino)ethyl)thio)-, 6-ethenyldecahydro-5-hydroxy-4,6,9,10-tetramethyl-1-oxo-3-alpha,9-propano-3-alpha-H-cyclopentacycloocten-8-yl ester, (E)-2-butenedioate (1:1) (salt) Acetic acid, ((2-(diethylamino)ethyl)thio)-, 6-ethenyldecahydro-5-hydroxy-4,6,9,10-tetramethyl-1-oxo-3a,9-propano-3aH-cyclopentacycloocten-8-yl ester, (3aS-(3aalpha,4beta,5alpha,6alpha,8beta,9alpha,9abeta,10S*))-, (E)-2-butenedioate (1:1) (salt) Dynamutilin EINECS 259-581-6 SQ 22947 Sandoz 81723hfu TIAMULIN FUMARATE Thiamutilin fumarate Tiamulin fumarate [USAN] Tiamulin hydrogen fumarate Tiavet
pdb file: 182128.pdb
sdf file: 182128.sdf
directory: 182128

1,4-Naphthalenedione, 2-methyl-, compd. with sodium hydrogen sulfite (1:1) 1,4-Naphthoquinone, 2-methyl-, sodium bisulfite 2-Methyl-1,4-naphthochinon-natrium-bisulfit trihydrat [German] 2-Methyl-1,4-naphthoquinone sodiumbisulfite 2-Naphthalenesulfonic acid, 1,2,3,4-tetrahydro-2-methyl-1,4-dioxo-, sodium 57414-02-5 Menadion sodium bisulfite Sulfurous acid, monosodium salt, compd. with 2-methyl-1,4-naphthalenedione (1:1) Vitamin K3 sodium bisulfite trihydrate
pdb file: 182881.pdb
sdf file: 182881.sdf
directory: 182881

4-Amino-5-chloro-2-methoxy-N-(1-benzyl-4-piperidyl)benzamide malate 57645-91-7 BENZAMIDE, 4-AMINO-5-CHLORO-2-METHOXY-N-(1-BENZYL-4-PIPERIDYL)-, MALATE Clebopride hydrogen malate Clebopride malate EINECS 260-874-6 Malic acid, compound with 4-amino-N-(1-(benzyl)piperidin-4-yl)-5-chloro-2-methoxybenzamide (1:1)
pdb file: 183036.pdb
sdf file: 183036.sdf
directory: 183036

5,5-Dimethylcapronsaure-beta-diaethylaminoaethylesterdihydrogencitrat [German] 5,5-Dimethylhexanoic acid 2-(diethylamino)ethyl ester citrate 58568-13-1 HEXANOIC ACID, 5,5-DIMETHYL-, 2-(DIETHYLAMINO)ETHYL ESTER, CITRATE
pdb file: 183268.pdb
sdf file: 183268.sdf
directory: 183268

4-Trimethylsilylbuttersaure-beta-diathylaminoathylesterdihydrogencitrat [German] 4-Trimethylsilylbutyric acid 2-(diethylamino)ethyl ester citrate 58568-15-3 BUTYRIC ACID, 4-TRIMETHYLSILYL-, 2-(DIETHYLAMINO)ETHYL ESTER, CITRATE
pdb file: 183269.pdb
sdf file: 183269.sdf
directory: 183269

2,2-Diphenylacetic acid (2,2-dimethyl-3-morpholinopropyl) ester hydrogen sulfate (2:1) 66859-41-4 ACETIC ACID, 2,2-DIPHENYL-, (2,2-DIMETHYL-3-MORPHOLINOPROPYL) ESTER, HYDROGEN SU Acetic acid, 2,2-diphenyl-, (2,2-dimethyl-3-morpholinopropyl) ester, hydrogen sulfate (2:1)
pdb file: 187310.pdb
sdf file: 187310.sdf
directory: 187310

67031-52-1 BENZOIC ACID, p-AMINO-, 2-((1-METHYLHEPTYL)AMINO)ETHYL ESTER, HYDROGEN SULFATE ( Benzoic acid, p-amino-, 2-((1-methylheptyl)amino)ethyl ester, hydrogen sulfate (2:1) p-Aminobenzoic acid 2-((1-methylheptyl)amino)ethyl ester hydrogen sulfate (2:1)
pdb file: 187800.pdb
sdf file: 187800.sdf
directory: 187800

(Diethyl(4-methyl-2-oxo-2H-benzopyran-7-yl))ammonium hydrogen sulphate 2H-1-Benzopyran-2-one, 7-(diethylamino)-4-methyl-, sulfate (1:1) 4-Methyl-7-(diethylamino)coumarin, hydrosulfate 4-Methyl-7-diethylaminocoumarin, hydrogensulfate 67210-66-6 7-(Diethylamino)-4-methyl-2H-1-benzopyran-2-one sulfate (1:1) 7-(Diethylamino)-4-methylcoumarin sulfate 7-Diethylamino-4-methylcoumarin sulfuric acid salt COUMARIN, 7-DIETHYLAMINO-4-METHYL-, HYDROGEN SULFATE Coumarin, 7-(diethylamino)-4-methyl-, sulfate (1:1) Diethyl-4-methyl-7-coumarinylammonium hydrogen sulfate EINECS 266-604-3
pdb file: 188256.pdb
sdf file: 188256.sdf
directory: 188256

69781-15-3 BENZOIC ACID, m-AMINO-, (2-(ETHYLAMINO)-2-METHYL)PROPYL ESTER, HYDROGEN SULFATE m-Aminobenzoic acid (2-(ethylamino)-2-methyl)propyl ester hydrogen sulfate
pdb file: 189114.pdb
sdf file: 189114.sdf
directory: 189114

69781-20-0 BENZOIC ACID, m-AMINO-, (2-(ISOPROPYLAMINO)-2-METHYL)PROPYL ESTER, HYDROGEN SULF Benzoic acid, m-amino-, (2-(isopropylamino)-2-methyl)propyl ester, hydrogen sulfate m-Aminobenzoic acid (2-(isopropylamino)-2-methyl)propyl ester hydrogen sulfate
pdb file: 189118.pdb
sdf file: 189118.sdf
directory: 189118

76584-70-8 99-66-1 Abbott 50711 DIVALPROEX SODIUM Delepsine Depakote Depakote ER Divalproex sodium [USAN] Epilex Epival Natrium hydrogen bis(2-propylvalerat) Pentanoic acid, 2-propyl-, sodium salt (2:1) Sodium hydrogen bis(2-propylpentanoate) Sodium hydrogen bis(2-propylvalerate) Sodium hydrogen divalproate Sprinkle Valcote Valparin Valproate semisodique [French] Valproato semisodico [Spanish] Valproatum seminatricum [Latin] Valproic acid semisodium salt (2:1)
pdb file: 191341.pdb
sdf file: 191341.sdf
directory: 191341

2-HEPTENOIC ACID, 7-((2-AMINO-2-CARBOXYETHYL)THIO)-2-(((2,2-DIMETHYLCYCLOPROPYL) 2-Heptenoic acid, 7-((2-amino-2-carboxyethyl)thio)-2-(((2,2-dimethylcyclopropyl)carbonyl)amino)-, monosodium salt, (R-(R*,S*-(Z)))- 81129-83-1 82009-34-5 85875-53-2 Cilastatin sodium Cilastatin sodium [USAN:JAN] Cilastatin sodium salt EINECS 279-694-4 L 642957 MK 0791 MK 791 Primaxin Sodium (Z)-7-(((R)-2-amino-2-carboxyethyl)thio)-2-((S)-2,2-dimethylcyclopropanecarboxamido)-2-heptenoate Sodium hydrogen (R-(R*,S*-(Z)))-7-((2-amino-2-carboxylatoethyl)thio)-2-(((2,2-dimethylcyclopropyl)carbonyl)amino)hept-2-enoate
pdb file: 192214.pdb
sdf file: 192214.sdf
directory: 192214

81735-36-6 CINCHONINIC ACID, 7-CHLORO-2-FORMYL-, 2-(2-HYDROXYETHYL)HYDRAZONE, HYDROGENSULFA
pdb file: 192287.pdb
sdf file: 192287.sdf
directory: 192287

80529-93-7 86050-77-3 Diethylenetriaminepentaacetic acid dimeglumine salt gadolinium chelate Dihydrogen (N,N-bis(2-(bis(carboxymethyl)amino)ethyl)glycinato(5-))gadolinate(2-), compound with 1-deoxy-1-(methylamino)-D-glucitol (1:2) Dimeglumine-gadolinium-dtpa GADOPENTETATE DIMEGLUMINE Gadolinate(2-), (N,N-bis(2-(bis(carboxymethyl)amino)ethyl)glycinato(5-))-, dihydrogen, compd. with 1-deoxy-1-(methylamino)-D-glucitol (1:2) Gadopentetate Dimeglumine [USAN] Gadopentetic acid dimeglumine salt Magnevist Meglumine gadopentetate Resovist SHL 451A ZK 93035
pdb file: 192903.pdb
sdf file: 192903.sdf
directory: 192903

77356-04-8 91993-57-6 BORANECARBOXYLIC ACID, compd. with METHYLAMINE (1:1) Borate(1-), (carboxylato)dihydro(methanamine)-, hydrogen (T-4)- (9CI)
pdb file: 193642.pdb
sdf file: 193642.sdf
directory: 193642

100311-17-9 4-Amino-2-propoxythiobenzoic acid S-(2-(diethylamino)ethyl) ester hydrogen phosphate BENZOIC ACID, 4-AMINO-2-PROPOXYTHIO-, S-(2-(DIETHYLAMINO)ETHYL) ESTER, HYDROGEN Benzoic acid, 4-amino-2-propoxythio-, S-(2-(diethylamino)ethyl) ester, hydrogen phosphate WIN 3766
pdb file: 194744.pdb
sdf file: 194744.sdf
directory: 194744

100347-82-8 4-Amino-2-(benzyloxy)-benzoic acid 2-(dimethylamino)ethyl ester hydrogen phosphate BENZOIC ACID, 4-AMINO-2-(BENZYLOXY)-, 2-(DIMETHYLAMINO)ETHYL ESTER, HYDROGEN PHO Benzoic acid, 4-amino-2-(benzyloxy)-, 2-(dimethylamino)ethyl ester, hydrogen phosphate WIN 3415
pdb file: 194805.pdb
sdf file: 194805.sdf
directory: 194805

100347-84-0 4-Amino-2-(benzyloxy)benzoic acid 3-piperidinopropyl ester hydrogen phosphate BENZOIC ACID, 4-AMINO-2-(BENZYLOXY)-, 3-PIPERIDINOPROPYL ESTER, HYDROGEN PHOSPHA Benzoic acid, 4-amino-2-(benzyloxy)-, 3-piperidinopropyl ester, hydrogen phosphate WIN 3503
pdb file: 194806.pdb
sdf file: 194806.sdf
directory: 194806

100811-78-7 4-Amino-2-butoxy-benzoic acid 3-piperidinopropyl ester hydrogen phosphate BENZOIC ACID, 4-AMINO-2-BUTOXY-, 3-PIPERIDINOPROPYL ESTER, HYDROGEN PHOSPHATE WIN 3502
pdb file: 194949.pdb
sdf file: 194949.sdf
directory: 194949

100811-85-6 BENZOIC ACID, p-AMINO-, 3-(DIETHYLAMINO)PROPYL ESTER, HYDROGEN PHOSPHATE WIN 3618 p-Aminobenzoic acid 3-(diethylamino)propyl ester hydrogen phosphate
pdb file: 194956.pdb
sdf file: 194956.sdf
directory: 194956

102583-82-4 4-Amino-o-anisic acid 2-(diethylamino)ethyl ester hydrogen phosphate WIN 2595 o-ANISIC ACID, 4-AMINO-, 2-(DIETHYLAMINO)ETHYL ESTER, HYDROGEN PHOSPHATE
pdb file: 196081.pdb
sdf file: 196081.sdf
directory: 196081

102612-57-7 4-Amino-o-anisic acid 3-(diethylamino)propyl ester hydrogen phosphate Benzoic acid, 4-amino-2-methoxy-, 3-diethylaminopropyl ester, phosphate WIN 3604 o-ANISIC ACID, 4-AMINO-, 3-(DIETHYLAMINO)PROPYL ESTER, HYDROGEN PHOSPHATE
pdb file: 196163.pdb
sdf file: 196163.sdf
directory: 196163

109552-15-0 Aredia CGP 23339AE Disodium (3-amino-1-hydroxypropylidene)bisphosphonate pentahydrate Disodium dihydrogen (3-amino-1-hydroxypropylidene)diphosphonate, pentahydrate Disodium pamidronate pentahydrate Disodium-3-amino-1-hydroxypropylidene-1,1-diphosphonate pentahydrate PAMIDRONATE DISODIUM Pamidronate disodium [USAN:JAN] Pamidronate disodium pentahydrate Phosphonic acid, (3-amino-1-hydroxypropylidene)bis-, disodium salt, pentahydrate
pdb file: 196672.pdb
sdf file: 196672.sdf
directory: 196672

121268-17-5 66376-36-1 ALENDRONATE SODIUM Adronat Alendronate sodium [USAN] Alendronate sodium hydrate Alendronic acid monosodium salt trihydrate Alendros Aminohydroxybutylidene biphosphonate monosodium salt trihydrate Dronal Elandor Fosalan G-704,650 Monosodium (4-amino-1-hydroxybutylidene)bisphosphonate trihydrate Phosphonic acid, (4-amino-1-hydroxybutylidene)bis-, monosodium salt, trihydrate Sodium alendronate hydrate Sodium trihydrogen (4-amino-1-hydroxybutylidene)diphosphonate, trihydrate
pdb file: 196991.pdb
sdf file: 196991.sdf
directory: 196991

149845-07-8 89987-06-4 Disodium dihydrogen (((p-chlorophenyl)thio)methylene)diphosphonate Phosphonic acid, (((4-chlorophenyl)thio)methylene)bis-, disodium salt Skelid TILUDRONATE DISODIUM Tiludronate disodium [USAN]
pdb file: 197160.pdb
sdf file: 197160.sdf
directory: 197160

1-Hexanol, 2-ethyl-, hydrogen phosphate, sodium salt (7CI) 1-Hexanol, 2-ethyl-, phosphate, sodium salt (6CI) 141-65-1 2-Ethyl-1-hexanol hydrogen phosphate, sodium salt 298-07-7 Bis(2-ethylhexyl)sodium phosphate EINECS 205-493-8 PHOSPHORIC ACID, BIS(2-ETHYLHEXYL) ESTER, SODIUM SALT Phosphoric acid, bis(2-ethylhexyl)ester, sodium salt (8CI,9CI) Sodium bis(2-ethylhexyl) phosphate Sodium bis(2-ethylhexyl)phosphate Sodium di(2-ethylhexyl)phosphate Tergitol anionic P-28
pdb file: 197334.pdb
sdf file: 197334.sdf
directory: 197334

1-Hydrazino-2-phenylethane hydrogen sulphate 156-51-4 2-Phenylethylhydrazine dihydrogen sulfate 2-Phenylethylhydrazine dihydrogen sulphate 2-Phenylethylhydrazine hydrogen sulphate 2-Phenylethylhydrazine sulphate Alacine Alazin Alazine CCRIS 498 EINECS 205-856-0 EP-411 Estinerval HYDRAZINE, 2-PHENYLETHYL-, SULFATE Hydrazine, (2-phenylethyl)-, sulfate (1:1) Hydrazine, phenethyl-, sulfate (1:1) Kalgan Mao-Rem N-1544a NSC 170957 Nardelzine Nardil P 1531 Phenalzine dihydrogen sulfate Phenelzine acid sulfate Phenelzine bisulfate Phenelzine bisulphate Phenelzine dihydrogen sulfate Phenelzine hydrogen sulfate Phenelzine hydrogen sulphate Phenelzine sulfate Phenelzine sulfate [USAN] Phenelzine sulphate Phenethylhydrazin Phenethylhydrazine sulfate Phenethylhydrazine sulfate (1:1) Phenethylhydrazine sulphate Phenodyne Phenylethylhydrazine dihydrogen sulphate Phenylethylhydrazine sulphate S 1544 Stinerval WL 7 beta-Phenylethylhydrazine dihydrogen sulfate beta-Phenylethylhydrazine hydrogen sulphate beta-Phenylethylhydrazine sulfate
pdb file: 197340.pdb
sdf file: 197340.sdf
directory: 197340

298-14-6 CARBONIC ACID, MONOPOTASSIUM SALT CCRIS 3510 EINECS 206-059-0 EPA Pesticide Chemical Code 073508 K-Lyte K-Lyte DS K-Lyte/Cl Monopotassium carbonate Potassium acid carbonate Potassium bicarbonate Potassium hydrogen carbonate Potassium hydrogencarbonate
pdb file: 197346.pdb
sdf file: 197346.sdf
directory: 197346

2399-86-2 Dipotassium hydrogen nitrilotriacetate EINECS 219-271-3 NITRILOTRIACETIC ACID DIPOTASSIUM SALT
pdb file: 197585.pdb
sdf file: 197585.sdf
directory: 197585

12698-46-3 6104-59-2 86697-48-5 Benzenemethanaminium, N-(4-((4-((4-ethoxyphenyl)amino)phenyl)(4-(ethyl((3-sulfophenyl)methyl)amino)phenyl)methylene)-2,5-cyclohexadien-1-ylidene)-N-ethyl-3-sulfo-, hydroxide, inner salt, monosodium salt Benzenemethanaminium, N-(4-((4-((4-ethoxyphenyl)amino)phenyl)(4-(ethyl((3-sulfophenyl)methyl)amino)phenyl)methylene)-2,5-cyclohexadien-1-ylidene)-N-ethyl-3-sulfo-, inner salt, monosodium salt Brilliant Blue R C.I. Acid Blue 83 COOMASSIE BRILLIANT BLUE R EINECS 228-060-5 Eriosin Brilliant Cyanine 6B Hydrogen (4-(4-(p-ethoxyanilino)-4'-(ethyl(m-sulphonatobenzyl)amino)benzhydrylene)cyclohexa-2,5-dien-1-ylidene)(ethyl)(m-sulphonatobenzyl)ammonium, monosodium salt
pdb file: 197629.pdb
sdf file: 197629.sdf
directory: 197629

10213-95-3 102323-69-3 102980-92-7 6252-76-2 67577-85-9 9-(2-Carboxyphenyl)-3-((2-methylphenyl)amino)-6-((2-methyl-4-sulf- ophenyl)amino)xanthylium, hydroxide, inner salt, monosodium salt ACID VIOLET 9 C.I. Acid Violet 9 CI 45190 EINECS 228-377-9 Hydrogen 9-(2-carboxylatophenyl)-3-(2-methylanilino)-6-(2-methyl-4-sulphoanilino)xanthylium, monosodium salt Xanthylium, 9-(2-carboxyphenyl)-3-((2-methylphenyl)amino)-6-((2-methyl-4-sulf- ophenyl)amino)-, hydroxide, inner salt, monosodium salt Xanthylium, 9-(2-carboxyphenyl)-3-((2-methylphenyl)amino)-6-((2-methyl-4-sulfophenyl)amino)-, hydroxide, inner salt, monosodium salt Xanthylium, 9-(2-carboxyphenyl)-3-((2-methylphenyl)amino)-6-((2-methyl-4-sulfophenyl)amino)-, inner salt, monosodium salt
pdb file: 197639.pdb
sdf file: 197639.sdf
directory: 197639

163678-43-1 753-53-7 7578-36-1 Borate(1-), (acetato-O)trifluoro-, hydrogen, (beta-4)- Borate(1-), (acetato-kappaO)trifluoro-, hydrogen, (T-4)- Boron fluoride, compound with acetic acid Boron trifluoride acetic acid complex Boron trifluoride acetic acid complex [UN1742] [Corrosive] EINECS 231-477-5 Hydrogen (acetato-O)trifluoroborate(1-) UN1742
pdb file: 197680.pdb
sdf file: 197680.sdf
directory: 197680

10039-32-4 7632-05-5 Phosphoric acid, disodium salt, dodecahydrate Sodium monohydrogen phosphate dodecahydrate (2:1:1:12) Sodium phosphate, dibasic
pdb file: 197715.pdb
sdf file: 197715.sdf
directory: 197715

10048-95-0 7631-89-2 ARSENIC ACID, DISODIUM SALT, HEPTAHYDRATE Arsenic acid (H3AsO4), disodium salt, heptahydrate CCRIS 5553 Dibasic sodium arsenate (Na2HAsO4.7H2O) Dibasic sodium arsenate heptahydrate Disodium acid arsenate heptahydrate (Na2HAsO4.7H2O) Disodium arsenate, heptahydrate Disodium hydrogen arsenate (Na2HAsO4) heptahydrate Disodium monohydrogen arsenate heptahydrate Hydrogen disodium arsenate (HNa2AsO4) heptahydrate Sodium acid arsenate, heptahydrate Sodium arsenate heptahydrate Sodium arsenate, dibasic, heptahydrate Sodium hydrogen arsenate (Na2HAsO4) heptahydrate Sodium orthoarsenate heptahydrate
pdb file: 197719.pdb
sdf file: 197719.sdf
directory: 197719

10058-23-8 156736-98-0 219538-99-5 Caswell No. 699A EINECS 233-187-4 EPA Pesticide Chemical Code 063604 Monopotassium peroxymonosulfate Monopotassium peroxymonosulfurate POTASSIUM PEROXYMONOSULFATE Peroxymonosulfuric acid, monopotassium salt Potassium hydrogenperoxomonosulphate Potassium peroxymonosulfuric acid
pdb file: 197721.pdb
sdf file: 197721.sdf
directory: 197721

10103-43-2 Ammonium hydrogen thiosulphate Ammonium thiosulfate solution Ammonium thiosulfate solution (60 or less) EINECS 233-282-0 Thiosulfuric acid (H2S2O3), monoammonium salt
pdb file: 197741.pdb
sdf file: 197741.sdf
directory: 197741

113837-65-3 12002-26-5 136959-63-2 143478-32-4 188853-76-1 213778-75-7 251638-46-7 25498-02-6 294858-92-7 299177-59-6 340701-13-5 Colcoat MS 51 EINECS 234-412-9 M 51 M-Silicate 51 MKC Silicate MS 51 MKC Silicate MS 56 MKC Silicate MS 56S MKC Silicate MS 60 MS 51 Methyl hydrogen siloxane Methyl silicate Methyl silicate 51 Methyl silicate 56 Silicic acid, methyl ester Silicon methylate Silres MSE 100 Tetramethoxysilane homopolymer Tetramethoxysilane polymer
pdb file: 197829.pdb
sdf file: 197829.sdf
directory: 197829

14691-84-0 Diphosphoric acid, dipotassium salt Dipotassium dihydrogen pyrophosphate Dipotassium dihydrogenpyrophosphate Dipotassium diphosphate Dipotassium pyrophosphate EINECS 238-736-1 Potassium acid pyrophosphate Pyrophosphoric acid, dipotassium salt
pdb file: 198150.pdb
sdf file: 198150.sdf
directory: 198150

(Bis(2-ethylhexyloxy)maleoloxy)dibutylstannane 138556-84-0 15546-12-0 2-Ethylhexyl 6,6-dibutyl-14-ethyl-4,8,11-trioxo-5,7,12-trioxa-6-stannaoctadeca-2,9-dienoate 2-Ethylhexylmaleinan di-n-butylcinicity [Czech] 37645-34-4 5,7,12-Trioxa-6-stannaoctadeca-2,9-dienoic acid, 6,6-dibutyl-14-ethyl-4,8,11-trioxo-, 2-ethylhexyl ester Bis((2-(ethyl)hexyloxy)maleoyloxy)di(n-butyl)stannane Dibutyltin bis(2-ethylhexyl maleate) EINECS 239-595-9 Sn 25 Sn 25 (stabilizer) Stannane, bis((2-ethylhexyloxy)maleoloxy)dibutyl- Stannane, dibutylbis(3-(carboxyacryloyl)oxy)-, bis(2-ethylhexyl) ester, (Z,Z)- (8CI) Tin, bis(hydrogen maleato)dibutyl-, bis(2-ethylhexyl) ester
pdb file: 198190.pdb
sdf file: 198190.sdf
directory: 198190

15792-67-3 25305-78-6 Benzenemethanaminium, N-ethyl-N-(4-((4-(ethyl((3-sulfophenyl)methyl)amino)phenyl)(2-sulfophenyl)methylene)-2,5-cyclohexadien-1-ylidene)-3-sulfo-, hydroxide, inner salt, aluminum salt (3:2) Benzenemethanaminium, N-ethyl-N-(4-((4-(ethyl((3-sulfophenyl)methyl)amino)phenyl)(2-sulfophenyl)methylene)-2,5-cyclohexadien-1-ylidene)-3-sulfo-, inner salt, aluminum salt (3:2) C.I. Acid Blue 9, aluminum salt (3:2) EINECS 239-897-0 Hexahydrogen tris((ethyl)(4-((4-(ethyl(3-sulphonatobenzyl)amino)phenyl)(2-sulphonatophenyl)methylene)cyclohexa-2,5-dien-1-ylidene)(3-sulphonatobenzyl)ammonium), dialuminium salt
pdb file: 198208.pdb
sdf file: 198208.sdf
directory: 198208

15845-52-0 16040-38-3 EINECS 239-952-9 Lead hydrogen phosphate Lead hydrogenorthophosphate Phosphoric acid, lead(2+) salt (1:1)
pdb file: 198212.pdb
sdf file: 198212.sdf
directory: 198212

1-Phenanthrenecarboxylic acid, dodecahydro-1,4a-dimethyl-7-(1-methylethyl)-, methyl ester 30968-45-7 Abietic acid, dihydro-, methyl ester Hydrogenated methyl abietate Methyl dihydroabietate
pdb file: 198284.pdb
sdf file: 198284.sdf
directory: 198284

37222-66-5 MONOPOTASSIUM PEROXYMONOSULFATE, MIXT. WITH K2SO4 AND KHSO4 Peroxymonosulfuric acid, monopotassium salt, mixt. with dipotassium sulfate and potasssium hydrogen sulfate Potassium monoperoxysulfate
pdb file: 198379.pdb
sdf file: 198379.sdf
directory: 198379

53404-51-6 60-00-4 Caswell No. 438B EINECS 258-534-7 EPA Pesticide Chemical Code 039111 Ethylenediaminetetraacetic acid, potassium salt Glycine, N,N'-1,2-ethanediylbis(N-(carboxymethyl)-, monopotassium salt N,N'-1,2-Ethanediylbis(N-(carboxymethyl)glycine) monopotassium salt Potassium ethylenediaminetetraacetate Potassium trihydrogen ethylenediaminetetraacetate
pdb file: 198528.pdb
sdf file: 198528.sdf
directory: 198528

53404-68-5 Caswell No. 656B EPA Pesticide Chemical Code 066023 Mercurate(1-), amidophenyl(propanoato-O)-, hydrogen Phenylmercuric ammonium propionate Propanoic acid, mercury complex
pdb file: 198532.pdb
sdf file: 198532.sdf
directory: 198532

56977-47-0 Hydrofluorosilicic acid Silicate(2-), hexafluoro-, monohydrogen
pdb file: 198631.pdb
sdf file: 198631.sdf
directory: 198631

68155-92-0 94765-63-6 Copper phthalocyaninedisulfonic acid, compd. with 2-ethyl-N-(2-ethylhexyl)-1-hexanamine (1:2) Copper phthalocyaninedisulfonic acid, compd. with2-ethyl-N-(2-ethylhexyl)-1-hexanamine (1:2) Cuprate(2-), (29H,31H-phthalocyanine-C,C-disulfonato(4-)-N29,N39,N31,N32)-, dihydrogen, compd. with 2-ethyl-N-(2-ethylhexyl)-1-hexanamine (1:2) Cuprate(2-), (29H,31H-phthalocyanine-C,C-disulfonato(4-)-kappaN29,kappaN30,kappaN31,kappaN32)-, dihydrogen, compd. with 2-ethyl-N-(2-ethylhexyl)-1-hexanamine (1:2) Dihydrogen (29H,31H-phthalocyaninedisulphonato(4-)-N29,N30,N31,N32)cuprate(2-), compound with bis(2-ethylhexyl)amine (1:2) Disulfonated copper phthalocyanine, di(2-ethylhexyl)ammonium salt EINECS 268-991-4
pdb file: 199130.pdb
sdf file: 199130.sdf
directory: 199130

15066-87-2 540-82-9 EINECS 208-758-6 Ethyl hydrogen sulphate Ethyl sulfate Ethylsulphuric acid Monoethyl sulfate SULFURIC ACID, MONOETHYL ESTER Sulfethylic acid Sulfovinic acid
pdb file: 203656.pdb
sdf file: 203656.sdf
directory: 203656

1188-47-2 Acetic acid, nitrilotri-, copper(2+) salt (1:1) Cuprate(1-), (N,N-bis(carboxy-kappaO)methyl)glycinato(3-)-kappaN,kappaO)-, hydrogen, (T-4)-
pdb file: 203679.pdb
sdf file: 203679.sdf
directory: 203679

(1-Methylethyl) dihydrogen 2-hydroxypropane-1,2,3-tricarboxylate 1,2,3-Propanetricarboxylic acid, 2-hydroxy-, mono(1-methylethyl) ester 1321-57-9 Citric acid, monoisopropyl ester EINECS 215-319-2 Mono(1-methylethyl) 2-hydroxy-1,2,3-propanetricarboxylate Monoisopropyl citrate
pdb file: 203729.pdb
sdf file: 203729.sdf
directory: 203729

3129-90-6 Hydrogen isothiocyanate ISOTHIOCYANIC ACID Isothiocyanic acid [Forbidden]
pdb file: 203910.pdb
sdf file: 203910.sdf
directory: 203910

103947-10-0 104298-69-3 12777-86-5 184827-20-1 192230-72-1 204996-41-8 2609-88-3 3520-42-1 39470-83-2 61261-16-3 74871-35-5 Acid Leather Red KB Acid Red XB Acid Rhodamine B Acid red 52 Aizen Food Red No. 106 Amacid Rhodamine B Amido Rhodamine B Ammonium, (6-(diethylamino)-9-(2,4-disulfophenyl)-3H-xanthen-3-ylidene)diethyl-, hydroxide, inner salt, sodium salt Brilliant Acid Rhodamine B Brilliant Superlan Rhodamine 2B Brilliant Superlan Rhodamine B C.I. 45100 C.I. Acid Red 52 CCRIS 2446 CI 45100 EINECS 222-529-8 Erio Acid Red XB Erio Acid Red XBC Ethanaminium, N-(6-(diethylamino)-9-(2,4-disulfophenyl)-3H-xanthen-3-ylidene)-N- -ethyl-, hydroxide, inner salt, sodium salt Fenazo Pink XXB Food Red 106 Hydrogen 3,6-bis(diethylamino)-9-(2,4-disulphonatophenyl)xanthylium, sodium salt Kiton Rhodamine B Lissamine Rhodamine N-(6-(Diethylamino)-9-(2,4-disulfophenyl)-3H-xanthen-3-ylidene)-N- -ethyl
pdb file: 203939.pdb
sdf file: 203939.sdf
directory: 203939

1,2,3-Propanetricarboxylic acid, 2-hydroxy-, iron(3+) salt (1:1) 2338-05-8 28633-45-6 3522-50-7 Citric acid, iron(3+) salt (1:1) Citric acid, iron(3+) salt (1:1) (8CI) EINECS 222-536-6 FERRIC CITRATE Ferric citrate (VAN) Iron citrate Iron citrate, FeC6H5O7 Iron(III) citrate Iron, (hydrogen citrato(3-))- NSC 112227
pdb file: 203940.pdb
sdf file: 203940.sdf
directory: 203940

3921-30-0 68427-32-7 AI3-17201 Decyl dihydrogen phosphate EINECS 223-491-5 PHOSPHORIC ACID, MONODECYL ESTER n-Decyl phosphoric acid
pdb file: 203976.pdb
sdf file: 203976.sdf
directory: 203976

4712-55-4 Diphenoxyphosphine oxide Diphenyl hydrogen phosphite Diphenyl phosphite Diphenyl phosphonate EINECS 225-202-8 NSC 43786 Phenyl phosphonate Phenyl phosphonate, (PhO)2HPO Phosphonic acid, diphenyl ester Phosphorous acid, diphenyl ester
pdb file: 204012.pdb
sdf file: 204012.sdf
directory: 204012

1-Tridecanol, hydrogen phosphate 105268-89-1 5116-95-0 Bis(tridecan-1-yl) hydrogen phosphate Di(tridecyl)acid phosphate Ditridecyl acid phosphate EINECS 225-851-7
pdb file: 204035.pdb
sdf file: 204035.sdf
directory: 204035

7646-93-7 7778-80-5 AI3-04459 Acid potassium sulfate Caswell No. 682C EINECS 231-594-1 EPA Pesticide Chemical Code 005605 Monopotassium hydrogen sulfate Monopotassium sulfate NSC 409996 Potassium acid sulfate Potassium bisulfate Potassium bisulphate Potassium hydrogen sulfate Potassium hydrogen sulfate [UN2509] [Corrosive] Potassium hydrogen sulfate, solid Potassium hydrogensulphate Potassium hydrosulfate (KHSO4) Potassium sulfate Potassium sulfate (KHSO4) Sal enixum Sulfuric acid potassium salt (1:1) Sulfuric acid, monopotassium salt UN2509
pdb file: 204171.pdb
sdf file: 204171.sdf
directory: 204171

12262-56-5 7681-38-1 AI3-08654 BIF Bisulfate of soda Caswell No. 742 EINECS 231-665-7 EPA Pesticide Chemical Code 073201 Fanal GBS Monosodium hydrogen sulfate Monosodium sulfate NSC 71192 Niter cake Nitre cake SODIUM BISULFATE Sodium acid sulfate Sodium bisulfate, fused Sodium bisulfate, solid(DOT) Sodium hydrogen sulfate Sodium hydrogen sulfate (NaHSO4) Sodium hydrogen sulfate, solid (DOT) Sodium hydrogensulphate Sodium hydrosulfate Sodium pyrosulfate Sodium sulfate, NaHSO4 Sulfuric acid, monosodium salt WC-00 WC-Klosettreiniger WC-Perfect WC-Super
pdb file: 204172.pdb
sdf file: 204172.sdf
directory: 204172

7782-75-4 Magnesium dibasic phosphate trihydrate Magnesium hydrogen phosphate trihydrate Magnesium phosphate (1:1), trihydrate Magnesium phosphate (MgHPO4) trihydrate Magnesium phosphate, dibasic Magnesium phosphate, dibasic, trihydrate Phosphoric acid, magnesium salt (1:1), trihydrate
pdb file: 204218.pdb
sdf file: 204218.sdf
directory: 204218

10102-18-8 7782-82-3 EINECS 231-966-3 Hydrogen sodium selenite Hydrogen sodium selenium oxide Selenious acid, monosodium salt Sodium hydrogen trioxoselenite Sodium hydrogenselenite Sodium hydroselenite Sodium selenite Sodium selenite (7CI)
pdb file: 204219.pdb
sdf file: 204219.sdf
directory: 204219

29704-46-9 8043-44-5 9-Octadecenoic acid, 12-(sulfooxy)-, sodium salt, (9Z,12R)- EINECS 232-456-3 Sodium hydrogen (R)-12-(sulphooxy)oleate
pdb file: 204436.pdb
sdf file: 204436.sdf
directory: 204436

17421-79-3 60-00-4 Acetic acid, (ethylenedinitrilo)tetra-, monosodium salt (8CI) Caswell No. 438C EDTA monosodium salt EINECS 241-447-3 EPA Pesticide Chemical Code 039103 Ethylenediaminetetraacetic acid, sodium salt Glycine, N,N'-1,2-ethanediylbis(N-(carboxymethyl)-, monosodium salt Monosodium edetate Sodium edetate Sodium ethylenediaminetetraacetate Sodium trihydrogen ethylenediaminetetraacetate
pdb file: 204607.pdb
sdf file: 204607.sdf
directory: 204607

17572-97-3 Acetic acid, (ethylenedinitrilo)tetra-, tripotassium salt (8CI) EDTA tripotassium salt EINECS 241-543-5 Edetate tripotassium Ethylenediaminetetraacetic acid, tripotassium salt Glycine, N,N'-1,2-ethanediylbis(N-(carboxymethyl)-, tripotassium salt N,N'-1,2-Ethanediylbis(N-(carboxymethyl)glycine), tripotassium salt Sequestrene 50K3 Tripotassium EDTA Tripotassium ethylenediaminetetraacetate Tripotassium hydrogen ethylenediaminetetraacetate
pdb file: 204613.pdb
sdf file: 204613.sdf
directory: 204613

19473-49-5 5-Potassium hydrogen L-glutamate 56-86-0 70938-17-9 997-42-2 CCRIS 6564 EINECS 243-094-0 L-Glutamic acid, monopotassium salt MONOPOTASSIUM GLUTAMATE Monopotassium L-glutamate Potassium L-glutamate Potassium diglutamate Potassium glutamate Potassium glutaminate
pdb file: 204653.pdb
sdf file: 204653.sdf
directory: 204653

24808-52-4 Dihydrogen bis(L-ascorbato(2-)-02,03)ferrate(2-) EINECS 246-469-7 Ferrate(2-), bis(L-ascorbato(2-)-02,03)-, dihydrogen Ferrous ascorbate Ferrous cevitamate Iron(2+) L-ascorbate Iron(2+) di-L-ascorbate Iron(II) ascorbate L-Ascorbic acid, iron complex L-Ascorbic acid, iron(2+) salt (2:1)
pdb file: 204757.pdb
sdf file: 204757.sdf
directory: 204757

29809-42-5 Carbonic acid, thallium(1+) salt DITHALLIUM CARBONATE EINECS 249-868-4 NSC 112225 Thallium carbonate Thallium hydrogen carbonate Thallium(I) carbonate Thallous carbonate
pdb file: 205021.pdb
sdf file: 205021.sdf
directory: 205021

143-71-5 Biocodone Brocodid longum Codone Dicodethal Dicodrine Dicotrate Dihydrocodeinone acid tartrate Dihydrocodeinone bitartrate Dihydrocodeinone hydrogen tartrate Dihydrocodeinone tartrate EINECS 205-608-1 Hycon Hydrocodone anhydrous Hydrocodone bitartrate Hydrocodone bitartrate (anhydrous) [USAN] Hydrocodone hydrogen tartrate Hydrokon Mercodinone Morphinan-6-one, 4,5-epoxy-3-methoxy-17-methyl-, (5alpha)-, (2R,3R)-2,3-dihydroxybutanedioate (1:1) Morphinan-6-one, 4,5-epoxy-3-methoxy-17-methyl-, (5alpha)-, (R-(R*,R*))-2,3-dihydroxybutanedioate (1:1) Morphinan-6-one, 4,5-epoxy-3-methoxy-17-methyl-, (5alpha)-, (theta-(theta,theta))-2,3-dihydroxybutanedioate (1:1) Morphinan-6-one, 4,5alpha-epoxy-3-methoxy-17-methyl-, tartrate(1:1) Robidone Stodcodon Synkonin
pdb file: 205103.pdb
sdf file: 205103.sdf
directory: 205103

30771-84-7 BRN 3997583 S-((N-(2-(1-Adamantyloxy)ethyl)amidino)methyl) hydrogen thiosulfate Thiosulfuric acid (H2S2O3), S-(2-imino-2-((2-(tricyclo(3.3.1.13,7)dec-1-yloxy)ethyl)amino)ethyl) ester Thiosulfuric acid, S-ester with N-(2-(1-adamantyloxy)ethyl)-2-mercaptoacetamidine WR 145040
pdb file: 206281.pdb
sdf file: 206281.sdf
directory: 206281

30771-86-9 BRN 4000735 Methanethiol, N-(2-(1-adamantyloxy)-2-methylethyl)amidino-, hydrogen thiosulfate (ester) NSC 193496 S-((N-(2-(1-Adamantyloxy)-2-methylethyl)amidino)methyl) hydrogen thiosulfate Thiosulfuric acid, S-ester with N-(2-(1-adamantyloxy)propyl)-2-mercaptoacetamidine (8CI)
pdb file: 206283.pdb
sdf file: 206283.sdf
directory: 206283

35412-70-5 BRN 2859419 Ethanethiol, 2-(tricyclo(3.3.1.1(sup 3,7))dec-1-ylamino)-, dihydrogen phosphate (ester) Ethanethiol, 2-(tricyclo(3.3.1.1(sup3,7)dec-1-ylamino)- dihydrogen phosphate S-(2-(Adamantyl-1-amino)ethyl)thiophosphoric acid
pdb file: 206303.pdb
sdf file: 206303.sdf
directory: 206303

2-(1-Adamantyl)aminoethanethiol hydrogen sulfate (ester) 37018-31-8 BRN 2861884 Ethanethiol, 2-(1-adamantyl)amino-, hydrogen sulfate Ethanethiol, 2-(1-adamantyl)amino-, hydrogen sulfate (ester) Thiosulfuric acid (H2S2O3), S-(2-(tricyclo(3.3.1.13,7)dec-1-ylamino)ethyl) ester
pdb file: 206310.pdb
sdf file: 206310.sdf
directory: 206310

2-(2-Adamantylamino)ethanethiol hydrogen sulfate (ester) 37018-32-9 BRN 2859549 Ethanethiol, 2-(2-adamantylamino)-, hydrogen sulfate Ethanethiol, 2-(2-adamantylamino)-, hydrogen sulfate (ester) Thiosulfuric acid, S-(2-(tricyclo(3.3.1.1(sup 3,7))dec-2-ylamino)ethyl) ester
pdb file: 206311.pdb
sdf file: 206311.sdf
directory: 206311

40283-70-3 BRN 3985401 Methanethiol, (N-1-adamantyl)amidino-, hydrogen sulfate (ester) Methanethiol, (N-1-adamantyl)amidino-, hydrogen sulfate ester S-((N-1-Adamantylamidino)methyl) hydrogen sulfate Thiosulfuric acid (H2S203), S-(2-imino-2-(tricyclo(3.3.1.1(sup 3,7))dec-1-ylamino)ethyl) ester
pdb file: 206328.pdb
sdf file: 206328.sdf
directory: 206328

40283-72-5 BRN 2884121 Methanethiol, (N-1-adamantylmethyl)amidino-, hydrogen sulfate (ester) Methanethiol, (N-1-adamantylmethyl)amidino-, hydrogen sulfate ester NSC 187514 S-((N-1-Adamantylmethylamidino)methyl) hydrogen thiosulfate Thiosulfuric acid (H2S2O3), S-(2-imino-2-((tricyclo(3.3.1.13,7)dec-1-ylmethyl)amino)ethyl) ester (9CI)
pdb file: 206329.pdb
sdf file: 206329.sdf
directory: 206329

63869-14-7 Methanethiol, (N-1-adamantyl)amidino-, hydrogen sulfate (ester) hydrate Methanethiol, (N-1-adamantyl)amidino-, hydrogen sulfate, hydrate S-((N-1-Adamantylamidino)methyl) hydrogen thiosulfate, hydrate (4:1) Thiosulfuric acid (H2S2O3), S-(2-imino-2-(tricyclo(3.3.1.13,7)dec-1-ylamino)ethyl) ester, hydrate (4:1)
pdb file: 206407.pdb
sdf file: 206407.sdf
directory: 206407

1-Propanethiol, 3-((2-((tricyclo(3.3.1.1(sup 3,7))dec-1-ylmethyl)amino)ethyl)amino)-, dihydrogen phosphate (ester), hydrate (2:5) 88313-52-4 S-(N-(N-(Adamantyl-1-methyl)-2-aminoethyl)-3-aminopropyl)thiophosphoric acid hydrate (2:5)
pdb file: 206481.pdb
sdf file: 206481.sdf
directory: 206481

1-Propanethiol, 3-((2-(tricyclo(3.3.1.1(sup 3,7))dec-1-ylamino)ethyl)amino)-, dihydrogen phosphate (ester), hydrate (2:3) 88313-58-0 S-(N-(N-(Adamantyl-1)-2-aminoethyl)-3-aminopropyl)thiophosphoric acid sesquihydrate
pdb file: 206482.pdb
sdf file: 206482.sdf
directory: 206482

88313-59-1 Ethanethiol, 2-((2-((tricyclo(3.3.1.1(sup 3,7))dec-1-ylmethyl)amino)ethyl)amino)-, dihydrogen phosphate (ester), hydrate S-(N-(N-(Adamantyl-1-methyl)-2-aminoethyl)aminoethyl)thiophosphoric acid hydrate
pdb file: 206483.pdb
sdf file: 206483.sdf
directory: 206483

88313-60-4 Ethanethiol, 2-((3-(tricyclo(3.3.1.1(sup 3,7))dec-1-ylamino)propyl)amino)-, dihydrogen phosphate (ester), hydrate (1:2) S-(N-(N-(Adamantyl-1)-3-aminopropyl)aminoethyl)thiophosphoric acid dihydrate
pdb file: 206484.pdb
sdf file: 206484.sdf
directory: 206484

5226-98-2 Atropine O-(hydrogen sulphate) Benzeneacetic acid, alpha-((sulfooxy)methyl)-, 8-methyl-8-azabicyclo(3.2.1)oct-3-yl ester, endo- EINECS 226-026-4
pdb file: 206590.pdb
sdf file: 206590.sdf
directory: 206590

10086-45-0 14866-19-4 Calcium dihydrogenpyrophosphate, with a fluorine content of 0,005 or more by weight on the dry anhydrous product Diphosphoric acid, calcium salt (1:1) EINECS 238-933-2
pdb file: 206666.pdb
sdf file: 206666.sdf
directory: 206666

33774-52-6 4-(3-(Diethylamino)-2-hydroxypropyl)ajmalinium tartrate 47719-70-0 Ajmalanium, 4-(3-(diethylamino)-2-hydroxypropyl)-17,21-dihydroxy-, (17R,21alpha)-, salt with (2R,3R)-2,3-dihydroxybutanedioic acid (1:1) Ajmalanium, 4-(3-(diethylamino)-2-hydroxypropyl)-17,21-dihydroxy-, (17R,21alpha)-, salt with (R-(R*,R*))-2,3-dihydroxybutanedioic acid (1:1) Ajmalinium, 4-(3-(diethylamino)-2-hydroxypropyl)-, tartrate (1:1) (salt) Butanedioic acid, 2,3-dihydroxy- (2R,3R)-, ion(1-), (17R,21alpha)-4-(3-(diethylamino)-2-hydroxypropyl)-17,21-dihydroxyajmalanium Detajmium bitartrate Detajmium bitartrate anhydrous Detajmium hydrogen tartrate Tachmalcor
pdb file: 206683.pdb
sdf file: 206683.sdf
directory: 206683

2'-Deoxy-5'-guanylic acid 2'-Deoxy-GMP 2'-Deoxyguanosine 5'-phosphate 2'-Deoxyguanosine 5'-phosphoric acid 2'-Deoxyguanosine 5'MP 2'-Deoxyguanylic acid 2'-dGMP 33430-61-4 5'-DGMP 5'-Deoxyguanylic acid 5'-Guanylic acid, 2'-deoxy- (9CI) 902-04-5 Deoxy GMP Deoxy-GMP Deoxyguanosine 5'-monophosphate Deoxyguanosine 5'-phosphate Deoxyguanosine monophosphate Deoxyguanylate Deoxyguanylic acid EINECS 212-988-2 Guanosine, 2'-deoxy-, 5'-(dihydrogen phosphate) (8CI) Guanosine, 2'-deoxy-, 5'-phosphoric acid NSC 82626
pdb file: 207013.pdb
sdf file: 207013.sdf
directory: 207013

135556-16-0 2'-Deoxy-5'-uridylic acid 2'-Deoxyuridine 5'-monophosphate 2'-Deoxyuridine 5'-phosphate 2'-Deoxyuridylate 2'-Deoxyuridylic acid 4-24-00-01200 (Beilstein Handbook Reference) 42155-08-8 5'-Uridylic acid, 2'-deoxy- 87578-10-7 964-26-1 BRN 0042143 Deoxy-UMP Deoxyuridine 5'-monophosphate Deoxyuridine 5'-phosphate Deoxyuridine monophosphate Deoxyuridylic acid EINECS 213-518-9 Uridine, 2'-deoxy-, 5'-(dihydrogen phosphate) Uridine, 2'-deoxy-, 5'-phosphate dUMP
pdb file: 207017.pdb
sdf file: 207017.sdf
directory: 207017

1-beta-D-Arabinofuranosylcytosine 5'-monophosphate 1-beta-D-Arabinofuranosylcytosine 5'-phosphate 1beta-Arabino-furanosylcytosine-5'-monophosphoric acid, D- 2(1H)-Pyrimidinone, 4-amino-1-(5-O-phosphono-beta-D-arabinofuranosyl)- 7075-11-8 Ara 5'-cmp Arabinosylcytosine 5'-monophosphate Aracytidine 5'-monophosphate Aracytidine 5'-phosphate Cytarabine 5'-monophosphate Cytosine arabinoside 5'-monophosphate Cytosine arabinoside 5'-phosphate Cytosine arabinoside 5'MP Cytosine arabinoside monophosphate Cytosine, 1-beta-D-arabinofuranosyl-, 5'-(dihydrogen phosphate) (8CI) NSC 99445
pdb file: 207142.pdb
sdf file: 207142.sdf
directory: 207142

5873-16-5 61332-27-2 9-(2,4-Disulfophenyl)-3,6-bis(ethylamino)-2,7-dimethylxanthylium, hydroxide, inner salt, monosodium salt Acid red 50 CI 45220 EINECS 227-528-6 Hydrogen 9-(2,4-disulphonatophenyl)-3,6-bis(ethylamino)-2,7-dimethylxanthylium, monosodium salt Xanthylium, 9-(2,4-disulfophenyl)-3,6-bis(ethylamino)-2,7-dimethyl-, hydroxide, inner salt, monosodium salt Xanthylium, 9-(2,4-disulfophenyl)-3,6-bis(ethylamino)-2,7-dimethyl-, inner salt, monosodium salt
pdb file: 207157.pdb
sdf file: 207157.sdf
directory: 207157

17781-34-9 4-Hydroxymercuribenzenesulfonate 89640-49-3 Hydroxy(4-sulfophenyl)mercury Hydroxymercury benzenesulfonic acid Mercurate(1-), hydroxy(4-sulfonatophenyl)-, hydrogen PHMPS p-Hydroxy-mercuric-phenylsulfonic acid p-Hydroxymercuriphenylsulfonate para-Hydroxymercuribenzenesulfonate
pdb file: 207224.pdb
sdf file: 207224.sdf
directory: 207224

130443-69-5 42808-36-6 50497-65-9 Butyl oleate, sulfated, sodium salt EINECS 255-950-0 Octadecanoic acid, 9(or 10)-(sulfooxy)-, 1-butyl ester, sodium salt Oleic acid, butyl ester, hydrogen sulfate, sodium salt Oleic acid, butyl ester, sulfated, sodium salt Sodium butyl 9(or 10)-(sulphonatooxy)octadecanoate Sulfated butyl oleate, sodium salt Sulfonated butyl oleate, sodium salt
pdb file: 207261.pdb
sdf file: 207261.sdf
directory: 207261

(dA)n 25191-20-2 5'-Adenylic acid, 2'-deoxy-, homopolymer Adenosine, 2'-deoxy-, 5'-(dihydrogen phosphate), polymers (8CI) Deoxyadenylic acid polymer Oligo(dA) Poly dAP Poly(2'-deoxyadenylic acid) Poly(dA) Poly(deoxyadenylic acid) Polydeoxyriboadenylic acid
pdb file: 207290.pdb
sdf file: 207290.sdf
directory: 207290

1,4-Benzenedicarboxylic acid, compd. with (5alpha)-4,5-epoxy-14-hydroxy-3-methoxy-17-methylmorphinan-6-one 25333-72-6 4,5alpha-Epoxy-14-hydroxy-3-methoxy-17-methyl-6-oxomorphinan hydrogen terephthalate 76-42-6 EINECS 246-859-7 Morphinan-6-one, 4,5-epoxy-14-hydroxy-3-methoxy-17-methyl-, (5alpha)-, 1,4-benzenedicarboxylate (1:1) (salt) Morphinan-6-one, 4,5alpha-epoxy-14-hydroxy-3-methoxy-17-methyl-, terephthalate (1:1) (salt) Oxycodone terephthalate
pdb file: 207462.pdb
sdf file: 207462.sdf
directory: 207462

4-(Methoxycarbonyl)-1-phenethyl-4-(N-phenylpropionylamino)piperidinium dihydrogen citrate 4-Piperidinecarboxylic acid, 4-((1-oxopropyl)phenylamino)-1-(2-phenylethyl)-, methyl ester, 2-hydroxy-1,2,3-propanetricarboxylate (1:1) 59708-52-0 61380-27-6 Carfentanil citrate Carfentanil citrate [USAN] EINECS 262-748-6 Methyl 1-phenethyl-4-(N-phenylpropionamido)isonipecotate citrate (1:1) R 33799
pdb file: 207500.pdb
sdf file: 207500.sdf
directory: 207500

(-)-Methyl cis-3-methyl-1-phenethyl-4-(N-phenylpropionamido)isonipecotate oxalate (1:1) 4-Piperidinecarboxylic acid, 3-methyl-4-((1-oxopropyl)phenylamino)-1-(2-phenylethyl)-, methyl ester, cis, (-)-, ethanedioate (1:1) 61380-41-4 EINECS 262-750-7 Lofentanil oxalate Lofentanil oxalate [USAN] R 34,995 R 34995 cis-(-)-4-(Methoxycarbonyl)-3-methyl-1-phenethyl-4-(N-phenylpropionylamino)piperidinium hydrogen oxalate
pdb file: 207501.pdb
sdf file: 207501.sdf
directory: 207501

1H-Imidazole-4-ethanamine, phosphate (1:2) 2-Imidazol-4-ylethylamine orthophosphoric acid (1:2) 4-(2-Aminoethyl)imidazole bis(dihydrogen phosphate) 4-(2-Aminoethyl)imidazole di-acid phosphate 51-74-1 53623-99-7 74-56-6 EINECS 200-118-4 Histamine acid phosphate Histamine biphosphate Histamine dihydrogen phosphate Histamine diphosphate Histamine phosphate Histamine phosphate (1:2)
pdb file: 207516.pdb
sdf file: 207516.sdf
directory: 207516

(3R,5aS,6R,8aS,9R,10S,12R,12aR)-Decahydro-3,6,9-trimethyl-3,12-epoxy-12H-pyrano(4,3-j)-1,2-benzodioxepin-10-ol, hydrogen succinate 112346-66-4 252637-87-9 83507-69-1 88495-63-0 91487-94-4 Arsumax Artesunate Artesunate [INN] Artesunato [INN-Spanish] Artesunatum [INN-Latin] Artesunic acid Butanedioic acid, mono((3R,5aS,6R,8aS,9R,10S,12R,12aR)-decahydro-3,6,9-trimethyl-3,12-epoxy-12H-pyrano(4,3-j)-1,2-benzodioxepin-10-yl) ester Dihydroqinghasu hemsuccinate Plasmotrin Qinghaozhi WR 256283
pdb file: 207690.pdb
sdf file: 207690.sdf
directory: 207690

110-11-2 EINECS 203-736-2 Octyl hydrogen sulphate Sulfuric acid, monooctyl ester
pdb file: 208131.pdb
sdf file: 208131.sdf
directory: 208131

1070-62-8 AI3-06343 EINECS 213-977-5 Ethyl hydrogen glutarate Pentanedioic acid, monoethyl ester
pdb file: 208190.pdb
sdf file: 208190.sdf
directory: 208190

147584-41-6 147754-38-9 53457-65-1 53626-40-7 77-91-8 87774-72-9 Cholex Choline dihydrogen citrate Choline, citrate (1:1) (salt) Cholinvel Chothyn Cirrocolina Citracholin Citracholine Citrocholine Citrocol Colicitrin Delichol EINECS 201-068-6 Ethanaminium, 2-hydroxy-N,N,N-trimethyl-, salt with 2-hydroxy-1,2,3-propanetricarboxylic acid Ethanaminium, 2-hydroxy-N,N,N-trimethyl-, salt with 2-hydroxy-1,2,3-propanetricarboxylic acid (1:1) Neurotropan
pdb file: 208245.pdb
sdf file: 208245.sdf
directory: 208245

11056-18-1 116296-62-9 85568-22-5 N-29479 NSC 107041 NSC-107041 Nificin Niphimycin Ialpha Propanedioic acid, mono(5,7,9,19,23,25,27,31,33,34,35-undecahydroxy-15-(11-((imino(methylamino)methyl)amino)-1,3-dimethyl-7-undecenyl)-8,14,18,22,26,30-hexamethyl-17-oxo-16,37-dioxabicyclo(31.3.1)heptatriaconta-10,12,20-trien-3-yl) ester Scopa Scopafungin Scopafungin [USAN] Stereoisomer of 5,7,9,19,23,25,27,31,33,34,35-undecahydroxy-15-(11-((imino(methylamino)methyl)amino)-1,3-dimethyl-7-undecenyl)-8,14,18,22,26,30-hexamethyl-17-oxo-16,37-dioxabicyclo(31.3.1_heptatriaconta-10,12,20-trien-3-yl hydrogen propanedioate U 29479 U-29,479
pdb file: 208448.pdb
sdf file: 208448.sdf
directory: 208448

4-09-00-00715 (Beilstein Handbook Reference) 93-59-4 BRN 1210120 Benzenecarboperoxoic acid (9CI) Benzoyl hydroperoxide Benzoylhydrogen peroxide CCRIS 687 EINECS 202-260-2 Kyselina perbenzoova [Czech] Kyselina peroxybenzoova [Czech] Perbenzoic acid Peroxybenzoic acid
pdb file: 208826.pdb
sdf file: 208826.sdf
directory: 208826

101015-20-7 138-08-9 2-Dihydroxyphosphinoyloxyacrylic acid 2-Propenoic acid, 2-(phosphonooxy)- 53230-12-9 80206-33-3 Acrylic acid, 2-hydroxy-, dihydrogen phosphate EINECS 205-312-2 Phosphopyruvic acid
pdb file: 209416.pdb
sdf file: 209416.sdf
directory: 209416

110-50-9 141-33-3 Carbonodithioic acid, O-butyl ester, sodium salt EINECS 205-481-2 O-Butyl hydrogen dithiocarbonate , sodium salt
pdb file: 209440.pdb
sdf file: 209440.sdf
directory: 209440

142-98-3 Decyl hydrogen sulphate EINECS 205-576-9 Sulfuric acid, monodecyl ester
pdb file: 209454.pdb
sdf file: 209454.sdf
directory: 209454

2,7-Naphthalenedisulfonic acid, 3-((2-arsonophenyl)azo)-4,5-dihydroxy- 520-10-5 AI3-52540 Arsenazo I EINECS 208-285-5 Trisodium 2-(-hydrogen arsonatophenylazo)-1,8-dihydroxynaphthalene-3,6-disulphonate
pdb file: 210343.pdb
sdf file: 210343.sdf
directory: 210343

10040-45-6 2-Picolylidenebis(p-phenyl sodium sulfate) 4,4'-(2-Picolylidene)bis(phenylsulfuric acid) disodium salt 4,4'-(2-Pyridinylmethylene)bisphenol bis(hydrogen sulfate) (ester) disodium salt 4,4'-(2-Pyridylmethylene)diphenol bis(hydrogen sulfate) disodium salt 4,4'-(2-Pyridylmethylene)diphenolbis(hydrogen sulfate) (ester) disodium salt DA-1773 Disodium 4,4'-disulfoxydiphenyl-(2-pyridyl)methane EINECS 233-120-9 Evanol Guttalax Laxidogol Laxoberal Laxoberon Natrii picosulfas [INN-Latin] Neopax Phenol, 4,4'-(2-pyridylmethylene)bis-, bis(hydrogen sulfate), disodium salt Picosulfate de sodium [INN-French] Picosulfate sodium Picosulfato sodico [INN-Spanish] Picosulfol Rapilax Sodium Picosulfate Sodium Picosulfate [INN:JAN] Sodium picosulphate
pdb file: 210778.pdb
sdf file: 210778.sdf
directory: 210778

36983-81-0 Abbott 38642 Acetic acid, phosphono-, P,P-disodium salt, hydrate Acetic acid, phosphono-, disodium salt (9CI) Disodium carboxymethylphosphonate Disodium hydrogen phosphonatoacetate Disodium phosphonoacetate Disodium phosphonoacetate monohydrate EINECS 253-297-6 Fosfonet sodium Fosfonet sodium [USAN] NSC 138745 Phosphonoacetic acid, disodium salt, monohydrate
pdb file: 210785.pdb
sdf file: 210785.sdf
directory: 210785

105462-24-6 115436-72-1 Actonel Monosodium (1-hydroxy-2-(3-pyridinyl)ethylidene)bisphosphonate NE 58095 Phosphonic acid, (1-hydroxy-2-(3-pyridinyl)ethylidene)bis-, monosodium salt Risedronate sodium Risedronate sodium [USAN] Risedronic acid monosodium salt Sodium risedronate Sodium trihydrogen (1-hydroxy-2-(3-pyridyl)ethylidene)diphosphonate
pdb file: 210868.pdb
sdf file: 210868.sdf
directory: 210868

693-55-0 Decanedioic acid, monoethyl ester EINECS 211-753-1 Ethyl hydrogen sebacate Monoethyl sebacate NSC 53961 Sebacic acid, monoethyl ester
pdb file: 211838.pdb
sdf file: 211838.sdf
directory: 211838

818-88-2 AI3-11759 Decanoic acid, monomethyl ester EINECS 212-458-0 Methyl hydrogen sebacate
pdb file: 212141.pdb
sdf file: 212141.sdf
directory: 212141

1,2-Benzenedicarboxylic acid, monosodium salt 827-27-0 88-99-3 EINECS 212-568-9 Sodium hydrogen phthalate
pdb file: 212194.pdb
sdf file: 212194.sdf
directory: 212194

2-Butenedioic acid (2Z)-, mono(1-methylethyl) ester 924-83-4 EINECS 213-109-5 Isopropyl hydrogen maleate Isopropyl maleate half ester Monoisopropyl maleate
pdb file: 212394.pdb
sdf file: 212394.sdf
directory: 212394

2-tert-Butylaminoethanethiol hydrogen sulfate (ester) 926-52-3 BRN 2357891 Ethanethiol, 2-tert-butylamino-, hydrogen sulfate (ester) Thiosulfuric acid, S-(2-((1,1-dimethylethyl)amino)ethyl) ester
pdb file: 212406.pdb
sdf file: 212406.sdf
directory: 212406

142-45-0 2-Butynedioic acid, monopotassium salt 40636-47-3 928-04-1 Acetylenedicarboxylic acid, monopotassium salt EINECS 213-169-2 Monopotassium salt of acetylenedicarboxylic acid NSC 631597 Potassium hydrogen butynedioate U-4783
pdb file: 212413.pdb
sdf file: 212413.sdf
directory: 212413

2-Tridecylaminoethanethiol hydrogen sulfate (ester) 929-41-9 BRN 2376760 Ethanethiol, 2-tridecylamino-, hydrogen sulfate (ester) Thiosulfuric acid, S-(2-(tridecylamino)ethyl) ester WR 2236
pdb file: 212425.pdb
sdf file: 212425.sdf
directory: 212425

2-Pentadecylaminoethanethiol hydrogen sulfate (ester) 929-44-2 BRN 2380996 Ethanethiol, 2-pentadecylamino-, hydrogen sulfate (ester) Thiosulfuric acid, S-(2-(pentadecylamino)ethyl) ester WR 2345
pdb file: 212427.pdb
sdf file: 212427.sdf
directory: 212427

2-Octadecylaminoethanethiol hydrogen sulfate (ester) 929-47-5 BRN 2385563 Ethanethiol, 2-octadecylamino-, hydrogen sulfate (ester) Thiosulfuric acid, S-(2-(octadecylamino)ethyl) ester WR 2362
pdb file: 212430.pdb
sdf file: 212430.sdf
directory: 212430

2-Phenethylaminoethanethiol hydrogen sulfate (ester) 953-22-0 BRN 2731447 Ethanethiol, 2-phenethylamino-, hydrogen sulfate (ester) Thiosulfuric acid, S-(2-(phenethylamino)ethyl) ester WR 2456
pdb file: 212564.pdb
sdf file: 212564.sdf
directory: 212564

1070-34-4 AI3-06253 Butanedioic acid, monoethyl ester EINECS 213-973-3 Ethyl hydrogen succinate
pdb file: 212789.pdb
sdf file: 212789.sdf
directory: 212789

2-(2-Dimethylamino)-ethanol hydrogen N-acetylglutamate 2-(Dimethylamino)ethanol N-acetylglutamate 2-(Dimethylamino)ethanol hydrogen N-acetylglutamate 3342-61-8 Aceglumate de deanol [INN-French] Aceglumate de demanol Aceglumato de deanol [INN-Spanish] Cleregil Deanol aceglumate Deanol aceglumate [INN] Deanoli aceglumas [INN-Latin] Deanolo aceglumato [DCIT] Demanol aceglumate Dimethyl-amino-ethanol sel de l'acetyl glutamate acide [French] Dimethylaminoethanol acetyl-L-glutamate EINECS 222-085-5 Ethanol, 2-(dimethylamino)-, N-acetyl-L-glutamate (salt) (1:1) Glutamic acid, N-acetyl-, compd. with 2-(dimethylamino)ethanol (1:1), L- N-Acetyl-L-glutamic acid compd. with 2-(dimethylamino)ethanol (1:1) Otrun Risatarun
pdb file: 213326.pdb
sdf file: 213326.sdf
directory: 213326

2-(2,2-Dicyclohexylethyl)piperidine acid maleate 2-(2,2-Dicyclohexylethyl)piperidine maleate 2-(2,2-Dicyclohexylethyl)piperidine maleate (1:1) 2-(2,2-Dicyclohexylethyl)piperidinium hydrogen maleate 6724-53-4 CCRIS 5491 EINECS 229-775-5 Perhexiline maleate Perhexiline maleate [USAN] Pexid Piperidine, 2-(2,2-dicyclohexylethyl)-, (Z)-2-butenedioate (1:1) Piperidine, 2-(2,2-dicyclohexylethyl)-, maleate (1:1)
pdb file: 213383.pdb
sdf file: 213383.sdf
directory: 213383

(32P)-Sodium hydrogen phosphate 7635-46-3 Dibasic sodium phosphate-(sup 32)P Disodium hydrogen phosphate (32P) Disodium hydrogen phosphate (P32) Disodium hydrogen phosphate labeled with 32P Phosphoric-(sup 32)P acid, disodium salt Phosphoric-32P acid, disodiuk salt Phosphotope Sodium hydrogen phosphate (P-32) Sodium phosphate P 32 Sodium phosphate P 32 [USAN]
pdb file: 213388.pdb
sdf file: 213388.sdf
directory: 213388

2-(Phosphonooxy)benzoic acid 2-Carboxyphenylphosphoric acid 2-Phosphonoxybenzoesaeure [German] 2-Phosphonoxybenzoic acid 4-10-00-00142 (Beilstein Handbook Reference) 6064-83-1 BRN 2619142 Benzoic acid, 2-(phosphonooxy)- (9CI) Benzoic acid, o-(phosphonooxy)- Disdolen EINECS 227-993-5 Fosfosal Fosfosal [INN] Fosfosalum [INN-Latin] NSC 46475 Phosphonoxybenzoic acid Salicyl phosphate Salicylic acid dihydrogen phosphate UR 1521 UR 1522 o-(Phosphonooxy)benzoic acid o-Carboxyphenyl phosphate
pdb file: 213426.pdb
sdf file: 213426.sdf
directory: 213426

114517-02-1 114517-04-3 Benzyl (+-)-5,8,13,14-tetrahydro-14-methyl-8,13-dioxobenz(5,6)isoindolo(2,1-b)isoquinolin-9-yl hydrogen phosphate Fosquidona [INN-Spanish] Fosquidone Fosquidone [USAN:BAN:INN] Fosquidonum [INN-Latin] GR 63178K Phosphoric acid, mono(phenylmethyl) mono(5,8,13,14-tetrahydro-14-methyl-8,13-dioxobenz(5,6)isoindolo(2,1-b)isoquinolin-9-yl) ester, (+-)-
pdb file: 213556.pdb
sdf file: 213556.sdf
directory: 213556

14842-81-0 39341-92-9 8000-90-6 8022-01-3 Aspara Asparkam Aspartic acid, L-, magnesium salt (2:1) tetrahydrate, mixture with potassium hydrogen L-aspartate hemihydrate L-Asparkam L-Aspartic acid, monopotassium salt, mixt. with dihydrogen (T-4)-bis(L-aspartato(2-)-N,O(sup 1)magnesate(2-) L-Aspartic acid, monopotassium salt, mixt. with dihydrogen (T-4)-bis(L-aspartato(2-)-N,O1)magnesate(2-) L-Aspartic acid, monopotassium salt, mixt. with dihydrogen (T-4)-bis(L-aspartato(2-)-kappaN,kappaO1)magnesate(2-) Magnesate(2-), bis(Laspartato(2-)-kappaN,kappaO1)-, (T-4)-, dihydrogen, mixt. contg. Magnesium potassium L-aspartate Potassium Aspartate and Magnesium Aspartate Potassium Aspartate and Magnesium Aspartate [USAN:JAN] Potassium magnesium aspartate Spartase Trophicard Wy 2837 Wy 2838
pdb file: 213607.pdb
sdf file: 213607.sdf
directory: 213607

3-Cyclohexene-1-carboxylic acid, 2-(dimethylamino)-1-phenyl-, ethyl ester, trans-(+-)-, (E)-2-butenedioate (1:1) 55567-81-2 EINECS 259-711-1 Tilidine fumarate trans-(1)-(2-(Ethoxycarbonyl)-2-phenylcyclohex-5-enyl)dimethylammonium hydrogen fumarate
pdb file: 213632.pdb
sdf file: 213632.sdf
directory: 213632

34144-82-6 Bis(1,2,2,6,6-pentamethyl-4-piperidyl) succinate sulfate (1:2) Bis(1,2,2,6,6-pentamethyl-4-piperidyl)succinate-bis(hydrogen sulfate) Butanedioic acid, bis(1,2,2,6,6-pentamethyl-4-piperidinyl) ester, sulfate (1:2) Succinic acid, bis(1,2,2,6,6-pentamethyl-4-piperidyl) ester, disulfate (7CI) Succinic acid, bis(1,2,2,6,6-pentamethyl-4-piperidyl) ester, sulfate (1:2) (8CI) Suxemerid sulfate Suxemerid sulfate [USAN] W 2180
pdb file: 213656.pdb
sdf file: 213656.sdf
directory: 213656

1,3-Naphthalenedisulfonic acid, 7-amino-, monopotassium salt 842-15-9 86-65-7 EINECS 212-669-8 Potassium hydrogen 7-aminonaphthalene-1,3-disulphonate
pdb file: 213838.pdb
sdf file: 213838.sdf
directory: 213838

144472-84-4 2-Butenedioic acid (2Z)-, monobutyl ester 2-Butenedioic acid (Z)-, monobutyl ester 45019-36-1 50821-55-1 925-21-3 Butyl hydrogen maleate EINECS 213-116-3 Maleic acid, monobutyl ester
pdb file: 213846.pdb
sdf file: 213846.sdf
directory: 213846

1115-63-5 26639-59-8 56-84-8 EINECS 214-226-4 L-Aspartic acid, monopotassium salt Potassium hydrogen aspartate
pdb file: 213870.pdb
sdf file: 213870.sdf
directory: 213870

(R-(R*,R*))-3-Pyridylmethyl hydrogen succinate, tetraester with N,N'-(dithiobis(ethyleneiminocarbonylethylene))bis(2,4-dihydroxy-3,3-dimethylbutyramide) 3-(3-Pyridinemethoxycarbonyl)propionic acid pantethine tetraester 5,30-Dioxa-17,18-dithia-10,14,21,25-tetraazatetratriacontanedioic acid, 8,27-bis(1,4-dioxo-4-(3-pyridinylmethoxy)butoxy)-4,9,13,22,26,31-hexaoxo-7,7,28,28-tetramethyl-, bis(3-pyridinylmethyl) ester, (R-(R*,R*))- 5,30-Dioxa-17,18-dithia-10,14,21,25-tetraazatetratriacontanedioic acid, 8,27-bis(1,4-dioxo-4-(3-pyridinylmethoxy)butoxy)-7,7,28,28-tetramethyl-4,9,13,22,26,31-hexaoxo-, bis(3-pyridinylmethyl) ester, (R-(R*,R*))- 96922-80-4 MG 28362 Pantenicate Pantenicate [INN] Pantenicato [Spanish] Pantenicatum [Latin]
pdb file: 214052.pdb
sdf file: 214052.sdf
directory: 214052

(Succinyloxy-1 ethyl)-2 methyl-3 (oxo-2 dihydro-2,5 furyl-4)-5 benzo(6)furanne [French] 2-(1-(Succinoyloxy)ethyl)-3-methyl-5-(2-oxo-2,5-dihydro-4-furyl)benzo(b)furan 2-(1-Hydroxyethyl)-beta-(hydroxymethyl)-3-methyl-5-benzofuranacrylic acid gamma-lactone hydrogen succinate 2-(1-Succinyloxyethyl)-3-methyl-5-(2-oxo-2,5-dihydro-4-furyl)benzo(b)furan 3447-95-8 7313-78-2 Benfurodil Hemisuccinate (+-) Benfurodil hemisuccinate Benfurodil hemisuccinate [DCF:INN] Benfurodil hemisuccinato [Spanish] Benfurodili hemisuccinas [INN-Latin] Benfurodili succinas Benzofurodil CB 4091 EINECS 222-367-8 Eucilat Hemisuccinate de benfurodil [INN-French] Hemisuccinato de benfurodil [INN-French] Succinic acid, monoester with 4-(2-(1-hydroxyethyl)-3-methyl-5-benzofuranyl)-2(5H)-furanone
pdb file: 214093.pdb
sdf file: 214093.sdf
directory: 214093

(3-Amino-1-hydroxypropylidene)diphosphonic acid disodium salt 3-Amino-1-hydroxypropane-1,1-diphosphonic acid disodium salt 40391-99-9 57248-88-1 APD Aminohydroxypropylidene diphosphonate disodium salt Aminomux Aredia CGP 23339 A CGP 23339A CGP 23339AE Disodium 3-amino-1-hydroxypropane-1,1-diphosphonate Disodium dihydrogen (3-amino-1-hydroxypropylidene)bisphosphonate Disodium pamidronate EINECS 260-647-1 Pamidronate disodium Pamidronic acid disodium salt Phosphonic acid, (3-amino-1-hydroxypropylidene)bis-, disodium salt
pdb file: 215605.pdb
sdf file: 215605.sdf
directory: 215605

(5)-Methyl L-hydrogen glutamate 1499-55-4 AI3-52387 EINECS 216-110-9 L-Glutamic acid, 5-methyl ester
pdb file: 216146.pdb
sdf file: 216146.sdf
directory: 216146

1501-27-5 4-(Methoxycarbonyl)butyric acid 4-Methoxycarbonylbutanoic acid EINECS 216-116-1 Glutaric acid methyl half ester Glutaric acid, monomethyl ester (8CI) Methyl glutarate (VAN) Methyl hydrogen glutarate Monomethyl glutarate NSC 93807 PENTANEDIOIC ACID, MONOMETHYL ESTER
pdb file: 216150.pdb
sdf file: 216150.sdf
directory: 216150

(Dimethylcyclohexyl) hydrogen phthalate 1,2-Benzenedicarboxylic acid, mono(dimethylcyclohexyl) ester 1322-94-7 EINECS 215-344-9 Phthalic acid, mono(dimethylcyclohexyl) ester
pdb file: 216221.pdb
sdf file: 216221.sdf
directory: 216221

1325-16-2 Barium(2+) hydrogen 2-((2-hydroxy-3,6-disulphonato-1-naphthyl)azo)benzoate Benzoic acid, 2-((2-hydroxy-3,6-disulfo-1-naphthalenyl)azo)-, barium salt (1:2) Benzoic acid, 2-[(2-hydroxy-3,6-disulfo-1-naphthalenyl)azo]-, barium salt (1:2) EINECS 215-388-9
pdb file: 216225.pdb
sdf file: 216225.sdf
directory: 216225

1804-93-9 AI3-16970 Dipropyl hydrogen phosphate EINECS 217-296-4 Phosphoric acid, dipropyl ester
pdb file: 216775.pdb
sdf file: 216775.sdf
directory: 216775

1,2-Ethanediol, mono(dihydrogen phosphate) 1892-26-8 2-Hydroxyethyl phosphate EINECS 217-575-0 Ethylene glycol, mono(dihydrogen phosphate) Ethylene glycol, monophosphated Phosphoric acid, beta-hydroxyethyl ester
pdb file: 216919.pdb
sdf file: 216919.sdf
directory: 216919

1,3-Benzenedicarboxylic acid, 5-nitro-, monomethyl ester 1955-46-0 5-Nitroisophthalic acid, monomethyl ester EINECS 217-793-6 Isophthalic acid, 5-nitro-, monomethyl ester Methyl 5-nitrohydrogen.isophthalate
pdb file: 217003.pdb
sdf file: 217003.sdf
directory: 217003

2104-19-0 AI3-08581 EINECS 218-275-2 Methyl hydrogen azelate Nonanedioic acid, monomethyl ester
pdb file: 217234.pdb
sdf file: 217234.sdf
directory: 217234

1-Hexadecanol, hydrogen phosphate 17026-47-0 2197-63-9 4-01-00-01880 (Beilstein Handbook Reference) BRN 1717117 Bis(hexadecyl) phosphate Di-n-hexadecyl phosphate Dicetyl hydrogen phosphate Dicetyl phosphate Dicetylphosphate Dicetylphosphoric acid Dihexadecyl hydrogen phosphate Dihexadecyl phosphate EINECS 218-594-7 NSC 12429 Phosphoric acid, dihexadecyl ester
pdb file: 217367.pdb
sdf file: 217367.sdf
directory: 217367

1,2-Benzenedicarboxylic acid, mono(2-(2-hydroxyethoxy)ethyl) ester 2-(2-Hydroxyethoxy)ethyl hydrogen phthalate 2202-98-4 AI3-00965 EINECS 218-610-2
pdb file: 217374.pdb
sdf file: 217374.sdf
directory: 217374

2253-44-3 30366-55-3 3549-51-7 36245-44-0 4-01-00-01537 (Beilstein Handbook Reference) 58952-81-1 6990-43-8 BRN 1100903 Butyl phosphorodithioate ((BuO)2(HS)PS) (6CI,7CI) Dibutyl dithiophosphate Dibutyl phosphorodithioate EINECS 218-848-7 O,O-Dibutyl dithiophosphate O,O-Dibutyl hydrogen dithiophosphate O,O-Dibutyl phosphorodithioate Phosphorodithioic acid, O,O-dibutyl ester
pdb file: 217482.pdb
sdf file: 217482.sdf
directory: 217482

2253-52-3 EINECS 218-849-2 O,O-Bis(2-methylpropyl) phosphorodithioate O,O-Diisobutyl hydrogen dithiophosphate Phosphorodithioic acid, O,O-bis(2-methylpropyl) ester
pdb file: 217483.pdb
sdf file: 217483.sdf
directory: 217483

130970-01-3 2253-57-8 EINECS 218-850-8 O,O-Dioctyl hydrogen dithiophosphate Phosphorodithioic acid, O,O-dioctyl ester
pdb file: 217484.pdb
sdf file: 217484.sdf
directory: 217484

1-Butanol, 3-methyl-, dihydrogen phosphate 2466-67-3 EINECS 219-575-6 Isoamyl acid phosphate Isopentyl dihydrogen phosphate Monoisoamyl acid phosphate
pdb file: 217794.pdb
sdf file: 217794.sdf
directory: 217794

2466-73-1 EINECS 219-576-1 Isobutyl dihydrogen phosphate Phosphoric acid, mono(2-methylpropyl) ester
pdb file: 217795.pdb
sdf file: 217795.sdf
directory: 217795

1,2-Benzenedicarboxylic acid, mono(phenylmethyl) ester 23239-68-1 2528-16-7 Benzyl hydrogen phthalate EINECS 219-771-1 Mono(phenylmethyl) 1,2-benzenedicarboxylate Mono-benzyl phthalate Mono-n-benzyl phthalate Monobenzyl phthalate NSC 402008 Phthalic acid, benzyl ester
pdb file: 217887.pdb
sdf file: 217887.sdf
directory: 217887

2627-35-2 Dihydrogen monolauryl phosphate Dodecyl dihydrogen phosphate EINECS 220-095-4 Lauryl dihydrogen phosphate Monododecyl phosphate Monolauryl phosphate NSC 41919 Phosphoric acid, monododecyl ester
pdb file: 218034.pdb
sdf file: 218034.sdf
directory: 218034

1-Naphthalenol, dihydrogen phosphate, monosodium salt 1-Naphthyl acid phosphate, monosodium sat 2650-44-4 EINECS 220-171-7 Sodium naphthyl hydrogen phosphate
pdb file: 218070.pdb
sdf file: 218070.sdf
directory: 218070

2-Aminoethanethiol hydrogen sulfate (ester) 2-Aminoethanethiolsulfuric acid 2-Aminoethanethiosulfuric acid 2-Aminoethanethiosulphonic acid 2-Aminoethylthiosulfuric acid 2-Mercaptoethylamine thiosulfate 27151-40-2 2937-53-3 4-04-00-01578 (Beilstein Handbook Reference) 54641-86-0 BRN 1758955 Cysteamine S-sulfate Cysteamine sulfonic acid Cysteamine, S-sulfo- Cysteaminesulfonic acid EINECS 220-917-1 Ethanethiol, 2-amino-, hydrogen sulfate Ethanethiol, 2-amino-, hydrogen sulfate (ester) Ethanethiol, 2-amino-, sulfate (6CI) Ethanol, 2-amino-, thiosulfate NSC 202840 S-(2-Aminoethyl) hydrogen thiosulfate S-(2-Aminoethyl) hydrogen thiosulphate S-beta-Aminoethylthiosulfuric acid Thiosulfuric acid (H2S2O3), S-(2-aminoethyl) ester Thiosulfuric acid, S-(2-aminoethyl) ester (8CI) USAF EK-8413 WR 361
pdb file: 218454.pdb
sdf file: 218454.sdf
directory: 218454

2958-09-0 Dihydrogen monooctadecyl phosphate EINECS 220-983-1 Monooctadecyl orthophosphate Monooctadecyl phosphate Monostearyl acid phosphate Monostearyl dihydrogen phosphate Monostearyl phosphate NSC 41920 Octadecyl dihydrogen phosphate Octadecyl phosphate Phosphoric acid, monooctadecyl ester Stearyl acid phosphate
pdb file: 218503.pdb
sdf file: 218503.sdf
directory: 218503

AIDS-122680 AIDS122680 D-Glycero-.alpha.-D-galacto-2-nonulopyranosidonic acid, 3-(docosyloxy)-2-[(docosyloxy)methyl]-2-methylpropyl 5-(acetylamino)-3,5-dideoxy-, 4,7,8,9-tetrakis(hydrogen sulfate) NMSO3
pdb file: 219068.pdb
sdf file: 219068.sdf
directory: 219068

1,2,4-Dithiazolidine-3-thione, 5-imino- 3H-1,2, 4-Dithiazole-3-thione, 5-amino- 5-Imino-1,2, 4-dithiazolidine-3-thione 5-Imino-1,2,4-dithiazolidine-3-thione 6846-35-1 AIDS-125210 AIDS125210 Isoperthiocyanic acid NSC65248 Xanthane hydride Xanthanohydrogen
pdb file: 221150.pdb
sdf file: 221150.sdf
directory: 221150

40283-99-6 AIDS-127774 AIDS127774 NSC187498 S-(2-((2-((4-Chlorophenyl)thio)ethyl)amino)-2-iminoethyl) hydrogen thiosulfate Thiosulfuric acid (H2S2O3), {S-[2-[[2-[(4-chlorophenyl)thio]ethyl]amino]-2-iminoethyl]} ester
pdb file: 223713.pdb
sdf file: 223713.sdf
directory: 223713

40283-90-7 AIDS-127779 AIDS127779 NSC187513 S-(2-Imino-2-((4-phenoxybutyl)amino)ethyl) hydrogen thiosulfate Thiosulfuric acid (H2S2O3), {S-[2-imino-2-[(4-phenoxybutyl)amino]ethyl]} ester
pdb file: 223718.pdb
sdf file: 223718.sdf
directory: 223718

40283-72-5 AIDS-127780 AIDS127780 NSC187514 S-(2-((1-Adamantylmethyl)amino)-2-iminoethyl) hydrogen thiosulfate Thiosulfuric acid (H2S2O3), {S-[2-imino-2-[(tricyclo[3.3.1.13,} 7\]dec-1-ylmethyl)amino\]ethyl\] ester
pdb file: 223719.pdb
sdf file: 223719.sdf
directory: 223719

63869-36-3 AIDS-127786 AIDS127786 NSC187526 S-(2-((3,4-Dimethylbenzyl)amino)-2-iminoethyl) hydrogen thiosulfate Thiosulfuric acid (H2S2O3), {S-[[[[(3,} 4-dimethylphenyl)methyl\]amino\]imino\]methyl\] ester
pdb file: 223725.pdb
sdf file: 223725.sdf
directory: 223725

40283-52-1 AIDS-127791 AIDS127791 NSC187533 S-(2-(Cyclopropylamino)-2-iminoethyl) hydrogen thiosulfate Thiosulfuric acid (H2S2O3), {S-[2-(cyclopropylamino)-2-iminoethyl]} ester
pdb file: 223730.pdb
sdf file: 223730.sdf
directory: 223730

40283-92-9 AIDS-127796 AIDS127796 NSC187541 S-(2-((3-(Benzyloxy)propyl)amino)-2-iminoethyl) hydrogen thiosulfate Thiosulfuric acid (H2S2O3), {S-[2-imino-2-[[3-(phenylmethoxy)propyl]amino]ethyl]} ester
pdb file: 223735.pdb
sdf file: 223735.sdf
directory: 223735

30771-86-9 AIDS-127830 AIDS127830 NSC193496 S-(2-((2-(1-Adamantyloxy)propyl)amino)-2-iminoethyl) hydrogen thiosulfate Thiosulfuric acid, S-ester with {N-[2-(1-adamantyloxy)propyl]-2-mercaptoacetamidine}
pdb file: 223769.pdb
sdf file: 223769.sdf
directory: 223769

40283-55-4 AIDS-127853 AIDS127853 NSC194277 S-(2-(Cyclohexylamino)-2-iminoethyl) hydrogen thiosulfate Thiosulfuric acid (H2S2O3), {S-[2-(cyclohexylamino)-2-iminoethyl]} ester
pdb file: 223792.pdb
sdf file: 223792.sdf
directory: 223792

40283-58-7 AIDS-127854 AIDS127854 NSC194279 S-(2-((3-Cyclohexylpropyl)amino)-2-iminoethyl) hydrogen thiosulfate Thiosulfuric acid (H2S2O3), {S-[2-[(3-cyclohexylpropyl)amino]-2-iminoethyl]} ester
pdb file: 223793.pdb
sdf file: 223793.sdf
directory: 223793

40283-59-8 AIDS-127855 AIDS127855 NSC194282 S-(2-((4-Cyclohexylbutyl)amino)-2-iminoethyl) hydrogen thiosulfate Thiosulfuric acid (H2S2O3), {S-[2-[(4-cyclohexylbutyl)amino]-2-iminoethyl]} ester
pdb file: 223794.pdb
sdf file: 223794.sdf
directory: 223794

40283-56-5 AIDS-127856 AIDS127856 NSC194285 S-(2-((Cyclohexylmethyl)amino)-2-iminoethyl) hydrogen thiosulfate Thiosulfuric acid (H2S2O3), {S-[2-[(cyclohexylmethyl)amino]-2-iminoethyl]} ester
pdb file: 223795.pdb
sdf file: 223795.sdf
directory: 223795

19142-99-5 AIDS-129459 AIDS129459 NSC348969 S-(2-((4-Cyclohexylbutyl)amino)ethyl) hydrogen thiosulfate Thiosulfuric acid (H2S2O3), {S-[2-[(4-cyclohexylbutyl)amino]ethyl]} ester
pdb file: 225408.pdb
sdf file: 225408.sdf
directory: 225408

AIDS-145183 AIDS145183 Methyl hydrogen 1-amino-2-(1H-indol-3-yl)ethylphosphonate NSC669635 Phosphonic acid, {[1-amino-2-(3-indolyl)ethyl]-,} methyl ester
pdb file: 241131.pdb
sdf file: 241131.sdf
directory: 241131

4891-15-0 Emcyt (free acid) Estra-1,3,5(10)-triene-3,17-diol (17.beta.)-, 3-[bis(2-chloroethyl)carbamate] 17-(dihydrogen phosphate) Estracyt Estradiol, 3-[bis(2-chloroethyl)carbamate] dihydrogen phosphate Estramustine phosphate Leo 299 NSC89199
pdb file: 375898.pdb
sdf file: 375898.sdf
directory: 375898

1501-27-5 Glutaric acid, monomethyl ester Methyl glutarate Methyl hydrogen glutarate Monomethyl glutarate NSC93807 Pentanedioic acid, monomethyl ester
pdb file: 378793.pdb
sdf file: 378793.sdf
directory: 378793

3',5'-AMP 60-92-4 Acrasin Adenosine 3',5'-cyclophosphate Adenosine 3',5'-monophosphate Adenosine 3',5'-phosphate Adenosine cyclic 3',5'-monophosphate Adenosine cyclic 3',5'-phosphate Adenosine cyclic monophosphate Adenosine, cyclic 3',5'-(hydrogen phosphate) Cyclic 3',5'-AMP Cyclic 3',5'-adenylic acid Cyclic AMP Cyclic adenosine 3',5'-monophosphate Cyclic adenosine 3',5'-phosphate NSC94017 cAMP
pdb file: 378953.pdb
sdf file: 378953.sdf
directory: 378953

598-02-7 Diethyl acid phosphate Diethyl hydrogen phosphate Diethyl phosphate Diethyl phosphoric acid Ethyl phosphate, (ETO)2(HO)PO NSC97178 Phosphoric acid, diethyl ester
pdb file: 401454.pdb
sdf file: 401454.sdf
directory: 401454

(-)-Nicotine hydrogen tartrate 65-31-6 NSC97238 Nicotine acid tartrate Nicotine bitartrate Nicotine hydrogen tartarate Nicotine hydrogen tartrate Nicotine tartrate Nicotine, tartrate (1:2) Pyridine, 3-(1-methyl-2-pyrrolidinyl)-, (S)-, [R-(R*,R*)]-2,3-dihydroxybutanedioate (1:2) Pyridine, 3-(1-methyl-2-pyrrolidinyl)-, (S)-, [R-(R,R)]-2,3-dihydroxybutanedioate (1:2) Tartrate de nicotine WLN: T6NJ C- BT5NTJ A1 &OVYQYQVO
pdb file: 401493.pdb
sdf file: 401493.sdf
directory: 401493

146-14-5 1H-Purin-6-amine, flavin dinucleotide 1H-Purin-6-amine, flavine dinucleotide Adenine-flavin dinucleotide Adenine-flavine dinucleotide Adenine-riboflavin dinuceotide Adenine-riboflavin dinucleotide Adenine-riboflavine dinucleotide Adenosine 5'-(trihydrogen pyrophosphate), 5'.fwdarw.5'-ester with riboflavine FAD Flamitajin B Flanin F Flavin adenine dinucleotide Flavin-adenine dinucleotide Flavine adenosine diphosphate Flavine-adenine dinucleotide Flavitan Flaziren (free acid) Isoalloxazine-adenine dinucleotide NSC112207 Riboflavin 5'-(trihydrogen diphosphate), 5'.fwdarw.5'-ester with adenosine Riboflavin 5'-adenosine diphosphate Riboflavin-adenine dinucleotide Riboflavine 5'-(trihydrogen diphosphate), 5'.fwdarw.5'-ester with adenosine Riboflavine-adenine dinucleotide
pdb file: 409914.pdb
sdf file: 409914.sdf
directory: 409914

5965-13-9 Codeine, dihydro-, tartrate (1:1) DF 118 DIHYDRO-CODEINE, TARTRATE Dihydrocodeine acid tartrate Dihydrocodeine bitartrate Hydrocodeine bitartrate Hydrocodeine hydrogen tartrate Morphinan-6-ol, 4,5-epoxy-3-methoxy-17-methyl-, (5.alpha.,6.alpha.)-, [R-(R*,R*)]-2,3-dihydroxybutanedioate (1:1) (salt) Morphinan-6.alpha.-ol, 4,5.alpha.-epoxy-3-methoxy-17-methyl-, tartrate (1:1) Morphinan-6.alpha.-ol, 4,5.alpha.-epoxy-3-methoxy-17-methyl-, tartrate (1:1) (salt) NSC117857 Paracodeine bitartrate Tuscodin WLN: T B6566 B6/CO 4ABBC R BX HO PN GHT&&TTJ FQ JO1 P1 &OVYQYQVO
pdb file: 413264.pdb
sdf file: 413264.sdf
directory: 413264

3',5'-Dibutyryl cyclic AMP 362-74-3 AMP N6-2'-O-dibutyrate Adenosine, N-(1-oxobutyl)-, cyclic 3',5'-(hydrogen phosphate) 2'-butanoate Butyramide, N-(9-.beta.-D-ribofuranosyl-9H-purin-6-yl)-, 2'-butyrate cyclic 3',5'-(hydrogen phosphate) Butyramide, N-(9-.beta.-D-ribofuranosyl-9H-purin-6-yl)-, cyclic 3',5'-(hydrogen phosphate) 2'-butyrate Cyclic AMP dibutyrate Cyclic dibutyryl AMP Dibutyryl 3',5'-cyclic AMP Dibutyryl 3',5'-cyclic adenosine monophosphate Dibutyryl adenosine 3',5'-cyclic phosphate Dibutyryl adenosine 3',5'-monophosphate Dibutyryl adenosine cyclic 3',5'-monophosphate Dibutyryl cyclic 3',5'-AMP Dibutyryl cyclic 3',5'-adenylic acid Dibutyryl cyclic AMP Dibutyryl cyclic adenosine 3',5'-monophosphate Dibutyryl cyclic adenosine monophosphate Dibutyryl-3',5'-AMP Dibutyryl-3',5'-adenosine monophosphate Dibutyryladenosine 3',5'-cyclic monophosphate Dibutyryladenosine cyclic monophosphate N6,2'-Dibutyryladenosine cyclic 3',5'-(hydrogen phosphate) N6,2'-O-Dibutyryl 3',5'-cyclic AMP N6,2'-O-Dibutyryl 3',5'-cyclic adenosine monophosphate N6,2'-O-Dibutyryl cyclic 3',5'-AMP N6,2'-O-Dibutyryl cyclic 3',5'-adenosine monophosphate N6,2'-O-Dibutyryl cyclic AMP N6,2'-O-Dibutyryladenosine 3',5'-monophosphate N6,2'-O-Dibutyryladenosine
pdb file: 427867.pdb
sdf file: 427867.sdf
directory: 427867

(-)-Noradrenaline (+)-bitartrate (-)-Noradrenaline acid tartrate (-)-Noradrenaline bitartrate (-)-Noradrenaline bitartrate monohydrate (-)-Noradrenaline hydrogen tartrate (-)-Noradrenaline tartrate (-)-Norepinephrine (+)-bitartrate (-)-Norepinephrine bitartrate (-)-Norepinephrine tartrate 1,2-Benzenediol, 4-(2-amino-1-hydroxyethyl)-, (R)-, [R-(R*,R*)]-2,3-dihydroxybutanedioate (1:1) (salt) 51-40-1 Arterenol bitartrate Benzyl alcohol, .alpha.-(aminomethyl)-3,4-dihydroxy-, (-)-, tartrate (1:1) Benzyl alcohol, .alpha.-(aminomethyl)-3,4-dihydroxy-, (-)-, tartrate (1:1) (salt) Levarterenol bitartrate Levophed bitartrate NSC169106 Noradrenaline acid tartrate Noradrenaline bitartrate Noradrenaline hydrogen tartrate Noradrenaline tartrate Noradrenaline, tartrate (1:1) Norartrinal bitartrate Norepinephrine bitartrate Norepinephrine tartrate WLN: Z1YQR CQ DQ &OVYQYQVO l-Arterenol bitartrate l-Noradrenaline bitartrate l-Noradrenaline d-bitartrate l-Noradrenaline tartrate l-Norepinephrine bitartrate
pdb file: 442082.pdb
sdf file: 442082.sdf
directory: 442082

1641-74-3 2-Diethylaminoethyl nicotinate citrate 3-Diethylaminoethoxycarbonylpyridine citrate 3-Pyridinecarboxylic acid, 2-(diethylamino)ethyl ester, 2-hydroxy-1,2,3-propanetricarboxylate (1:1) 53 IIC 53-11 C Eucast Euclidan Euclidan, citrate Manlate NSC169477 Nicametate citrate Nicametate dihydrogen citrate Nicotinic acid, 2-(diethylamino)ethyl ester, citrate (1:1) Provasan Soclidan
pdb file: 442256.pdb
sdf file: 442256.sdf
directory: 442256

298-06-6 Diethyl dithiophosphate Diethyl phosphorodithioate Diethyl phosphorodithioic acid Dithiophosphoric acid, O,O-diethyl ester Kyselina O,O-diethyldithiofosforecna NSC171184 O,O'-Diethyl dithiophosphate O,O'-Diethyl hydrogen dithiophosphate O,O-Diethyl dithiophosphate O,O-Diethyl dithiophosphoric acid O,O-Diethyl hydrogen phosphorodithioate O,O-Diethyl phosphorodithioate O,O-Diethyl phosphorodithioic acid O,O-Diethyl-S-hydrogen phosphorodithioate O,O-Diethyldithiophosphate O,O-Diethyldithiophosphoric acid O,O-Diethylphosphorodithioic acid Phosphonodithioic acid, O,O-diethyl ester Phosphorodithioic acid, O,O-diethyl ester WLN: SHPS & O2 & O2
pdb file: 443423.pdb
sdf file: 443423.sdf
directory: 443423

1-Methyl-D-lysergic acid butanolamide dimaleate 29605-96-7 Deseril-retard Desernil bismaleate Ergoline-8-carboxamide, 9,10-didehydro-N-[1-(hydroxymethyl)propyl]-1,6-dimethyl-, (8.beta.)-, (Z)-2-butenedioate (1:2) (salt) Ergoline-8.beta.-carboxamide, 9,10-didehydro-N-[1-(hydroxymethyl)propyl]-1,6-dimethyl-, maleate (1:2) (salt) Methysergide hydrogen bimaleate NSC186061
pdb file: 447723.pdb
sdf file: 447723.sdf
directory: 447723

10319-70-7 Acetamidine, 2-mercapto-, hydrogen sulfate (ester) Methanethiol, amidino-, hydrogen thiosulfate NSC187482 S-(Amidinomethyl) hydrogen thiosulfate Thiosulfuric acid (H2S2O3), S-(2-amino-2-iminoethyl) ester WLN: WSQS1YZUM
pdb file: 447937.pdb
sdf file: 447937.sdf
directory: 447937

.beta.-Exotoxin 23526-02-5 BACILLUS THURINGIENSIS B TOXIN D-Allaric acid, 2-O-.alpha.-D-glucopyranosyl-, 4-(dihydrogen phosphate), 4'.fwdarw.5'-anhydride with adenosine Exotoxin NSC197177
pdb file: 450422.pdb
sdf file: 450422.sdf
directory: 450422

2-Aminoethanethiol hydrogen sulfate (ester) 2-Aminoethanethiolsulfuric acid 2-Aminoethanethiosulfuric acid 2-Aminoethanethiosulphonic acid 2-Aminoethylthiosulfuric acid 2-Mercaptoethylamine thiosulfate 2937-53-3 Cysteamine S-sulfate Cysteamine, S-sulfo- Cysteaminesulfonic acid Ethanol, 2-amino-, thiosulfate NSC202840 S-(2-Aminoethyl) hydrogen thiosulfate S-.beta.-Aminoethylthiosulfuric acid Thiosulfuric acid (H2S2O3), S-(2-aminoethyl) ester Thiosulfuric acid, S-(2-aminoethyl) ester Usaf ek-8413 WLN: Z2OSS&O&O&O
pdb file: 451743.pdb
sdf file: 451743.sdf
directory: 451743

10584-64-2 16,17-Seco-24-nor-5.alpha.,13.alpha.,14.beta.,17.alpha.-chola-20,22-dien-16-oic acid, 14,15.beta.:21,23-diepoxy-17-hydroxy-4,4,8-trimethyl-3,7-dioxo-, .delta.-lactone D-Homo-24-nor-17-oxachola-20,22-diene-3,7,16-trione, 14,15:21,23-diepoxy-4,4,8-trimethyl-, (5.alpha.,13.alpha.,14.beta.,15.beta.,17a.alpha.)- KETODIHYDROGENDUNIN NSC309911
pdb file: 454863.pdb
sdf file: 454863.sdf
directory: 454863

7795-87-1 Decyl phosphate ((C10H21O)2(HO)PO) Didecyl hydrogen phosphate Didecyl phosphate Didecylorthophosphate NSC309954 Phosphoric acid, didecyl ester
pdb file: 454901.pdb
sdf file: 454901.sdf
directory: 454901

2-(1-Decylamino)ethanethiosulfuric acid 2-(Decylamino)ethanethiol hydrogen sulfate (ester) 2-(n-Decylamino)-ethanethiosulfuric acid 3752-51-0 Ethanethiol, 2-(decylamino)-, hydrogen sulfate (ester) NSC320931 Thiosulfuric acid (H2S2O3), S-[2-(decylamino)ethyl] ester Thiosulfuric acid(H2S2O3), S-[2-(decylamino)ethyl] ester Thiosulfuric acid, S-[2-(decylamino)ethyl] ester WLN: WSQS2M10 WR 1607 n-Decylaminoethanethiosulfuric acid
pdb file: 457197.pdb
sdf file: 457197.sdf
directory: 457197

1-Propanethiol, 3-[(3-aminopropyl)amino]-, dihydrogen phosphate (ester) 20709-39-1 NSC335661 Phosphorothioic acid, S-[3-[(3-aminopropyl)amino]propyl] ester Phosphorothioic acid, S-[3-[(3-aminopropyl)amino]propyl]- ester S-2-(3-Aminopropylamino)propyl phosphorothioic acid S-[3-[(3-Aminopropyl)amino]propyl] dihydrogen phosphorothioate
pdb file: 460152.pdb
sdf file: 460152.sdf
directory: 460152

23464-46-2 Ethanethiol, 2-[(4-phenylbutyl)amino]-, hydrogen sulfate (ester) Ethanethiol, 2-[(4-phenylbutyl)amino]-,hydrogen sulfate (ester) NSC339141 Thiosulfuric acid (H2S2O3), S-[2-[(4-phenylbutyl)amino]ethyl] ester
pdb file: 461032.pdb
sdf file: 461032.sdf
directory: 461032

25350-44-1 Ethanethiol, 2-[(3,7-dimethyloctyl)amino]-, hydrogen sulfate (ester) NSC339142 Thiosulfuric acid (H2S2O3), S-[2-[(3,7-dimethyloctyl)amino]ethyl] ester Thiosulfuric acid (H2S2O3), S-[2-[(3,7-dimethyloctyl)amino]ethyl]- ester
pdb file: 461033.pdb
sdf file: 461033.sdf
directory: 461033

2-[(2-Octyl)amino]ethanethiol hydrogen sulfate (ester) 927-30-0 Ethanethiol, 2-[(1-methylheptyl)amino]-, hydrogen sulfate (ester) Ethanethiol, 2-[(2-octyl)amino]-, hydrogen sulfate (ester) NSC339144 Thiosulfuric acid (H2S2O3), S-[2-[(1-methylheptyl)amino]ethyl] ester Thiosulfuric acid (H2S2O3), S-[2-[(1-methylheptyl)amino]ethyl]- ester WLN: WSQS2MY6&1
pdb file: 461035.pdb
sdf file: 461035.sdf
directory: 461035

330-13-2 4-Nitrophenyl dihydrogen phosphate NSC404086 Phenol, p-nitro-, dihydrogen phosphate Phosphoric acid, mono(4-nitrophenyl) ester Phosphoric acid, mono(p-nitrophenyl) ester p-Nitrophenyl dihydrogen phosphate
pdb file: 474322.pdb
sdf file: 474322.sdf
directory: 474322

4-Heptanol, 2,6-dimethyl-, hydrogen phosphate 7507-03-1 Bis(2,6-dimethyl-4-heptyl)phosphoric acid NSC407905 Phosphoric acid, bis(1-isobutyl-3-methylbutyl) ester Phosphoric acid, bis(2,6-dimethyl-4-heptyl) ester WLN: 1Y1&1Y1Y1&1&OPQO&OY1Y1&1&1Y1&1
pdb file: 477571.pdb
sdf file: 477571.sdf
directory: 477571

1-Undecanol, hydrogen phosphate 7598-64-3 Diundecyl phosphate NSC407915 Phosphoric acid, diundecyl ester Undecyl phosphate, di- WLN: 11OPQO&O11
pdb file: 477580.pdb
sdf file: 477580.sdf
directory: 477580

5'-Inosinic acid, 6-thio- 53-83-8 6-Mercaptopurine ribonucleotide 6-Mercaptopurine riboside 5'-monophosphate 6-Mercaptopurine riboside 5'-phosphate 6-Mercaptopurine riboside-5-phosphate 6-Mercaptopurine ribotide 6-Thio-IMP 6-Thioinosine 5'-monophosphate 6-Thioinosine 5'-phosphate 9H-Purine-6-thiol, 9-.beta.-D-ribofuranosyl-, 5'-(dihydrogen phosphate) NSC520722 Thio-IMP Thioinosinic acid
pdb file: 480856.pdb
sdf file: 480856.sdf
directory: 480856

2-Butenedioic acid (Z)-, monomethyl ester 2-Butenedioic acid, monomethyl ester 3052-50-4 Hydrogen methyl maleate Maleic acid, monomethyl ester Methyl hydrogen maleate Monomethyl maleate NSC525206
pdb file: 481963.pdb
sdf file: 481963.sdf
directory: 481963

2-Butenedioic acid (Z), monoethyl ester 2-Butenedioic acid (Z)-, monoethyl ester 3990-03-2 Ethyl hydrogen maleate Maleic acid, monoethyl ester Monoethyl maleate NSC525207
pdb file: 481964.pdb
sdf file: 481964.sdf
directory: 481964

21-Hydrocortisonephosphoric acid 3863-59-0 Corphos Cortisol 21-phosphate Cortisol phosphate Cortisol, 21-(dihydrogen phosphate) Cortisol, phosphate (salt) Hydrocortisone 21-(dihydrogen phosphate) Hydrocortisone 21-dihydrogen phosphate Hydrocortisone 21-phosphate Hydrocortisone phosphate NSC529660 Pregn-4-ene-3,20-dione, 11,17-dihydroxy-21-(phosphonooxy)-, (11.beta.)-
pdb file: 483004.pdb
sdf file: 483004.sdf
directory: 483004

NSC626201 Pentosan sulfate Xylan poyl(hydrogen sulfate, 6kD, with 1.8 sulfate gro ups per monomer and approx. 1/10 of xylopyranoses substituted by glucuronic acid
pdb file: 492848.pdb
sdf file: 492848.sdf
directory: 492848

14306-25-3 Inositol hexaphosphoric acid, dodecasodium salt NSC709486 Phytic acid, dodecasodium salt from corn myo-Inositol hexakis[dihydrogen phosphate] dodecasodium salt
pdb file: 530317.pdb
sdf file: 530317.sdf
directory: 530317

NSC710297 OMDPI Phosphoric acid, (2R)-2-methoxy-3-(octadecyloxy)propyl- (1R,2R,3S,4R,6R)-2,3,4,6-tetrahydroxycyclohexyl ester chiro-Inositol, 1-deoxy-, 5-[hydrogen [(3R)-3-methoxy-4-(octadecyloxy)butyl]phosphate]
pdb file: 530691.pdb
sdf file: 530691.sdf
directory: 530691

(ETHYLENEDINITRILO)TETRAACETIC ACID, DISODIUM SALT, DIHYDRATE (Ethylenedinitrilo)tetraacetic acid, disodium salt 139-33-3 Acetic acid, (ethylenedinitrilo)tetra-, disodium salt CBC 50152966 Cheladrate Chelaplex III Chelaton 3 Chelaton III Complexon III D'E.d.t.a. disodique DR-16133 Diso-Tate Disodium (ethylenedinitrilo)tetraacetate Disodium (ethylenedinitrilo)tetraacetic acid Disodium EDTA Disodium diacid ethylenediaminetetraacetate Disodium dihydrogen ethylenediaminetetraacetate Disodium dihydrogen ethylenediaminetetracetate Disodium dihydrogen(ethylenedinitrilo)tetraacetate Disodium edetate Disodium ethylenediamine-N,N,N',N'-tetraacetate Disodium ethylenediaminetetraacetate Disodium ethylenediaminetetraacetic acid Disodium salt of EDTA Disodium sequestrene Disodium tetracemate Disodium versenate Disodium versene EDTA EDTA disodium salt Edathamil calcium disodium Edathamil disodium Edetate Disodium Edetic acid disodium salt Edta disodium Edtacal Endrate Endrate disodium Ethylenediaminetetraacetate, disodium salt Ethylenediaminetetraacetic acid disodium salt Ethylenediaminetetraacetic acid,
pdb file: 538524.pdb
sdf file: 538524.sdf
directory: 538524

08-Union Carbide 1-Hexanol, 2-ethyl-, hydrogen sulfate, sodium salt 1-Hexanol, 2-ethyl-, sulfate, sodium salt 126-92-1 2-Ethyl-1-hexanol hydrogen sulfate sodium salt 2-Ethyl-1-hexanol sodium sulfate 2-Ethyl-1-hexanol sulfate sodium salt 2-Ethylhexyl sodium sulfate Emcol D 5-10 Ethasulfate sodium Hexanol, 2-ethyl-, hydrogen sulfate, sodium salt Mono(2-ethylhexyl) sulfate sodium salt NCI-C50204 NSC4744 Pentrone ON Propaste 6708 Sodium 2-ethylhexyl sulfate Sodium Ethasulfate Sodium etasulfate Sodium ethosulfate Sodium(2-ethylhexyl)alcohol sulfate Sole Tege TS-25 Sulfirol 8 Sulfuric acid, mono(2-ethylhexyl) ester, sodium salt Tergemist Tergimist Tergitol 08 Tergitol anionic 08 WLN: WSQO1Y4 & 2 &-NA- component of Tergemist
pdb file: 538888.pdb
sdf file: 538888.sdf
directory: 538888

54-64-8 Elcide 75 Elicide Estivin Ethylmercurithiosalicyclic acid, sodium salt Ethylmercurithiosalicylate sodium Ethylmercurithiosalicylate sodium salt Mercurate(1-), ethyl[2-mercaptobenzoato(2-)-O,S]-, sodium Mercurate(1-), ethyl[o-mercaptobenzoato(2-)]-, sodium Mercurothiolate Mercury, [(o-carboxyphenyl)thio]ethyl-, sodium salt Mercury, ethyl(2-mercaptobenzoato-S)-, sodium salt Mercury, ethyl(hydrogen o-mercaptobenzoato)-, sodium salt Merfamin Merphol Merseptyl Merthiolate Merthiolate salt Merthiolate sodium Mertorgan Merzonin Merzonin sodium Merzonin, sodium salt NSC4794 Nosemack SET Sodium 2-(ethylmercurithio)benzoate Sodium ethylmercuric thiosalicylate Sodium ethylmercurithiosalicylate Sodium merthiolate Sodium o-(ethylmercurithio)benzoate Sodium salt of 2-(carboxyphenyl)thioethylmercury Thimerosal Thimerosal solution Thimerosalate Thimerosol Thimerosol solution Thimersalate Thiomerosal Thiomersal Thiomersalat Thiomersalate WLN: QVR BS-HG-2 &-NA- [(o-Carboxyphenyl)thio]ethylmercury sodium salt o-(Ethylmercurithio)benzoic acid sodium salt
pdb file: 538897.pdb
sdf file: 538897.sdf
directory: 538897

138-15-8 2-Aminopentanedioic acid hydrochloride Achylin Acidalin Acidogen Acidoride Acidothyn Acidulen Acidulin Aciglumin Aclor Acridogen Acridoride Antalka Flanithin GLUTAMIC ACID, (L) Gastuloric Glusatin Glutamic acid hydrochloride Glutamic acid hydrogen chloride Glutamic acid, hydrochloride, L- Glutamidin Glutan H-C-L Glutan HCl Glutan Hydrochloric Glutan hydrochloride Glutasin Hydrionic Hypochylin L-Glutamic acid hydrochloride L-Glutamic acid monohydrochloride L-Glutamic acid, hydrochloride Muriamic NSC9239 Pepsdol Pepsidol
pdb file: 539597.pdb
sdf file: 539597.sdf
directory: 539597

4,4'-Stilbenediol, .alpha.,.alpha.'-diethyl-, bis(dihydrogen phosphate), disodium salt, (E)- 4,4'-Stilbenediol, .alpha.,.alpha.'-diethyl-, diphosphate, disodium salt 5965-09-3 Cytonal disodium salt Diethylstilbestrol 4,4'-diphosphoric ester, disodium salt Diethylstilbestrol diphosphoric acid ester disodium salt Knonvan NSC10481 Phenol, 4,4'-(1,2-diethyl-1,2-ethenediyl)bis-, bis(dihydrogen phosphate), disodium salt, (E)- SP-52-ASTA Stilphostrol Stilphostrol disodium salt
pdb file: 539823.pdb
sdf file: 539823.sdf
directory: 539823

21H,23H-Porphine, 2,18-dipropanoic acid deriv., ferrous complex Ferrate(2-), chloro[7,12-diacetyl-3,8,13,17-tetramethyl- 21H,23H-porphine-2,18-dipropanoato(4-)-N(21),N(22),N(23), N(24)]-, dihydrogen, (SP-5-13) NSC19664
pdb file: 541578.pdb
sdf file: 541578.sdf
directory: 541578

6217-68-1 NSC26566 Phenol, p-nitro-, hydrogen sulfate (ester), potassium salt Sulfuric acid, mono(4-nitrophenyl) ester, potassium salt
pdb file: 542733.pdb
sdf file: 542733.sdf
directory: 542733

(4-Carboxyphenyl)chloromercury 4-Carboxyphenylmercuric chloride 4-Chloromercuribenzoic acid 59-85-8 Benzoic acid, p-(chloromercuri) Mercurate(1-), (4-carboxylatophenyl)chloro-, hydrogen Mercury, (4-carboxyphenyl)chloro- Mercury, (p-carboxyphenyl)chloro- NSC32866 PCMB Usaf d-3 WLN: QVR D-HG-G p-(Chloromercuri)benzoic acid p-Carboxyphenylmercuric chloride p-Chlormercuribenzoic acid p-Chloromercuric benzoic acid p-Chloromercurybenzoic acid
pdb file: 543806.pdb
sdf file: 543806.sdf
directory: 543806

26403-12-3 Isooctanol, dihydrogen phosphate Isooctyl alcohol, dihydrogen phosphate NSC41917 Phosphoric acid, monoisooctyl ester
pdb file: 546155.pdb
sdf file: 546155.sdf
directory: 546155

7722-76-1 Ammonium biphosphate Ammonium diacid phosphate Ammonium dihydrogen orthophosphate Ammonium dihydrogen phosphate Ammonium dihydrogen phosphate ((NH4)H2PO4) Ammonium dihydrophosphate Ammonium monobasic phosphate Ammonium monobasic phosphate (NH4H2PO4) Ammonium phosphate Ammonium phosphate (NH4H2PO4) Ammonium phosphate, NH4H2PO4 Dihydrogen ammonium phosphate Monoammonium acid phosphate Monoammonium dihydrogen phosphate Monoammonium dihydrogen phosphate ((NH4)H2PO4) Monoammonium hydrogen phosphate Monoammonium orthophosphate Monoammonium phosphate Monobasic ammonium phosphate NSC57633 Phosphoric acid monoammonium salt Phosphoric acid, monoammonium salt Primary ammonium phosphate VTI 57
pdb file: 548381.pdb
sdf file: 548381.sdf
directory: 548381

7631-90-5 Bisulfite de sodium FR-62 Hydrogen sodium sulfate Hydrogen sulfite sodium Monosodium sulfite NSC60680 SODIUM BISULFITE Sodium acid sulfite Sodium bisulfite (1:1) Sodium bisulfite (NaHSO3) Sodium bisulfite, (solid) Sodium bisulfite, solid Sodium bisulphite Sodium hydrogen sulfite Sodium hydrogen sulfite, solid Sodium hydrosulfite Sodium metabisulfite Sodium sulfite (NaHSO3) Sodium sulfite, NaHSO3 Sodium sulhydrate Sulfurous acid, monosodium salt WLN: NA S-O2-Q
pdb file: 548732.pdb
sdf file: 548732.sdf
directory: 548732

7681-38-1 BIF Bisulfate of soda Fanal Monosodium hydrogen sulfate Monosodium sulfate NSC71192 Niter cake Nitre cake SODIUM HYDROGEN SULFATE, SOLID Sodium acid sulfate Sodium bisulfate Sodium bisulfate, fused Sodium bisulfate, solid Sodium hydrogen sulfate Sodium hydrogen sulfate (NaHSO4) Sodium hydrosulfate Sodium pyrosulfate Sodium sulfate, NaHSO4 Sulfuric acid monosodium salt Sulfuric acid, monosodium salt WC-00 WC-Klosettreiniger WC-Perfect WC-Super
pdb file: 550114.pdb
sdf file: 550114.sdf
directory: 550114

63903-51-5 NSC72166 PHYTIC ACID myo-Inositol, hexakis(dihydrogen phosphate), hexazinc salt
pdb file: 550283.pdb
sdf file: 550283.sdf
directory: 550283

7635-45-2 NSC78064 Phosphoric-32P acid, monosodium salt Sodium dihydrogen phosphate(32P) Sodium orthophosphate-32P Sodium phosphate, NaH2(32)PO4 Sodium phosphate-P32
pdb file: 551128.pdb
sdf file: 551128.sdf
directory: 551128

3724-89-8 Cistaphos Cystafos Cystaphos Cystaphos sodium salt Ethanethiol, 2-amino-, dihydrogen phosphate (ester), monosodium salt Ethanethiol, 2-amino-, dihydrogen phosphate, monosodium salt Monosodium .beta.-aminoethyl thiophosphate NSC87174 Phosphorothioic acid, S-(2-aminoethyl) ester, monosodium salt S-(2-Aminoethyl) thiophosphate monosodium salt S-(2-Aminoethyl)thiophosphate monosodium salt Sodium .beta.-aminoethyl thiophosphate Sodium hydrogen S-(2-aminoethyl) phosphorothioic acid Sodium hydrogen S-(2-aminoethyl)phosphorothioate Sodium hydrogen S-(2-aminoethyl)phosphorothioic acid Tsistafos Tsistafos (cystafos) WLN: Z2SPQO&O &-NA- WR 638
pdb file: 552231.pdb
sdf file: 552231.sdf
directory: 552231

.beta.-Sitosterol carboxymethylthiosuccinate NSC110372 Pfizer Sitosterol Stigmast-5-en-3-ol, hydrogen 2(or 3)-[(carboxymethyl)thio]butanedioate, (3.beta.)- Succinic acid, [(carboxymethyl)thio]-, 1-stigmast-5-en-3.beta.-yl ester Succinic acid, [(carboxymethyl)thio]-, 4-stigmast-5-en-3.beta.-yl ester or
pdb file: 554759.pdb
sdf file: 554759.sdf
directory: 554759

1,2,3-Propanetricarboxylic acid, 2-hydroxy-, iron(3+) salt (1:1) 3522-50-7 Citric acid, iron(3+) salt (1:1) Ferric citrate Iron citrate, FeC6H5O7 Iron(III) citrate Iron, [hydrogen citrato(3-)]- NSC112227
pdb file: 554967.pdb
sdf file: 554967.sdf
directory: 554967

127-50-4 Cyclopentanecarboxylic acid, 3-[[[3-(hydroxymercurio)-2-methoxypropyl]amino]carbonyl]-1,2,2-trimethyl- Mercurate(1-), [3-[[(3-carboxylato-2,2,3-trimethylcyclopentyl)carbonyl]amino]-2-methoxypropyl]hydroxy-, hydrogen Mercurin Mercury, [3-(3-carboxy-2,2,3-trimethylcyclopentanecarboxamido)-2-methoxypropyl]hydroxy- Mercury, [3-[[(3-carboxy-2,2,3-trimethylcyclopentyl)carbonyl]amino]-2-methoxypropyl]hydroxy- N-(.gamma.-Hydroxymercuri-.beta.-methoxy)propylcamphoramic acid NSC115879
pdb file: 555452.pdb
sdf file: 555452.sdf
directory: 555452

6217-68-1 NSC121598 Phenol, p-nitro-, hydrogen sulfate (ester), potassium salt Sulfuric acid, mono(4-nitrophenyl) ester, potassium salt
pdb file: 556481.pdb
sdf file: 556481.sdf
directory: 556481

576-42-1 D-Glucaric acid, monopotassium salt Glucaric acid, potassium salt, D- NSC130975 Potassium acid saccharate Potassium bisaccharate Potassium hydrogen saccharate
pdb file: 557747.pdb
sdf file: 557747.sdf
directory: 557747

144-55-8 Acidosan Baking soda Bicarbonate of soda Carbonic acid, monosodium salt Jusonin Meylon Monosodium carbonate Monosodium hydrogen carbonate NSC134031 Neut Soda Soda Mint Sodium acid carbonate Sodium bicarbonate Sodium bicarbonate (Na(HCO3)) Sodium bicarbonate(1:1) Sodium carbonate (NaHCO3) Sodium hydrogen carbonate Soludal WLN: QVQ &-NA- component of Col-Evac component of Pretts
pdb file: 558222.pdb
sdf file: 558222.sdf
directory: 558222

.alpha.-Monosodium glutamate 142-47-2 Accent Ajinomoto Chinese seasoning Glutacyl Glutamic acid, monosodium salt Glutamic acid, monosodium salt, L- Glutamic acid, monosodium salt, L-(+)- Glutamic acid, sodium salt Glutammato monosodico Glutavene L-(+)-Sodium glutamate L-Glutamic acid, monosodium salt L-Glutamic acid, sodium salt MSG Monosodioglutammato Monosodium L-glutamate Monosodium glutamate NSC135529 Natriumglutaminat RL 50 Sodium L-glutamate Sodium glutamate Sodium hydrogen glutamate Vetsin WLN: QVYZ2VO &-NA--R Zest
pdb file: 558362.pdb
sdf file: 558362.sdf
directory: 558362

1-Tetradecanol, hydrogen sulfate sodium salt 1-Tetradecanol, hydrogen sulfate, sodium salt 1191-50-0 Monotetradecylsulfate sodium salt Myristyl sulfate, sodium salt NSC139032 S.T.D. Sodium myristyl sulfate Sodium tetradecyl sulfate Sodium tetradecylsulfate Sulfuric acid, monotetradecyl ester, sodium salt Sulfuric acid, myristyl ester, sodium salt Tetradecyl sodium sulfate Tetradecyl sulfate, sodium salt Texapon K 14 WLN: WSQO14 &-NA-
pdb file: 558747.pdb
sdf file: 558747.sdf
directory: 558747

868-14-4 Acidpotassium tartrate Butanedioic acid, 2,3-dihydroxy- [R-(R*,R*)]-, monopotassium salt Cream of tartar Cremor tartari Faccla Faccula Faecla Faecula Monopotassium tartrate NSC155080 Potassium acid tartrate Potassium bitartrate Potassium hydrogen tartrate Potassium tartrate (KHC4H4O6) Tartar Tartar cream Tartaric acid, monopotassium salt component of Col-Evac
pdb file: 561000.pdb
sdf file: 561000.sdf
directory: 561000

14494-69-0 Bis(8-hydroxyquinoline-5-sulfonic acid) zinc(II) NSC166687 Zinc(II), bis(5-sulfo-8-quinolinolato-N(sup 1),O(sup 8))- Zinc, bis(5-sulfo-8-quinolinolato)- Zincate(2-), bis[8-hydroxy-5-quinolinesulfonato(2-)-N1,O8]-, dihydrogen, (T-4)-
pdb file: 562330.pdb
sdf file: 562330.sdf
directory: 562330

CORALYNE,-10-METHOXY, SULFOACETATE Dibenzo[a,g]quinolizinium, 2,3,11-trimethoxy-8-methyl-, hydrogen sulfate anhydride with acetic acid NSC168212
pdb file: 562584.pdb
sdf file: 562584.sdf
directory: 562584

13514-27-7 Methanethiol, N-[3-(3-indolyl)propyl]amidino-, hydrogen thiosulfate NSC187499 S-[[N-[3-(3-Indolyl)propyl]amidino]methyl] hydrogen thiosulfate Thiosulfuric acid (H2S2O3), S-[2-imino-2-[[3-(1H-indol-3-yl)propyl]amino]ethyl] ester Thiosulfuric acid, S-ester with N-(3-indol-3-ylpropyl)-2-mercaptoacetamidine WLN: T56 BMJ D3MYUM&1SSWQ
pdb file: 564846.pdb
sdf file: 564846.sdf
directory: 564846

17126-47-5 Ferrate(4-), hexacyano-, tetrahydrogen Ferrate(4-), hexakis(cyano-C)-, tetrahydrogen, (OC-6-11)- Ferrocyanhydric acid Ferrocyanic acid Hydroferrocyanic acid NSC187672 Tetrahydrogen hexacyanoferrate
pdb file: 564938.pdb
sdf file: 564938.sdf
directory: 564938

67071-43-6 Mercurate(1-), hydroxy(2-methyl-5-sulfophenyl)-, hydrogen NSC203302 o-Hydroxymercury toluene-p-sulfonic acid
pdb file: 565729.pdb
sdf file: 565729.sdf
directory: 565729

14284-06-1 Acetoacetic acid, ethyl ester, copper complex Bis(ethoxycarbonylacetonato)copper Bis(ethyl acetoacetato)copper Bis(ethyl acetylacetate)copper(II) Bis(ethyl acetylacetato)copper Copper bis(ethyl acetylacetonate) Copper, bis(1-ethoxy-1,3-butanedionato)- Copper, bis(ethyl 3-oxobutanoato-O1',O3)- Copper, bis(ethyl acetoacetato)- Copper, bis(hydrogen acetoacetato)-, diethyl ester Copper, tetrakis(hydrogen acetoacetato)di-, tetraethyl ester Copperbis(ethyl acetoacetate) NSC244773
pdb file: 568477.pdb
sdf file: 568477.sdf
directory: 568477

1,2-Cyclohexanediamine, platinum complex 73588-77-9 L-Aspartic acid, N-(phosphonoacetyl)-, platinum complex NSC314926 Platinate(2-), (1,2-cyclohexanediamine-N,N')(N-phosphonoacetyl)-L-aspartato(4-)-O1,O4)-, sodium hydrogen Platinate(2-), (1,2-cyclohexanediamine-N,N')[N-(phosphonoacetyl)-L-aspartato(4-)-O1,O4]-, sodium hydrogen, (SP-4-3)-
pdb file: 573941.pdb
sdf file: 573941.sdf
directory: 573941

56047-87-1 Benzenesulfonic acid, 4,4',4'',4'''-(21H,23H-porphine- 5,10,15,20-tetrayl)tetrakis-, zinc complex NSC315551 Zincate(4-), [[4,4',4'',4'''-(21H,23H-porphine- 5,10,15,20-tetrayl)tetrakis[benzenesufonato]](6-)- N21,N22,N23,N24]-, tetrahydrogen, (SP-4-1)-
pdb file: 573977.pdb
sdf file: 573977.sdf
directory: 573977

2-Propanol, 1-amino-3-(phosphonothio)-, monosodium salt 28402-17-7 NSC318809 Phosphororothioic acid, S-(3-amino-2-hydroxypropyl) ester, monosodium salt S-3-Amino-2-hydroxypropyl sodium hydrogen phosphorothioate
pdb file: 574102.pdb
sdf file: 574102.sdf
directory: 574102

6408-31-7 Bucolan Red GRE C.I. 18800 C.I. Acid Red 183 Chromate(5-), bis[5-chloro-3-[[4,5-dihydro-3-methyl-5-oxo-1-(3-sulfophenyl)-1H-pyrazol-4-yl]azo]-2-hydroxybenzenesulfonato(4-)]-, tetrasodium hydrogen Chrome Intra Red GRE Chromolan Red GRE Efdolan Red GRN Gycolan Red GRL Inochrome Red 3J NSC324571 Neolan Red GRE Nyasol Red GGS Palatine Fast Red GREN Pilate Fast Red GREN Super Fast Red GRE Tertroxane Red G Vitrolan Red GRE
pdb file: 574441.pdb
sdf file: 574441.sdf
directory: 574441

10127-05-6 Bucolan Yellow 6G Bucolan Yellow EL C.I. 19010 C.I. Acid Yellow 54 Calcofast Leather Yellow N Calcofast Wool Pink N Calcofast Wool Yellow N Chromacyl Yellow N Chromate(5-), bis[2-[[4,5-dihydro-3-methyl-1-(2-methyl-4-sulfophenyl)-5-oxo-1H-pyrazol-4-yl]azo]-4-sulfobenzoato(4-)]-, tetrasodium hydrogen Chrome Intra Yellow EL Chromolan Yellow ELN Chromolan Yellow N Fenapal Yellow EL Glycolan Yellow BEL Inochrome Yellow JLN NSC326203 Neolan Yellow BE Nyasol Fast Yellow GLN Palatine Fast Yellow ELN Palatine Yellow ELNA-CF Pharmalan Yellow EL Pilate Fast Yellow ELN Stenamina Yellow B Super Fast Yellow ELNA Ultralan Yellow G Vitrolan Yellow BE Yamada Neo Fast Yellow EL
pdb file: 574543.pdb
sdf file: 574543.sdf
directory: 574543

Acid Orange 74 Chromate(3-), bis[3-[(4,5-dihydro-3-methyl-5-oxo-1-phenyl-1H-pyrazol-4-yl)azo]-2-hydroxy-5-nitrobenzenesulfonato(3-)]-, disodium hydrogen NSC326205
pdb file: 574545.pdb
sdf file: 574545.sdf
directory: 574545

Bucolan Yellow 6G Bucolan Yellow EL C.I. 19010 C.I. Acid Yellow 54 Calcofast Leather Yellow N Calcofast Wool Pink N Calcofast Wool Yellow N Chromacyl Yellow N Chromate(5-), bis[2-[[4,5-dihydro-3-methyl-1-(2-methyl-4-sulfophenyl)-5-oxo-1H-pyrazol-4-yl]azo]-4-sulfobenzoato(4-)]-, tetrasodium hydrogen Chrome Intra Yellow EL Chromolan Yellow ELN Chromolan Yellow N Fenapal Yellow EL Glycolan Yellow BEL Inochrome Yellow JLN NSC326635 Neolan Yellow BE Nyasol Fast Yellow GLN Palatine Fast Yellow ELN Palatine Yellow ELNA-CF Pharmalan Yellow EL Pilate Fast Yellow ELN Stenamina Yellow B Super Fast Yellow ELNA Ultralan Yellow G Vitrolan Yellow BE Yamada Neo Fast Yellow EL
pdb file: 574571.pdb
sdf file: 574571.sdf
directory: 574571

1,2-Cyclohexanediamine, platinum complex 80205-24-9 L-Aspartic acid, N-(phosphonoacetyl)-, platinum complex NSC328005 Platinate(2-), (1,2-cyclohexanediamine-N,N')(N-(phosphonoacetyl)-L-aspartato(4-)-O1,O4)-, dihydrogen, (SP-4-3)- Platinate(2-), (1,2-cyclohexanediamine-N,N')[N-(phosphonoacetyl)-L-aspartato(4-)-O(1),O(4)]-, dihydrogen Platinate(2-), (1,2-cyclohexanediamine-N,N')[N-(phosphonoacetyl)-L-aspartato(4-)-O1,O4]-, dihydrogen, (SP-4-3)-
pdb file: 574648.pdb
sdf file: 574648.sdf
directory: 574648

63903-50-4 NSC402433 PHYTIC ACID myo-Inositol, hexakis(dihydrogen phosphate), copper(2+) salt (1:6)
pdb file: 578683.pdb
sdf file: 578683.sdf
directory: 578683

20859-38-5 Ammonium hydrogen fluoride phosphate NSC404121 Phosphorofluoridic acid, monoammonium salt
pdb file: 579033.pdb
sdf file: 579033.sdf
directory: 579033

7646-93-7 Acid potassium sulfate Monopotassium hydrogen sulfate Monopotassium sulfate NSC409996 Potassium acid sulfate Potassium bisulfate Potassium hydrogen sulfate Potassium hydrogen sulfate, solid Potassium hydrosulfate (KHSO4) Potassium sulfate Potassium sulfate (KHSO4) Potassium sulfate, KHSO4 Sal enixum Sulfuric acid monopotassium salt Sulfuric acid potassium salt (1:1) Sulfuric acid, monopotassium salt
pdb file: 579580.pdb
sdf file: 579580.sdf
directory: 579580

.beta.-Heparin 24967-94-0 AIDS-000305 AIDS000305 Chondroitin sulfate B Chondroitin sulfate type B Chondroitinsulfuric acid B Chondroitinsulfuric acid type B Chondroitinsulfuric acid, type B Chondroitinsulfuric acids, type B DS 435 Dermatan 4-sulfate Dermatan hydrogen sulfate Dermatan sulfate Dermatan sulfate (supersulfated) Desmin 370 MF 701 MF 701 (polysaccharide)
pdb file: 594986.pdb
sdf file: 594986.sdf
directory: 594986

9007-28-7 AIDS-000480 AIDS000480 Ch polysulfate Chondroitin polysulfate Chondroitin sulfate Chondroitin, hydrogen sulfate Chondroitinsulfuric acid Chondroitinsulfuric acids Chonsurid
pdb file: 595123.pdb
sdf file: 595123.sdf
directory: 595123

3'-Azido-2',3'-dideoxythymidine-5'-triphosphate & Phosphonoformate (*Sodium salt*) 92586-35-1 AIDS-000786 AIDS000786 AZTTP & Foscarnet AZTTP & PFA Thymidine 5'-(tetrahydrogen triphosphate), 3'-azido-3'-deoxy- & Acetic acid, phosphono-
pdb file: 595383.pdb
sdf file: 595383.sdf
directory: 595383

2-Butenedioic acid (Z)-, titanium complex 83525-76-2 AIDS-001311 AIDS001311 Bis(hydrogen maleinate)-bis(.eta.^5-2,4-cyclopentadiene-1-yl)titanium Titanate(2-), bis[2-butenedioato(2-)-O]bis(.eta.^5-2,4-cyclopentadien-1-yl)-, dihydrogen, stereoisomer Titanocene bis(H maleinate)
pdb file: 595855.pdb
sdf file: 595855.sdf
directory: 595855

129572-46-9 AIDS-001676 AIDS001676 Molybdate(3-), tetracosa-m-oxododecaoxo[m12-[phosphato(3-)-kO:kO:kO:kO':kO':kO':kO'':kO'':kO'':kO''':kO''':kO''']]dodeca-, trihydrogen, compd. with N,N-dimethylacetamide Phosphoric acid, molybdenum complex [(DMA)2 H]3 P Mo12 O40 Polyoxometalate [(DMA)2H]3PMo12O40 [(N,N-Dimethylacetamide)2 H]3 P Mo12 O40, A Keggin type polyoxometalate
pdb file: 596180.pdb
sdf file: 596180.sdf
directory: 596180

(Ethylenedinitrilo)tetraacetic acid, disodium salt 139-33-3 (DISODIUM SALT) 150-38-9 (TRISODIUM SALT) 60-00-4 6381-92-6 (DISODIUM SALT) AIDS-002613 AIDS002613 Acetic acid, (ethylenedinitrilo)tetra-, disodium salt CBC 50152966 Cheladrate Chelaplex III Chelaton 3 Chelaton III Complexon III D'E.d.t.a. Disodique DR-16133 Diso-Tate Disodium (ethylenedinitrilo)tetraacetate Disodium (ethylenedinitrilo)tetraacetic acid Disodium diacid ethylenediaminetetraacetate Disodium dihydrogen ethylenediaminetetraacetate Disodium dihydrogen(ethylenedinitrilo)tetraacetate Disodium edetate Disodium ethylenediamine-N,N,N',N'-tetraacetate Disodium ethylenediaminetetraacetate Disodium ethylenediaminetetraacetic acid Disodium salt of EDTA Disodium sequestrene Disodium tetracemate Disodium versenate Disodium versene EDTA EDTA disodium salt Edathamil calcium disodium Edathamil disodium Edetate Disodium Edetic acid disodium salt Edta disodium Edtacal Endrate Endrate disodium Ethylenediaminetetraacetate, disodium salt Ethylenediaminetetraacetic acid disodium salt Ethylenediaminetetraacetic
pdb file: 597086.pdb
sdf file: 597086.sdf
directory: 597086

136088-27-2 AIDS-003064 AIDS003064 Cholestane, deoxyribonucleic acid deriv. Cholesteryl oligonucleotide Cholesteryl oligonucleotide(pTGGCGTACTCACCAGTCGCCGC) DNA, d(T-G-G-C-G-T-A-C-T-C-A-C-C-A-G-T-C-G-C-C-G-C), 5'-[(3.bETA.)-cholest-5-en-3-yl hydrogen phosphate]
pdb file: 597523.pdb
sdf file: 597523.sdf
directory: 597523

1-[5'-[[(S)-2-Aminopropyl]amino]-5'-deoxy-.beta. -D-allofuranosyluronic acid]uracil Hydrogen Acetate 93806-84-9 AIDS-008577 AIDS008577 Aminoalkyl UPOC analog
pdb file: 603349.pdb
sdf file: 603349.sdf
directory: 603349

21H,23H-Porphine, 2,18-dipropanoic acid deriv., ferrous complex AIDS-030509 AIDS030509 Ferrate(2-), chloro[7,12-diacetyl-3,8,13,17-tetramethyl- 21H,23H-porphine-2,18-dipropanoato(4-)-N(21),N(22),N(23), N(24)]-,dihydrogen, (SP-5-13) NSC19664
pdb file: 613275.pdb
sdf file: 613275.sdf
directory: 613275

125516-10-1(MONOSODIUM SALT) AIDS-096975 AIDS096975 Repandusinic acid A beta-D-Glucopyranose, cyclic-3,6-(4,4',5,5',6,6'-hexahydroxy(1,1'-biphenyl)-2,2'-dicarboxylate) 4-(4-hydrogen-2-(3-carboxy-3,4-dihydro-5,6,7-trihydroxy-1-oxo-1H-2-benzopyran-4-yl)-2-butenedioate)-1-(3,4,5-trihydroxybenzoate)
pdb file: 639842.pdb
sdf file: 639842.sdf
directory: 639842

(3R,5aS,6R,8aS,9R,10S,12R,12aR)-Decahydro-3,6,9-trimethyl-3,12-epoxy-12H-pyrano(4,3-j)-1,2-benzodioxepin-10-ol, hydrogen succinate 88495-63-0 AIDS-112081 AIDS112081 Artesunate Artesunic acid
pdb file: 648772.pdb
sdf file: 648772.sdf
directory: 648772

143476-57-7 3037-89-6 Dioctadecyl hydrogen phosphate Dioctadecyl orthophosphate Dioctadecyl phosphate Distearyl acid phosphate Distearyl phosphate EINECS 221-237-8 NSC 2681 Phosphated stearyl alcohol Phosphoric acid, dioctadecyl ester
pdb file: 653503.pdb
sdf file: 653503.sdf
directory: 653503

2-Butenedioic acid (2Z)-, monomethyl ester 2-Butenedioic acid (Z)-, monomethyl ester (9CI) 2-Butenedioic acid, monomethyl ester 3052-50-4 EINECS 221-271-3 Hydrogen methyl maleate Maleic acid, monomethyl ester Methyl hydrogen maleate Monomethyl (Z)-2-butenedioate Monomethyl maleate NSC 11205 NSC 525206
pdb file: 653524.pdb
sdf file: 653524.sdf
directory: 653524

1560-42-5 19045-78-4 3115-39-7 AI3-15045 Di(octyl) hydrogen phosphate Dioctyl hydrogen phosphate Dioctyl phosphate Dioctylorthophosphate EINECS 221-485-7 NSC 70167 Octyl phosphate, (C8H17O)2(HO)PO Phosphoric acid, dioctyl ester
pdb file: 653630.pdb
sdf file: 653630.sdf
directory: 653630

3138-42-9 AI3-16972 Diamyl acid phosphate Dipentyl hydrogen phosphate EINECS 221-537-9 Phosphoric acid, dipentyl ester Phosphoric acid, diphenyl ester
pdb file: 653656.pdb
sdf file: 653656.sdf
directory: 653656

3279-54-7 701-64-4 Disodium phenyl phosphate Disodium phenylphosphate EINECS 221-917-4 NSC 7190 Phenyl dihydrogen phosphate, disodium salt Phenyl disodium orthophosphate Phenyl sodium phosphate, (PhO)(NaO)2PO Phenyldisodium phosphate Phosphoric acid, monophenyl ester, disodium salt Sodium phenyl phosphate, (PhO)(NaO)2PO
pdb file: 653838.pdb
sdf file: 653838.sdf
directory: 653838

3536-49-0 50934-74-2 Acid blue 3 Acidal Carmine V Alphazurine 2 G (C.I. 42051) Bis(hydrogen (4-(4-(diethylamino)-5'-hydroxy-2',4'-disulphonatobenzhydrylidene)cyclohexa-2,5-dien-1-ylidene)diethylammonium), calcium salt Bleu patente V [French] Blue ZN 3 C.I. 42051 C.I. 712 C.I. Acid Blue 3 C.I. Acid Blue 3, calcium salt (2:1) (8CI) C.I. Food Blue 5 CI 42051 Carmine Blue V Dai-ei Acid Pure Blue VX E 131 EINECS 222-573-8 Ethanaminium, N-(4-((4-(diethylamino)phenyl)(5-hydroxy-2,4-disulfophenyl)methyl- ene)-2,5-cyclohexadien-1-ylidene)-N-ethyl-, hydroxide, inner salt, calcium salt (2:1) Ethanaminium, N-(4-((4-(diethylamino)phenyl)(5-hydroxy-2,4-disulfophenyl)methylene)-2,5-cyclohexadien-1-ylidene)-N-ethyl-, hydroxide, inner salt, calcium salt (2:1) Ethanaminium, N-(4-((4-(diethylamino)phenyl)(5-hydroxy-2,4-disulfophenyl)methylene)-2,5-cyclohexadien-1-ylidene)-N-ethyl-, inner salt, calcium salt (2:1) Food Blue 3 L-Blau 3 [German] Merantine Blue V Mitsui Acid Pure Blue VX N-(4-((4-(Diethylamino)phenyl)(5-hydroxy-2,4-disulfophenyl)methyl- ene)-2,5-cyclohexadien-1-ylidene)-N-ethylethanaminium, hydroxide,
pdb file: 654134.pdb
sdf file: 654134.sdf
directory: 654134

2-(1-Decylamino)ethanethiosulfuric acid 2-(n-Decylamino)-ethanethiosulfuric acid 2-Decylaminoethanethiol hydrogen sulfate (ester) 3752-51-0 BRN 2370356 Ethanethiol, 2-(decylamino)-, hydrogen sulfate (ester) Ethanethiol, 2-decylamino-, hydrogen sulfate (ester) NSC 320931 Thiosulfuric acid (H2S2O3), S-(2-(decylamino)ethyl) ester (9CI) Thiosulfuric acid(H2S2O3), S-(2-(decylamino)ethyl) ester (9CI) Thiosulfuric acid, S-(2-(decylamino)ethyl) ester (8CI) WR 1607 n-Decylaminoethanethiosulfuric acid
pdb file: 654413.pdb
sdf file: 654413.sdf
directory: 654413

3-Carbomethoxypropanoic acid 3878-55-5 AI3-03389 Butanedioic acid, monomethyl ester EINECS 223-408-2 Methyl hydrogen succinate Monomethyl succinate NSC 511 Succinic acid, monomethyl ester (8CI)
pdb file: 654537.pdb
sdf file: 654537.sdf
directory: 654537

2-Propenoic acid, 2-(phosphonooxy)-, monopotassium salt 4265-07-0 EINECS 224-247-0 Potassium hydrogen 2-(phosphonatooxy)acrylate
pdb file: 654997.pdb
sdf file: 654997.sdf
directory: 654997

4300-28-1 D-Ribose 5-(dihydrogen phosphate) D-Ribose 5-phosphate D-Ribose-5-phosphoric acid EINECS 224-310-2 R-5-P Ribose 5-monophosphate Ribose 5-phosphate Ribose phosphate Ribose, 5-(dihydrogen phosphate), D-
pdb file: 655028.pdb
sdf file: 655028.sdf
directory: 655028

148-25-4 2,7-Naphthalenedisulfonic acid, 4,5-dihydroxy-, monosodium salt 3888-44-6 Chromotropic acid, monosodium salt EINECS 223-430-2 Sodium hydrogen 4,5-dihydroxynaphthalene-2,7-disulphonate
pdb file: 655032.pdb
sdf file: 655032.sdf
directory: 655032

129101-54-8 Carbamic acid, ethylmethyl-, 3-((1S)-1-(dimethylamino)ethyl)phenyl ester, (2R,3R)-2,3-dihydroxybutanedioate (1:1) Carbamic acid, ethylmethyl-, 3-(1-(dimethylamino)ethyl)phenyl ester, (S)-, (R-(R*,R*))-2,3-dihydroxybutanedioate (1:1) ENA 713 ENA-713 Exelon Rivastigmine hydrogentartrate Rivastigmine tartrate SDZ-ENA 713
pdb file: 655040.pdb
sdf file: 655040.sdf
directory: 655040

4396-06-9 EINECS 224-524-6 Isopentyl octyl hydrogen phosphate Phosphoric acid, mono(3-methylbutyl) monooctyl ester
pdb file: 655148.pdb
sdf file: 655148.sdf
directory: 655148

1-Tetradecanol, hydrogen sulfate, compd. with 2,2',2''-nitrilotris(ethanol) (1:1) 4492-78-8 EINECS 224-784-0 Sulfuric acid, monotetradecyl ester, compd. with 2,2',2''-nitrilotris(ethanol) (1:1) Tetradecyl sulfate (1:1), triethanolamine salt Triethanolamine myristyl sulfate Triethanolamine tetradecyl sulfate Tris(2-hydroxyethyl)ammonium tetradecyl sulphate
pdb file: 655276.pdb
sdf file: 655276.sdf
directory: 655276

1-Hexadecanol, hydrogen sulfate, compd. with 2,2',2''-nitrilotris(ethanol) (1:1) 1-Hexadecanol, sulfate (1:1), triethanolamine salt (1:1) 4492-79-9 EINECS 224-785-6 Sulfuric acid, monohexadecyl ester, compd. with 2,2',2''-nitrilotrisethanol (1:1) Triethanolamine hexadecyl sulfate Triethanolamine palmityl sulfate Tris(2-hydroxyethyl)ammonium hexadecyl sulphate
pdb file: 655277.pdb
sdf file: 655277.sdf
directory: 655277

1,2-Benzenedicarboxylic acid, monooctyl ester 3-09-00-04112 (Beilstein Handbook Reference) 5393-19-1 AI3-06031 BRN 2280185 EINECS 226-398-8 Hydrogen octyl phthalate Mono-n-octyl phthalate Monooctyl phthalate NSC 4639 Octyl hydrogen phthalate Phthalic acid, monooctyl ester Phthalic acid, octyl ester
pdb file: 656364.pdb
sdf file: 656364.sdf
directory: 656364

409345-36-4 5399-63-3 636-78-2 Benzoic acid, 4-sulfo-, monopotassium salt EINECS 226-435-8 NSC 4862 Potassium 4-carboxybenzenesulfonate Potassium hydrogen 4-sulphonatobenzoate p-Sulphobenzoic acid, monopotassium salt
pdb file: 656391.pdb
sdf file: 656391.sdf
directory: 656391

5802-76-6 Diethyl hydrogen phosphate, compound with triethylamine (1:1) EINECS 227-354-0 Phosphoric acid, diethyl ester, compd. with N,N-diethylethanamine (1:1) Phosphoric acid, diethyl ester, triethylamine salt
pdb file: 656858.pdb
sdf file: 656858.sdf
directory: 656858

1080-04-2 6217-68-1 EINECS 228-288-5 NSC 121598 NSC 26566 Phenol, p-nitro-, hydrogen sulfate (ester), potassium salt Potassium 4-nitrophenyl sulphate Sulfuric acid, mono(4-nitrophenyl) ester, potassium salt
pdb file: 657352.pdb
sdf file: 657352.sdf
directory: 657352

6303-30-6 Diisobutyl hydrogen phosphate EINECS 228-602-0 Phosphoric acid, bis(2-methylpropyl) ester
pdb file: 657546.pdb
sdf file: 657546.sdf
directory: 657546

1,3-Benzenedicarboxylic acid, 5-sulfo-, monosodium salt 3,5-Dicarboxybenzenesulfonic acid, sodium salt 3,5-Dikarboxybenzensulfonan sodny [Czech] 6362-79-4 90021-69-5 Benzene-1,3-dicarboxylic acid, 5-sulfo-, monosodium salt Benzenesulfonic acid, 3,5-dicarboxy-, sodium salt EINECS 228-845-2 Isophthalic acid, 5-sulfo-, monosodium salt Kyselina 3,5-dikarboxybenzensulfonova sodny [Czech] Sodium hydrogen-5-sulphoisophthalate
pdb file: 657693.pdb
sdf file: 657693.sdf
directory: 657693

6428-00-8 Diethyl hydrogen phosphate, compound with N,N-dimethyldodecylamine(1:1) EINECS 229-202-9 Phosphoric acid, diethyl ester, compd. with N,N-dimethyl-1-dodecanamine (1:1)
pdb file: 657862.pdb
sdf file: 657862.sdf
directory: 657862

6505-30-2 Acid blue 104 Benzenemethanaminium, N-(4-((4-(diethylamino)phenyl)(4-(ethyl((3-sulfophenyl)methyl)ami- no)-2-methylphenyl)methylene)-3-methyl-2,5-cyclohexadien-1-yliden- e)-N-ethyl-3-sulfo-, hydroxide, inner salt, sodium salt Benzenemethanaminium, N-(4-((4-(diethylamino)phenyl)(4-(ethyl((3-sulfophenyl)methyl)amino)-2-methylphenyl)methylene)-3-methyl-2,5-cyclohexadien-1-ylidene)-N-ethyl-3-sulfo-, inner salt, sodium salt CI 42735 EINECS 229-390-2 Hydrogen (4-((4-(diethylamino)phenyl)(4-(ethyl(3-sulphonatobenzyl)amino)-o-tolyl)methylene)-3-methylcyclohexa-2,5-dien-1-ylidene)(ethyl)(3-sulphonatobenzyl)ammonium, sodium salt N-(4-((4-(Diethylamino)phenyl)(4-(ethyl((3-sulfophenyl)methyl)ami- no)-2-methylphenyl)methylene)-3-methyl-2,5-cyclohexadien-1-yliden- e)-N-ethyl-3-sulfobenzenemethanaminium hydroxide, inner salt, sodium salt
pdb file: 657947.pdb
sdf file: 657947.sdf
directory: 657947

632-25-7 6939-89-5 Ammonium hydrogen 2-sulphobenzoate Ammonium o-carboxybenzenesulfonate Ammonium o-sulfobenzoic acid Benzoic acid, 2-sulfo-, monoammonium salt Benzoic acid, o-sulfo-, S-monoammonium salt (8CI) EINECS 230-077-8 NSC 38710
pdb file: 658298.pdb
sdf file: 658298.sdf
directory: 658298

7447-44-1 BRN 2244004 Phosphorothioic acid, S-(2-amino-2-methylpropyl) ester Propanethiol, 2-amino-2-methyl-, dihydrogen phosphate (ester) S-(2-Amino-2-methylpropyl)phosphorothioate
pdb file: 658866.pdb
sdf file: 658866.sdf
directory: 658866

7529-94-4 Ammonium octadecyl hydrogen phosphate EINECS 231-393-9 Octadecyl phosphate (1:1), monoammonium salt Phosphoric acid, monooctadecyl ester, monoammonium salt
pdb file: 658948.pdb
sdf file: 658948.sdf
directory: 658948

115815-47-9 117515-23-8 135962-85-5 144334-23-6 155180-45-3 178327-05-4 4-Benzyl hydrogen N-(tert-butoxycarbonyl)-L-aspartate 7536-58-5 98482-77-0 Aspartic acid, N-carboxy-, 4-benzyl N-tert-butyl ester, L- EINECS 231-406-8 L-Aspartic acid, N-((1,1-dimethylethoxy)carbonyl)-, 4-(phenylmethyl) ester N-((1,1-Dimethylethoxy)carbonyl)-L-aspartic acid, 4-(phenylmethyl) ester N-tert-Butoxycarbonyl-L-aspartic acid 4-benzyl ester N-tert-Butoxycarbonyl-L-aspartic acid beta-benzyl ester NSC 118538 t-Butyloxycarbonylaspartic acid alpha-benzyl ester
pdb file: 658954.pdb
sdf file: 658954.sdf
directory: 658954

1-Undecanol, hydrogen phosphate (9CI) 4-01-00-01836 (Beilstein Handbook Reference) 7598-64-3 BRN 1715295 Diundecyl phosphate NSC 407915 Phosphoric acid, diundecyl ester Undecyl phosphate, di-
pdb file: 658989.pdb
sdf file: 658989.sdf
directory: 658989

1-Tridecanol, dihydrogen phosphate 5116-94-9 EINECS 225-850-1 Monotridecyl phosphate Tridecan-1-yl dihydrogen phosphate Tridecyl acid phosphate
pdb file: 659081.pdb
sdf file: 659081.sdf
directory: 659081

200553-44-2 39809-54-6 7722-71-6 9-Octadecen-1-ol, dihydrogen phosphate, (9Z)- EINECS 231-761-9 Oleyl dihydrogen phosphate Oleyl ether phosphate (acid)
pdb file: 659094.pdb
sdf file: 659094.sdf
directory: 659094

11099-00-6 113844-93-2 118063-53-9 14854-24-1 31051-56-6 36730-33-3 36730-35-5 66828-59-9 7782-91-4 80031-73-8 8030-65-7 EINECS 231-970-5 Molybdate (MoO42-), dihydrogen, (T-4)- Molybdate (MoO42-), dihydrogen, (beta-4)- Molybdic acid Molybdic(VI) acid
pdb file: 659126.pdb
sdf file: 659126.sdf
directory: 659126

12196-81-5 198830-56-7 36730-36-6 38413-99-9 7783-03-1 79702-55-9 82351-38-0 Dihydrogen wolframate EINECS 231-975-2 Tungstate (WO42-), dihydrogen, (T-4)- Tungstate (WO42-), dihydrogen, (beta-4)- Tungstic acid (H2WO4) Tungstic(VI) acid
pdb file: 659127.pdb
sdf file: 659127.sdf
directory: 659127

7795-87-1 97539-81-6 Decyl phosphate Didecyl hydrogen phosphate Didecyl phosphate Didecylorthophosphate EINECS 232-248-2 NSC 309954 Phosphoric acid, didecyl ester
pdb file: 659181.pdb
sdf file: 659181.sdf
directory: 659181

1,4-Piperazinediethanesulfonic acid, monosodium salt 10010-67-0 5625-37-6 EINECS 233-005-3 PIPES monosodium Piperazine-1,4-diethanesulfonate, sodium salt Sodium hydrogen piperazine-1,4-diethanesulphonate
pdb file: 659212.pdb
sdf file: 659212.sdf
directory: 659212

10319-70-7 Acetamidine, 2-mercapto-, hydrogen sulfate (ester) (8CI) BRN 1938718 Methanethiol, amidino-, hydrogen thiosulfate NSC 187482 S-(Amidinomethyl) hydrogen thiosulfate Thiosulfuric acid (H2S2O3), S-(2-amino-2-iminoethyl) ester (9CI)
pdb file: 659453.pdb
sdf file: 659453.sdf
directory: 659453

122402-75-9 12758-40-6 14C-Proxigermanium 2-Carboxyethylgermasesquioxane 27031-31-8 3,3'-(1,3-Dioxo-1,3-digermoxanediyl)dipropionic acid 3,3'-(Dioxodigermoxanylene) dipropanoic acid 3,3'-(Germanoic anhydride) dipropanoic acid 31434-91-0 69992-83-2 83172-76-3 BRN 4141883 Bis-beta-carboxyethylgermanium sesquioxide CCRIS 5469 Carboxyethylgermanium sesquioxide Carboxylethylgermanium sesquioxide Dihydrogen bis(2-carboxylatoethyl)trioxodigermanate(2-) Dipropanoic acid germanium sequioxide EINECS 235-800-0 Ge 132 Germanate(2-), bis(2-carboxylatoethyl)trioxodi-, dihydrogen (9CI) NSC 267004 Propagermanium Propanoic acid, 3,3'-(1,3-dioxo-1,3-digermoxanediyl)bis- Propanoic acid, 3,3'-(oxybis(oxogermylene))bis- Propionic acid, 3,3'-(1,3-dioxodigermoxanylene)di- Proxigermanium SK 818
pdb file: 659955.pdb
sdf file: 659955.sdf
directory: 659955

12789-45-6 AP 1 Methyl hydrogen phosphate Phosphoric acid, methyl ester
pdb file: 659957.pdb
sdf file: 659957.sdf
directory: 659957

13006-05-8 EINECS 235-847-7 Magnesium octadecyl sulfate Octadecanol, hydrogen sulfate, magnesium salt Octadecyl hydrogen sulphate, magnesium salt Sulfuric acid, monooctadecyl ester, magnesium salt
pdb file: 659964.pdb
sdf file: 659964.sdf
directory: 659964

1-Decanol, hydrogen sulfate ester, ammonium salt 1-Decanol, hydrogen sulfate, ammonium salt 13177-52-1 Ammonium decyl sulfate Ammonium decyl sulphate EINECS 236-128-0 Sulfuric acid, monodecyl ester, ammonium salt
pdb file: 660125.pdb
sdf file: 660125.sdf
directory: 660125

(2-(2-Methyl-5-nitro-1H-imidazol-1-yl)ethyl) hydrogen succinate 13182-87-1 Butanedioic acid, mono(2-(2-methyl-5-nitro-1H-imidazol-1-yl)ethyl) ester EINECS 236-130-1 Metronidazole monosuccinate
pdb file: 660128.pdb
sdf file: 660128.sdf
directory: 660128

13768-11-1 81517-99-9 EINECS 237-380-4 Hydrogen tetraoxorhenate (VII) Perrhenic acid Perrhenic acid (HReO4) Rhenate (ReO41-), hydrogen, (T-4)-
pdb file: 660619.pdb
sdf file: 660619.sdf
directory: 660619

(Carboxymethyl)trimethylammonium dihydrogen citrate 17671-50-0 Betaine citrate EINECS 241-648-6 Methanaminium, 1-carboxy-N,N,N-trimethyl-, salt with 2-hydroxy-1,2,3-propanetricarboxylic acid (1:1)
pdb file: 660739.pdb
sdf file: 660739.sdf
directory: 660739

20537-88-6 63717-27-1 Amifostina [INN-Spanish] Amifostine monohydrate Amifostinum [INN-Latin] Ethanethiol, 2-((3-aminopropyl)amino)-, dihydrogen phosphate (ester) hydrate Phosphorothioic acid, S-(2-((3-aminopropyl)amino)ethyl) ester, hydrate Phosphorothioic acid, S-ester with 2-((3-aminopropyl)amino)ethanethiol, hydrate
pdb file: 660883.pdb
sdf file: 660883.sdf
directory: 660883

120642-21-9 2-Aminoethanethiol dihydrogen phosphate (ester) 5746-40-7 Cysteamine S-phosphate Cysteamine-S-phosphate Ethanethiol, 2-amino-, S-ester with phosphorothioic acid (7CI) Ethanethiol, 2-amino-, dihydrogen phosphate (ester) NSC 118587 Phosphocysteamine Phosphorothioic acid, S-(2-aminoethyl) ester (8CI) S-(2-Aminoethyl) phosphorothioate WR 638
pdb file: 660930.pdb
sdf file: 660930.sdf
directory: 660930

1,2-Pyrrolidinedicarboxylic acid, 1-(1,1-dimethylethyl) ester, (2S)- 1,2-Pyrrolidinedicarboxylic acid, 1-(1,1-dimethylethyl) ester, (S)- 1,2-Pyrrolidinedicarboxylic acid, 1-(1,1-dimethylethyl) ester, (S)- (9CI) 1,2-Pyrrolidinedicarboxylic acid, 1-tert-butyl ester, L- (8CI) 1-(tert-Butyl) hydrogen (S)-pyrrolidine-1,2-dicarboxylate 1-tert-Butoxycarbonyl-L-proline 1-tert-Butyloxycarbonyl-L-proline 15761-39-4 EINECS 239-848-3 N-(tert-Butoxycarbonyl)-L-proline N-(tert-Butyloxycarbonyl)-L-proline N-tert-Butoxycarbonylproline NSC 164660 tert-Butoxycarbonyl-L-proline tert-Butoxycarbonylproline tert-Butyloxycarbonyl-L-proline
pdb file: 661938.pdb
sdf file: 661938.sdf
directory: 661938

(2-(N-(2-Hydroxyethyl)anilino)ethyl) hydrogen maleate 15772-26-6 2-Butenedioic acid (2Z)-, mono(2-((2-hydroxyethyl)phenylamino)ethyl) ester EINECS 239-864-0 Maleic acid, mono(2-(N-(2-hydroxyethyl)anilino)ethyl) ester
pdb file: 661947.pdb
sdf file: 661947.sdf
directory: 661947

16178-48-6 2921-83-7 Adenosine 5'-(trihydrogen diphosphate), disodium salt Adenosine, 5'-diphosphoric acid, disodium salt EINECS 240-314-7
pdb file: 662173.pdb
sdf file: 662173.sdf
directory: 662173

16456-56-7 3-01-00-01509 (Beilstein Handbook Reference) BRN 0969857 Butyl hydrogen phosphonate Butyl phosphite Butyl phosphonate ((Bu-O)-(O-H)-(H-P-O)) (7CI) Butylfosfit [Czech] EINECS 240-508-1 Monobutyl phosphite Phosphonic acid, monobutyl ester Phosphorous acid, butyl ester
pdb file: 662282.pdb
sdf file: 662282.sdf
directory: 662282

(2-Ethylhexyl)phosphonic acid, mono(2-ethylhexyl) ester 14802-03-0 2-Ethylhexyl hydrogen -2-ethylhexylphosphonate EINECS 238-865-3 Phosphonic acid, (2-ethylhexyl)-, mono(2-ethylhexyl) ester
pdb file: 662628.pdb
sdf file: 662628.sdf
directory: 662628

15679-95-5 67989-92-8 Palladate(2-), ((N,N'-1,2-cyclohexanediylbis(N-((carboxy-kappaO)methyl)glycinato-kappaN,kappaO))(4-))-, dihydrogen, (SP-4-2)- Palladium cyclohexanediaminetetraacetic acid
pdb file: 662754.pdb
sdf file: 662754.sdf
directory: 662754

37627-95-5 Ascorbate 2-sulfate Ascorbic acid 2-sulfate L-Ascorbic acid, 2-(hydrogen sulfate) L-Ascorbyl-2-sulfate
pdb file: 663326.pdb
sdf file: 663326.sdf
directory: 663326

18976-74-4 Benzenesulfonic acid, p-((4-(5-((2-hydroxyethyl)sulfonyl)-2-methoxyphenyl)azo)-5-hydroxy-3-methylpyrazol-1-yl)-3-chloro-5-methyl-, hydrogen sulfate (ester), disodium salt C.I. Reactive Yellow 14 Disodium 5-chloro-6-(4,5-dihydro-4-((2-methoxy-5-((2-(sulphonatooxy)ethyl)sulphonyl)phenyl)azo)-3-methyl-5-oxo-1H-pyrazol-1-yl)toluene-3-sulphonate EINECS 242-710-5 Procion Yellow MX 4R Remazol Yellow G
pdb file: 663651.pdb
sdf file: 663651.sdf
directory: 663651

103947-48-4 17125-84-7 23782-49-2 Palladate(2-), ((N,N'-1,2-ethanediylbis(N-(carboxymethyl)glycinato-kappaN,kappaO))(4-))-, dihydrogen, (SP-4-2)- Palladium ethylenediaminetetracetic acid
pdb file: 663802.pdb
sdf file: 663802.sdf
directory: 663802

17292-62-5 Cyanamide, monosodium salt EINECS 241-322-3 Monosodium cyanamide Sodium acid cyanamide Sodium cyanamidate Sodium hydrogen cyanamide
pdb file: 663870.pdb
sdf file: 663870.sdf
directory: 663870

17625-03-5 Benzoic acid, 3-sulfo-, monosodium salt EINECS 241-602-5 Sodium hydrogen m-sulphonatobenzoate
pdb file: 664016.pdb
sdf file: 664016.sdf
directory: 664016

17831-64-0 2-Butenedioic acid (Z)-, mono(2-methoxyethyl)ester 2-Methoxyethyl hydrogen maleate EINECS 241-787-2
pdb file: 664144.pdb
sdf file: 664144.sdf
directory: 664144

111753-25-4 12387-31-4 14969-97-2 16643-57-5 18962-61-3 51890-80-3 Aspartic acid, magnesium salt Dihydrogen bis(L-aspartato(2-)-N,O1)magnesate(2-) EINECS 242-703-7 Magnesate(2-), bis(L-aspartato(2-)-N,O1)-, dihydrogen, (beta-4)- Magnesate(2-), bis(L-aspartato(2-)-kappaN,kappaO1)-, dihydrogen, (T-4)- Magnesium aspartate
pdb file: 664686.pdb
sdf file: 664686.sdf
directory: 664686

1-Hexadecanol, dihydrogen phosphate, monopotassium salt 19035-79-1 EINECS 242-768-1 Phosphoric acid, cetyl ester, potassium salt Potassium cetyl phosphate Potassium hexadecyl hydrogen phosphate
pdb file: 664719.pdb
sdf file: 664719.sdf
directory: 664719

19089-55-5 3,5-Disulfobenzoic acid, disodium salt Benzoic acid, 3,5-disulfo-, disodium salt Disodium hydrogen 3,5-disulphonatobenzoate EINECS 242-807-2
pdb file: 664741.pdb
sdf file: 664741.sdf
directory: 664741

(2-((1-Oxoallyl)oxy)ethyl) hydrogen maleate 114266-44-3 19201-36-6 2-Butenedioic acid (2Z)-, mono(2-((1-oxo-2-propenyl)oxy)ethyl) ester EINECS 242-874-8
pdb file: 664770.pdb
sdf file: 664770.sdf
directory: 664770

19412-49-8 Methanethiol, amidino-, hydrogen phosphorothioate, sodium salt Phosphorothioic acid, S-(2-amino-2-iminoethyl) ester, monosodium salt Phosphorothioic acid, S-(amidinomethyl) ester, monosodium salt S-(Amidinomethyl) phosphorothioate monosodium salt Sodium hydrogen S-(amidinomethyl) phosphorothioate
pdb file: 664858.pdb
sdf file: 664858.sdf
directory: 664858

1,5-Naphthalenedisulfonic acid, 2-amino-, monosodium salt 1,5-Naphthalenedisulfonic acid,2-amino-,monosodium salt 19532-03-7 EINECS 243-138-9 Sodium hydrogen 2-aminonaphthalene-1,5-disulphonate
pdb file: 664908.pdb
sdf file: 664908.sdf
directory: 664908

145079-98-7 29-Ethyl 11-oxo-3-(phophonooxy)olean-12-en-29-oate P-2-ester with 5,6-O-(1-methylethylidene)-L-ascorbic acid, (3beta,20beta)- Ascorbic acid 2-(11-oxoolean-12-en-29-oic acid ethyl ester 3-yl-phosphate) GEPC L-Ascorbic acid 2-(glycyrrhetic acid ethyl ester-3beta-yl)phosphate sodium salt L-Ascorbic acid, 2-(20beta-11-oxo-olean-12-en-29-oic acid ethylester-3-beta-yl hydrogen phosphate) sodium salt Olean-12-en-29-oic acid, 11-oxo-3-(phophonooxy)-, 29-ethyl ester, P-2-ester with 5,6-O-(1-methylethylidene)-L-ascorbic acid, (3beta,20beta)-
pdb file: 664938.pdb
sdf file: 664938.sdf
directory: 664938

20438-93-1 DTPA - iron(3+) complex Diethylenetriamine pentaacetic acid, iron(III) salt Dihydrogen (N,N-bis(2-(bis(carboxymethyl)amino)ethyl)glycinato(5-))ferrate(2-) Dtpa ferrous chelate EINECS 243-821-1 Glycine, N,N-bis(2-(bis(carboxymethyl)amino)ethyl)-, iron salt
pdb file: 665333.pdb
sdf file: 665333.sdf
directory: 665333

20709-37-9 Ethanethiol, 2-((4-aminobutyl)amino)-, dihydrogen phosphate (ester) Phosphorothioic acid, S-(2-((4-aminobutyl)amino)ethyl) ester Phosphorothioic acid, S-ester with 2-((4-aminobutyl)amino)ethanethiol S-2-((4-Aminobutyl)amino)ethyl dihydrogen phosphorothioate WR 2822
pdb file: 665454.pdb
sdf file: 665454.sdf
directory: 665454

20709-38-0 Phosphorothioic acid, S-(3-((2-aminoethyl)amino)propyl) ester Phosphorothioic acid, S-ester with 3-((2-aminoethyl)amino)propanethiol Propanethiol, 3-((2-aminoethyl)amino)-, dihydrogen phosphate (ester) Propanethiol, 3-((2-aminoethyl)amino)-, dihydrogen phosphorothioate (ester) S-3-((2-Aminoethyl)amino)propyl dihydrogen phosphorothioate
pdb file: 665455.pdb
sdf file: 665455.sdf
directory: 665455

1-Propanethiol, 3-((3-aminopropyl)amino)-, dihydrogen phosphate 1-Propanethiol, 3-((3-aminopropyl)amino)-, dihydrogen phosphate (ester) (9CI) 20709-39-1 BRN 2092314 NSC 335661 Phosphorothioic acid, S-(3-(3-aminopropylamino)propyl) ester S-(3-((3-Aminopropyl)amino)propyl) dihydrogen phosphorothioate S-2-(3-Aminopropylamino)propyl phosphorothioic acid S-omega-(3-Aminopropylamino)propyl dihydrogen phosphorothioate WR 44923
pdb file: 665456.pdb
sdf file: 665456.sdf
directory: 665456

1-Propanethiol, 3-((4-aminobutyl)amino)-, dihydrogen phosphate (ester) 20709-40-4 Phosphorothioic acid, S-(3-((4-aminobutyl)amino)propyl) ester, dihydrate Phosphorothioic acid, S-ester with 3-((4-aminobutyl)amino)propanethiol, dihydrate Propanethiol, 3-((4-aminobutyl)amino)-, dihydrogen phosphate (ester) hydrate S-3-((4-Aminobutyl)amino)propyl dihydrogen phosphorothioate dihydrate WR 80855
pdb file: 665457.pdb
sdf file: 665457.sdf
directory: 665457

(2-((2-Methyl-1-oxoallyl)oxy)ethyl) hydrogen succinate 20882-04-6 Butanedioic acid, mono(2-((2-methyl-1-oxo-2-propenyl)oxy)ethyl) ester EINECS 244-096-4
pdb file: 665515.pdb
sdf file: 665515.sdf
directory: 665515

1-Hydroxyethylidene-1,1'-diphosphonate, dipotassium salt 128189-36-6 21089-06-5 Dipotassium dihydrogen (1-hydroxyethylidene)bisphosphonate EINECS 244-210-2 Phosphonic acid, (1-hydroxyethylidene)bis-, dipotassium salt
pdb file: 665581.pdb
sdf file: 665581.sdf
directory: 665581

21208-80-0 Ethanethiol, 2-(4-(p-methoxyphenyl)butyl)amino-, hydrogen thiosulfate S-2-((4-(p-Methoxyphenyl)butyl)amino)ethyl hydrogen thiosulfate Thiosulfuric acid, S-2-((4-(p-methoxyphenyl)butyl)amino)ethyl ester
pdb file: 665608.pdb
sdf file: 665608.sdf
directory: 665608

21302-09-0 BRN 2056801 Chelex H 12 Di(n-dodecyl)hydrogen phosphate Di-n-dodecyl phosphite Didodecyl phosphite Didodecyl phosphonate Dilauryl hydrogen phosphite Dilauryl phosphite EINECS 244-325-8 JP 212 NSC 41924 Phosphonic acid, didodecyl ester
pdb file: 665647.pdb
sdf file: 665647.sdf
directory: 665647

19698-29-4 2,3-Bis(palmitoyloxy)propyl dihydrogen phosphate Dipalmitoylphosphatidic acid EINECS 243-238-2 Palmitin, 1,2-di-, dihydrogen phosphate
pdb file: 665973.pdb
sdf file: 665973.sdf
directory: 665973

21601-78-5 61291-54-1 EINECS 244-470-7 Phenyl hydrogen phenylmalonate Phenylmalonic acid monophenyl ester Propanedioic acid, phenyl-, monophenyl ester
pdb file: 666279.pdb
sdf file: 666279.sdf
directory: 666279

22068-88-8 Benzenethiosulphonic acid, anhydrosulphide with O,O-dimethyl hydrogen dithiophosphate EINECS 244-758-2
pdb file: 666361.pdb
sdf file: 666361.sdf
directory: 666361

22483-52-9 EINECS 245-027-0 Isophthalic acid, dianhydride with diethyl bis(hydrogen carbonate)
pdb file: 666502.pdb
sdf file: 666502.sdf
directory: 666502

1,3-Benzenedicarboxylic acid, 5-nitro-, monoethyl ester 22871-55-2 5-Nitroisophthalic acid, monoethyl ester EINECS 245-273-9 Ethyl hydrogen 5-nitroisophthalate
pdb file: 666639.pdb
sdf file: 666639.sdf
directory: 666639

2-(2(Diethylamino)ethoxy)ethyl 1-phenyl-cyclopentanecarboxylate citrate (1:1) 2-(2-(Diethylamino)ethoxy)ethyl 1-phenylcyclopentanecarboxylate citrate (1:1) 2-(2-(Diethylamino)ethoxy)ethyl 1-phenylcyclopentyl-1-carboxylate dihydrogen citrate 23142-01-0 5585-88-6 Carbetapentane citrate Carbetapentone citrate Cyclopentanecarboxylic acid, 1-phenyl-, 2-(2-(diethylamino)ethoxy)ethyl ester, citrate (1:1) Diethyl(2-(2-((1-phenylcyclopentyl)formyloxy)ethoxy)ethyl)ammoniumdihydrogen 2-hydroxypropane-1,2,3-tricarboxylate EINECS 245-449-5 Ethanol, 2-(2-(diethylamino)ethoxy)-, 1-phenylcyclopentanecarboxylate (ester) citrate Loucarbate Pentoxiverine citrate Pentoxyverine citrate Toclase Toclase citrate
pdb file: 666774.pdb
sdf file: 666774.sdf
directory: 666774

23255-03-0 Acetic acid, nitrilotri-, disodium salt, monohydrate Disodium hydrogen nitrilotriacetate, monohydrate Disodium nitrilotriacetic acid monohydrate Glycine, N,N-bis(carboxymethyl)-, disodium salt, monohydrate NTA disodium salt, monohydrate Nitrilotriacetic acid, disodium salt, monohydrate Nitrolotriacetic acid disodium salt monohydrate
pdb file: 666809.pdb
sdf file: 666809.sdf
directory: 666809

2-(4-Phenylbutyl)aminoethanethiol hydrogen sulfate (ester) 23464-46-2 BRN 2863794 Ethanethiol, 2-((4-phenylbutyl)amino)-, hydrogen sulfate (ester) Ethanethiol, 2-((4-phenylbutyl)amino)-,hydrogen sulfate (ester) Ethanethiol, 2-(4-phenylbutyl)amino-, hydrogen sulfate (ester) NSC 339141 Thiosulfuric acid (H2S2O3), S-(2-((4-phenylbutyl)amino)ethyl) ester (8CI,9CI) WR 2754
pdb file: 666875.pdb
sdf file: 666875.sdf
directory: 666875

23545-56-4 Ethanethiol, 2-((3-aminopropyl)amino)-, hydrogen sulfate (ester), hydrochloride S-2-((3-Aminopropyl)amino)ethyl hydrogen thiosulfate hydrochloride Thiosulfuric acid, S-(2-((3-aminopropyl)amino)ethyl) ester, hydrochloride
pdb file: 666908.pdb
sdf file: 666908.sdf
directory: 666908

23545-57-5 Ethanethiol, 2-((4-aminobutyl)amino)-, hydrogen sulfate (ester), hydrochloride S-2-((4-Aminobutyl)amino)ethyl hydrogen thiosulfate hydrochloride Thiosulfuric acid, S-(2-((4-aminobutyl)amino)ethyl) ester, hydrochloride
pdb file: 666909.pdb
sdf file: 666909.sdf
directory: 666909

23545-58-6 Ethanethiol, 2-((6-aminohexyl)amino)-, hydrogen sulfate (ester), hydrobromide S-2-((6-Aminohexyl)amino)ethyl hydrogen thiosulfate hydrobromide Thiosulfuric acid, S-(2-((6-aminohexyl)amino)ethyl) ester, hydrobromide
pdb file: 666910.pdb
sdf file: 666910.sdf
directory: 666910

23563-74-8 Ethanethiol, 2-((2-anilinoethyl)amino)-, hydrogen sulfate (ester) S-2-((Anilinoethyl)amino)ethyl hydrogen thiosulfate Thiosulfuric acid, S-(2-((2-anilinoethyl)amino)ethyl) ester
pdb file: 666926.pdb
sdf file: 666926.sdf
directory: 666926

23563-75-9 Ethanethiol, 2-((3-anilinopropyl)amino)-, hydrogen sulfate (ester) S-2-((3-Anilinopropyl)amino)ethyl hydrogen thiosulfate Thiosulfuric acid, S-(2-((3-anilinopropyl)amino)ethyl) ester
pdb file: 666927.pdb
sdf file: 666927.sdf
directory: 666927

23563-79-3 Ethanethiol, 2-((3-cyclohexylaminopropyl)amino)-, hydrogen sulfate (ester), hemihydrate S-2-((3-Cyclohexylaminopropyl)amino)ethyl hydrogen thiosulfate hemihydrate Thiosulfuric acid, S-(2-((3-cyclohexylaminopropyl)amino)ethyl) ester, hemihydrate
pdb file: 666928.pdb
sdf file: 666928.sdf
directory: 666928

1,2-Benzenedicarboxylic acid, monohexyl ester 24539-57-9 AI3-06032 EINECS 246-302-8 Hexyl hydrogen phthalate Mono-n-hexyl phthalate
pdb file: 667264.pdb
sdf file: 667264.sdf
directory: 667264

1,2-Benzenedicarboxylic acid, monodecyl ester 24539-60-4 Decyl hydrogen phthalate EINECS 246-304-9
pdb file: 667266.pdb
sdf file: 667266.sdf
directory: 667266

24940-63-4 Calcium 2,5-diketogluconic acid Calcium bis(hydrogen D-threo-hexo-2,5-diulosonate) D-threo-2,5-Hexodiulosonic acid, calcium salt (2:1) EINECS 246-542-3
pdb file: 667395.pdb
sdf file: 667395.sdf
directory: 667395

(1-Ethylhexyl) hydrogen phthalate 1,2-Benzenedicarboxylic acid, mono(1-ethylhexyl) ester 23276-77-9 EINECS 245-547-8 Mono(1-ethylhexyl) phthalate Phthalic acid, mono(1-ethylhexyl) ester
pdb file: 667633.pdb
sdf file: 667633.sdf
directory: 667633

23807-34-3 4-(2-((4-((2-Hydroxyethyl)sulfonyl)-6-methoxy-m-tolyl)azo)acetoacetamido)-5-methoxy-o-toluenesulfonic acid, hydrogen sulfate (ester) Benzenesulfonic acid, 5-methoxy-4-((2-((2-methoxy-5-methyl-4-((2-(sulfooxy)ethyl)sulfonyl)phenyl)azo)-1,3-dioxobutyl)amino)-2-methyl-
pdb file: 667709.pdb
sdf file: 667709.sdf
directory: 667709

1,2-Benzenedicarboxylic acid, 4-((3-aminophenyl)hydroxymethyl)-, 1-methyl ester 23843-86-9 EINECS 245-905-3 Methyl hydrogen 4-((3-aminophenyl)hydroxymethyl)phthalate
pdb file: 667715.pdb
sdf file: 667715.sdf
directory: 667715

24614-40-2 EINECS 246-357-8 Sodium 4-decyl hydrogen sulphonatosuccinate Sodium decylsulfosuccinate Succinic acid, sulfo-, 4-decyl ester, monosodium salt
pdb file: 667882.pdb
sdf file: 667882.sdf
directory: 667882

1623-15-0 25238-99-7 Butyl potassium phosphate (1:1:1) EINECS 246-750-4 Phosphoric acid, monobutyl ester, monopotassium salt Potassium butyl hydrogen phosphate
pdb file: 668078.pdb
sdf file: 668078.sdf
directory: 668078

2-((3,7-Dimethyloctyl)amino)ethanethiol hydrogen sulfate (ester) 25350-44-1 BRN 2370516 Ethanethiol, 2-((3,7-dimethyloctyl)amino)-, hydrogen sulfate (ester) NSC 339142 Thiosulfuric acid (H2S2O3), S-(2-((3,7-dimethyloctyl)amino)ethyl) ester (8CI,9CI) WR 3358
pdb file: 668151.pdb
sdf file: 668151.sdf
directory: 668151

2-(5-Phenylpentyl)aminoethanethiol hydrogen sulfate (ester) 25350-46-3 BRN 2868769 Ethanethiol, 2-(5-phenylpentyl)amino-, hydrogen sulfate (ester) Thiosulfuric acid, (H2S2O3), S-(2-((5-phenylpentyl)amino)ethyl) ester (8CI,9CI) WR 3427
pdb file: 668152.pdb
sdf file: 668152.sdf
directory: 668152

2464-13-3 6-Phosphogluconate 921-62-0 D-Gluconic acid 6-(dihydrogen phosphate) EINECS 213-069-9 Gluconic acid-6-phosphate
pdb file: 668238.pdb
sdf file: 668238.sdf
directory: 668238

2-Butenedioic acid (E)-, monoethyl ester (9CI) 2459-05-4 55141-86-1 62008-21-3 62008-22-4 76260-93-0 EINECS 219-544-7 Ethyl fumarate Ethyl hydrogen fumarate Fumaric acid, ethyl ester Fumaric acid, monoethyl ester Monoethyl fumarate Monoethyl trans-2-butenedioate NSC 524101
pdb file: 668272.pdb
sdf file: 668272.sdf
directory: 668272

16079-55-3 3792-50-5 56-84-8 Aspartate monosodium salt CCRIS 7917 EINECS 223-264-0 L-Aspartic acid, monosodium salt Monosodium L-aspartate Monosodium aspartate Monosodium-L-aspartate Sodium aspartate Sodium hydrogen L-aspartate
pdb file: 668290.pdb
sdf file: 668290.sdf
directory: 668290

1-01-00-00182 (Beilstein Handbook Reference) 1-Propanol, 2,3-dibromo-, hydrogen phosphate 1-Propanol, 2,3-dibromo-, hydrogen phosphate (ester) 34432-82-1 36711-31-6 5412-25-9 64864-08-0 AI3-19169 BRN 1712420 Bis(2,3-dibromopropyl) hydrogen phosphate Bis(2,3-dibromopropyl) phosphate Bis(2,3-dibromopropyl)phosphate Bis(2,3-dibromopropyl)phosphoric acid CCRIS 813 EINECS 226-493-4 NSC 3239
pdb file: 668299.pdb
sdf file: 668299.sdf
directory: 668299

((Z)-2-(2-((1-Oxo-9-octadecenyl)amino)ethoxy)ethyl) hydrogen maleate 2-Butenedioic acid (2Z)-, mono(2-(2-((9Z)-(1-oxo-9-octadecenyl)amino)ethoxy)ethyl) ester 56381-65-8 EINECS 260-142-6 Mono(oleylamidoethoxyethyl) maleate
pdb file: 668638.pdb
sdf file: 668638.sdf
directory: 668638

1,2-Benzenedicarboxylic acid, 4-chloro-, monosodium salt 56047-23-5 EINECS 259-963-2 Monosodium hydrogen 4-chlorophthalate Sodium 4-chlorophthalate
pdb file: 668792.pdb
sdf file: 668792.sdf
directory: 668792

13015-61-7 1674-85-7 2133-82-6 5'-Inosinic acid, 6-thio- (9CI) 53-83-8 6-Mercaptopurine ribonucleotide 6-Mercaptopurine riboside 5'-monophosphate 6-Mercaptopurine riboside 5'-phosphate 6-Mercaptopurine riboside-5-phosphate 6-Mercaptopurine ribotide 6-Thioinosine 5'-monophosphate 6-Thioinosine 5'-phosphate (VAN) 9H-Purine-6-thiol, 9-beta-D-ribofuranosyl-, 5'-(dihydrogen phosphate) (8CI) EINECS 200-183-9 NSC 520722 Thio-IMP Thioinosinic acid
pdb file: 668919.pdb
sdf file: 668919.sdf
directory: 668919

3615-55-2 Ribose, 5-(dihydrogen phosphate) Ribose-5-phosphate Ribose-5-phosphoric acid
pdb file: 669042.pdb
sdf file: 669042.sdf
directory: 669042

1,2-Benzenedicarboxylic acid, mono(2-methylpropyl) ester (9CI) 3-09-00-04104 (Beilstein Handbook Reference) 30833-53-5 BRN 3280781 EINECS 250-352-6 Isobutyl hydrogen phthalate MIBP Mono-iso-butyl phthalate Monoisobutyl phthalate Phthalic acid, monoisobutyl ester
pdb file: 669130.pdb
sdf file: 669130.sdf
directory: 669130

1,2-Benzenedicarboxylic acid, 4,4'-carbonylbis-, ar,ar'-diethyl ester, compd. with 1,3-benzenediamine 1,2-Benzenedicarboxylic acid, 4,4'-carbonylbis-, ar,ar'-dietyl ester compd. with 1,3-benzenediamine 1,3-Benzenediamine, ar,ar'-diethyl 4,4'-carbonylbis(1,2-benzenedicarboxylate) (1:1) 65701-07-7 Di(half ethyl)ester of benzophenone tetracarboxylic acid dianhydride, m-phenylenediamine salts Diethyl 4,4'-carbonylbis(hydrogen phthalate), compound with benzene-m-diamine EINECS 265-883-9 Skybond 2595
pdb file: 669245.pdb
sdf file: 669245.sdf
directory: 669245

56643-20-0 BRN 2477282 Ethanethiol, 2-hydroxytrimethylenediiminodi-, dihydrogen phosphorothioate (1:2) Phosphorothioic acid, S-ester with 2-hydroxytrimethylenediiminodiethanethiol (2:1)
pdb file: 669362.pdb
sdf file: 669362.sdf
directory: 669362

56643-24-4 BRN 2451890 Phosphorothioic acid, S-(2-(3-(2-hydroxyethylamino)propylamino)ethyl) ester S-2-(3-(2-Hydroxyethylamino)propylamino)ethyl dihydrogen phosphorothioate ethanolate
pdb file: 669363.pdb
sdf file: 669363.sdf
directory: 669363

56643-49-3 BRN 2448395 Phosphorothioic acid, S-(3-(3-aminopropylamino)-2-hydroxy)propyl ester S-3-(omega-Aminopropylamino)-2-hydroxypropyl dihydrogen phosphorothioate
pdb file: 669364.pdb
sdf file: 669364.sdf
directory: 669364

144472-88-8 2-Butenedioic acid (2Z)-, monoethyl ester 2-Butenedioic acid (Z)-, monoethyl ester 3990-03-2 EINECS 223-635-7 Ethyl hydrogen maleate Maleic acid, monoethyl ester Maleic acid, monoethyl ester (8CI) Monoethyl maleate NSC 11206 NSC 525207
pdb file: 669906.pdb
sdf file: 669906.sdf
directory: 669906

5'-Uridylic acid, 5-bromo-2'-deoxy- 5-Bromo-2'-deoxyuridine 5'-monophosphate 6666-38-2 Bromodeoxyuridylate EINECS 229-706-9 Uridine, 5-bromo-2'-deoxy-, 5'-(dihydrogen phosphate)
pdb file: 669974.pdb
sdf file: 669974.sdf
directory: 669974

26016-98-8 Calcium fosfomycin Calcium hydrogen (2R-cis)-(3-methyloxiranyl)phosphonate Calcium phosphomycin Calcium phosphonomycin EINECS 247-408-7 Fosfomycin calcium Fosfomycin calcium salt Fosmicin Phosphonic acid, (1,2-epoxypropyl)-, calcium salt (1:1), (1R,2S)-(-)- Phosphonic acid, (3-methyloxiranyl)-, calcium salt (1:1), (2R-cis)- (9CI)
pdb file: 670046.pdb
sdf file: 670046.sdf
directory: 670046

29047-63-0 29923-31-7 51959-34-3 Acylglutamate LS-11 Amisoft LS 11 EINECS 249-958-3 Glutamic acid, N-lauroyl-, L-, monosodium salt Hostapon CLG L-Glutamic acid, N-(1-oxododecyl)-, monosodium salt Monosodium N-lauroyl-L-glutamate N-Dodecanoylglutamic acid sodium salt N-Lauroyl-L-glutamic acid monosodium salt N-Lauroyl-L-glutamic acid sodoim salt Sodium N-dodecanoylglutamate Sodium N-lauroyl-L-glutamate Sodium N-lauroylglutamate Sodium hydrogen N-(1-oxododecyl)-L-glutamate
pdb file: 670096.pdb
sdf file: 670096.sdf
directory: 670096

1-Propanol, 2,3-dibromo-, hydrogen phosphate, ammonium salt 2,3-Dibromo-1-propanol hydrogen phosphate ammonium salt 34432-82-1 5412-25-9 Ammonium bis(2,3-dibromopropyl) phosphate Ammonium bis(2,3-dibromopropyl)phosphate Bis(2,3-dibromopropyl)phosphate ammonium salt EINECS 252-018-5 Mono(2,3-dibromopropyl)ammonium phosphate Phosphoric acid, bis(2,3-dibromopropyl) ester, ammonium salt
pdb file: 670140.pdb
sdf file: 670140.sdf
directory: 670140

25954-13-6 59682-52-9 BRN 2206645 Ethyl carbamoylphosphonic acid Ethyl hydrogen carbamoylphosphonate Fosamine Fosamine [BSI:ISO] Monoethyl (aminocarbonyl)phosphonate Phosphonic acid, (aminocarbonyl)-, monoethyl ester
pdb file: 670305.pdb
sdf file: 670305.sdf
directory: 670305

62625-22-3 Benzoic acid, 2-((((2-hydroxy-5-sulfophenyl)azo)phenylmethylene)hydrazino)-, monosodium salt Benzoic acid, 2-(1-(2-hydroxy-5-sulfophenyl)-3-phenyl-5-formazano)-, monosodium salt EINECS 263-651-1 Sodium hydrogen 2-(1-(2-hydroxy-5-sulphonatophenyl)-3-phenyl-5-formazano)benzoate
pdb file: 670320.pdb
sdf file: 670320.sdf
directory: 670320

1,2-Benzenedicarboxylic acid, 4,4'-carbonylbis-, ar,ar'-diethyl ester, compd. with 4,4'-methylenebis(benzenamine) (1:1) 65701-06-6 Diethyl 4,4'-carbonylbis(hydrogen phthalate), compound with p,p'-methylenedianiline (1:1) EINECS 265-882-3 Skybond 1028
pdb file: 670341.pdb
sdf file: 670341.sdf
directory: 670341

1,3-Naphthalenedisulfonic acid, 4-amino-5-hydroxy-, monopotassium salt 57248-90-5 EINECS 260-649-2 Potassium hydrogen 4-amino-5-hydroxynaphthalene-1,3-disulphonate
pdb file: 670635.pdb
sdf file: 670635.sdf
directory: 670635

1,3-Dimethylbutyl hydrogen phosphorodithioate, sodium salt 2-Pentanol, 4-methyl-, hydrogen phosphorodithioate, sodium salt 58237-08-4 EINECS 261-178-5 Phosphorodithioic acid, O,O-bis(1,3-dimethylbutyl) ester, sodium salt
pdb file: 671046.pdb
sdf file: 671046.sdf
directory: 671046

109007-00-3 117343-56-3 119252-26-5 121703-70-6 144595-20-0 1676-73-9 200395-75-1 201050-80-8 224962-04-3 5-Benzyl L-glutamate 5844-47-3 65681-11-0 Benzyl hydrogen gamma-L-glutamate EINECS 216-826-1 Glutamic acid gamma-benzyl ester Glutamic acid, 5-benzyl ester, L- (8CI) L-Glutamic acid 5-benzyl ester L-Glutamic acid gamma-benzyl ester L-Glutamic acid, 5-(phenylmethyl) ester NSC 9969 gamma-Benzyl L-glutamate
pdb file: 672585.pdb
sdf file: 672585.sdf
directory: 672585

1-Hexanol, 3,5,5-trimethyl-, hydrogen phosphate (8CI) 7153-98-2 Bis(3,5,5-trimethylhexyl) hydrogen phosphate Bis(3,5,5-trimethylhexyl) phosphate EINECS 230-501-1 NSC 58150 Phosphoric acid, bis(3,5,5-trimethylhexyl) ester
pdb file: 673368.pdb
sdf file: 673368.sdf
directory: 673368

2-((5-Cyclohexylpentyl)amino)ethanethiol hydrogen sulfate (ester) 21209-03-0 Ethanethiol, 2-(5-cyclohexylpentyl)amino-, hydrogen sulfate (ester) NSC 89074 S-2-((5-Cyclohexylpentyl)amino)ethyl thiosulfate Thiosulfuric acid (H2S2O3), -(2-((5-cyclohexylpentyl)amino)ethyl) ester (9CI)
pdb file: 673964.pdb
sdf file: 673964.sdf
directory: 673964

2-((4-(4-Methylcyclohexyl)butyl)amino)ethanethiol hydrogen sulfate (ester) 21209-02-9 BRN 2981975 Ethanethiol, 2-(4-(4-methylcyclohexyl)butyl)amino-, hydrogen sulfate (ester) NSC 89096 S-2-((4-(4-Methylcyclohexyl)butyl)amino)ethyl thiosulfate Thiosulfuric acid (H2S2O3), S-(2-((4-(4-methylcyclohexyl)butyl)amino)ethyl) ester (9CI)
pdb file: 673965.pdb
sdf file: 673965.sdf
directory: 673965

26644-00-8 AI3-15042 Cycate 296.9 Diphosphoric acid, P,P'-dimethyl ester EINECS 247-871-5 NSC 96609 P,P'-Dimethyl dihydrogen diphosphate P,P'-Dimethyl pyrophosphate Pyrophosphoric acid dimethyl ester Pyrophosphoric acid, P,P'-dimethyl ester
pdb file: 674206.pdb
sdf file: 674206.sdf
directory: 674206

2177-62-0 4-Methyl hydrogen L-aspartate ASPARTIC ACID, 4-METHYL ESTER, (L) Aspartic acid 4-methyl ester EINECS 218-540-2 NSC 118508
pdb file: 674580.pdb
sdf file: 674580.sdf
directory: 674580

(2-Amino-2-thiazolin-5-yl)methylthiosulfuric acid 21679-20-9 BRN 1573503 Methanethiol, (2-amino-2-thiazolin-5-yl)-, hydrogen sulfate (ester) NSC 139604 Thiosulfuric acid, S-((2-amino-2-thiazolin-5-yl)methyl) ester
pdb file: 675752.pdb
sdf file: 675752.sdf
directory: 675752

163447-51-6 2382-76-5 Amyl dihydrogen phosphate EINECS 219-188-2 Monoamyl phosphate Monopentyl phosphate NSC 41913 Pentyl dihydrogen phosphate Pentyl phosphate, (C5H11O)(OH)2PO Phosphoric acid, monopentyl ester
pdb file: 675782.pdb
sdf file: 675782.sdf
directory: 675782

1-Piperidineethanethiol, hydrogen sulfate (ester) 30419-75-1 Thiosulfuric acid, S-2-piperidinoethyl ester
pdb file: 675887.pdb
sdf file: 675887.sdf
directory: 675887

1,2-Pyrrolidinedicarboxylic acid, 5-oxo-, 1-(phenylmethyl) ester 1-Benzyl hydrogen 5-oxopyrrolidine-1,2-dicarboxylate 80953-62-4 EINECS 279-635-2
pdb file: 676280.pdb
sdf file: 676280.sdf
directory: 676280

40284-00-2 Methanethiol, N-(2-(p-tolylthio)ethyl)amidino-, hydrogen thiosulfate NSC 187486 S-((N-(2-(p-Tolylthio)ethyl)amidino)methyl) hydrogen thiosulfate Thiosulfuric acid (H2S2O3), S-(2-imino-2-((2-((4-methylphenyl)thio)ethyl)amino)ethyl) ester (9CI)
pdb file: 676477.pdb
sdf file: 676477.sdf
directory: 676477

40283-99-6 Methanethiol, N-(2-(p-chlorophenylthio)ethyl)amidino-, hydrogen sulfate (ester) NSC 187498 S-((N-(2-(p-Chlorophenylthio)ethyl)amidino)methyl) hydrogen thiosulfate Thiosulfuric acid (H2S2O3), S-(2-((2-((4-chlorophenyl)thio)ethyl)amino)-2-iminoethyl) ester (9CI)
pdb file: 676478.pdb
sdf file: 676478.sdf
directory: 676478

13514-27-7 BRN 0443633 Methanethiol, N-(3-(3-indolyl)propyl)amidino-, hydrogen thiosulfate NSC 187499 S-((N-(3-(3-Indolyl)propyl)amidino)methyl) hydrogen thiosulfate Thiosulfuric acid (H2S2O3), S-(2-imino-2-((3-(1H-indol-3-yl)propyl)amino)ethyl) ester (9CI) Thiosulfuric acid, S-ester with N-(3-indol-3-ylpropyl)-2-mercaptoacetamidine (8CI)
pdb file: 676479.pdb
sdf file: 676479.sdf
directory: 676479

40283-90-7 Methanethiol, N-(4-phenoxybutyl)amidino-, hydrogen thiosulfate NSC 187513 S-((N-(4-Phenoxybutyl)amidino)methyl) hydrogen thiosulfate Thiosulfuric acid (H2S2O3), S-(2-imino-2-((4-phenoxybutyl)amino)ethyl) ester (9CI)
pdb file: 676480.pdb
sdf file: 676480.sdf
directory: 676480

40283-52-1 BRN 3953611 Methanethiol, N-cyclopropylamidino-, hydrogen thiosulfate NSC 187533 S-((N-Cyclopropylamidino)methyl) hydrogen thiosulfate Thiosulfuric acid (H2S2O3), S-(2-(cyclopropylamino)-2-iminoethyl) ester (9CI)
pdb file: 676482.pdb
sdf file: 676482.sdf
directory: 676482

40283-92-9 Methanethiol, N-(3-benzyloxypropyl)amidino-, hydrogen sulfate (ester) NSC 187541 S-((N-(3-Benzyloxypropyl)amidino)methyl) hydrogen thiosulfate Thiosulfuric acid (H2S2O3), S-(2-imino-2-((3-(phenylmethoxy)propyl)amino)ethyl) ester (9CI)
pdb file: 676483.pdb
sdf file: 676483.sdf
directory: 676483

40283-97-4 Methanethiol, N-(2-phenylthioethyl)amidino-, hydrogen thiosulfate NSC 187543 S-((N-(2-Phenylthioethyl)amidino)methyl) hydrogen thiosulfate Thiosulfuric acid (H2S2O3), S-(2-imino-2-((2-(phenylthio)ethyl)amino)ethyl) ester (9CI)
pdb file: 676484.pdb
sdf file: 676484.sdf
directory: 676484

40283-93-0 Methanethiol, N-(p-methoxybenzyl)amidino-, hydrogen thiosulfate NSC 187551 S-((N-(p-Methoxybenzyl)amidino)methyl) hydrogen thiosulfate Thiosulfuric acid (H2S2O3), S-(2-imino-2-(((4-methoxyphenyl)methyl)amino)ethyl) ester (9CI)
pdb file: 676485.pdb
sdf file: 676485.sdf
directory: 676485

40283-58-7 BRN 3971685 Methanethiol, (N-cyclohexylpropyl)amidino-, hydrogen sulfate (ester) NSC 194279 S-((N-Cyclohexylpropylamidino)methyl) hydrogen thiosulfate Thiosulfuric acid (H2S2O3), S-(2-((3-cyclohexylpropyl)amino)-2-iminoethyl) ester (9CI)
pdb file: 676525.pdb
sdf file: 676525.sdf
directory: 676525

40283-59-8 BRN 3975892 Methanethiol, (N-cyclohexylbutyl)amidino-, hydrogen thiosulfate NSC 194282 S-((N-Cyclohexylbutylamidino)methyl) hydrogen thiosulfate Thiosulfuric acid (H2S2O3), S-(2-((4-cyclohexylbutyl)amino)-2-iminoethyl) ester (9CI)
pdb file: 676526.pdb
sdf file: 676526.sdf
directory: 676526

40283-56-5 BRN 3965755 Methanethiol, (N-cyclohexylmethyl)amidino-, hydrogen sulfate (ester) NSC 194285 S-((N-Cyclohexylmethylamidino)methyl) hydrogen thiosulfate Thiosulfuric acid (H2S2O3), S-(2-((cyclohexylmethyl)amino)-2-iminoethyl) ester (9CI)
pdb file: 676527.pdb
sdf file: 676527.sdf
directory: 676527

23526-02-5 Bacillus thuringiensis B toxin Bacillus thuringiensis exotoxin D-Allaric acid, 2-O-alpha-D-glucopyranosyl-, 4-(dihydrogen phosphate), 4'-5'-anhydride with adenosine (9CI) D-Allaric acid, O-5'-deoxyadenosinyl-(5'-4)-O-3,6-anhydro-alpha-D-glucopyranosyl-(1-2)-, 4-(dihydrogenphosphate) Exotoxin NSC 197177 Thuringiensin Thuringiensin A Thurintox Turingin-1[Russian] beta-Exotoxin (bacillus thuringiensis)
pdb file: 676553.pdb
sdf file: 676553.sdf
directory: 676553

40283-68-9 Methanethiol, N-bornylamidino-, hydrogen sulfate (ester) NSC 187529 NSC 193430 S-((N-Bornylamidino)methyl) hydrogen thiosulfate Thiosulfuric acid (H2S2O3), S-(2-imino-2-((1,7,7-trimethylbicyclo(2.2.1)hept-2-yl)amino)ethyl) ester, endo- (9CI)
pdb file: 677080.pdb
sdf file: 677080.sdf
directory: 677080

40283-53-2 BRN 3959215 Methanethiol, N-cyclopentylamidino-, hydrogen thiosulfate NSC 193462 S-((N-Cyclopentylamidino)methyl) hydrogen thiosulfate Thiosulfuric acid (H2S2O3), S-(2-(cyclopentylamino)-2-iminoethyl) ester (9CI)
pdb file: 677088.pdb
sdf file: 677088.sdf
directory: 677088

40283-55-4 BRN 3963086 Methanethiol, (N-cyclohexyl)amidino-, hydrogen sulfate (ester) NSC 194277 S-((N-Cyclohexylamidino)methyl) hydrogen thiosulfate Thiosulfuric acid (H2S2O3), S-(2-(cyclohexylamino)-2-iminoethyl) ester (9CI)
pdb file: 677090.pdb
sdf file: 677090.sdf
directory: 677090

((7-Carboxy-4-formyl-3,8-dihydroxy-1,6-dimethyl-11-oxo-11H-dibenzo(b,e)(1,4)dioxepin-9-yl)methyl) hydrogen fumarate 489-50-9 EINECS 207-698-8 Fumarprotocetraric acid NSC 249984 NSC 685588
pdb file: 677258.pdb
sdf file: 677258.sdf
directory: 677258

2-((3-(Methylamino)propyl)amino)ethanethiol dihydrogen phosphate (ester) 20751-90-0 BRN 5508739 Ethanethiol, 2-((3-(methylamino)propyl)amino)-, dihydrogen phosphate (ester) Phosphorothioic acid, S-(2-((3-(methylamino)propyl)amino)ethyl) ester Phosphorothioic acid, S-(2-((3-(methylamino)propyl)amino)ethyl) ester (8CI)(9CI) WR 3689
pdb file: 678000.pdb
sdf file: 678000.sdf
directory: 678000

2-(2-Octyl)aminoethanethiol hydrogen sulfate (ester) 927-30-0 BRN 2366090 Ethanethiol, 2-((1-methylheptyl)amino)-, hydrogen sulfate (ester) Ethanethiol, 2-((2-octyl)amino)-, hydrogen sulfate (ester) Ethanethiol, 2-(2-octyl)amino-, hydrogen sulfate (ester) NSC 339144 Thiosulfuric acid (H2S2O3), S-(2-((1-methylheptyl)amino)ethyl) ester (8CI)(9CI) Thiosulfuric acid, S-(2-((1-methylheptyl)amino)ethyl) ester WR 1606
pdb file: 678055.pdb
sdf file: 678055.sdf
directory: 678055

19142-99-5 2-((4-Cyclohexylbutyl)amino)ethanethiol hydrogen sulfate (ester) BRN 2978395 Ethanethiol, 2-(4-cyclohexylbutyl)amino-, hydrogen sulfate (ester) NSC 348969 S-2-((4-Cyclohexylbutyl)amino)ethyl thiosulfate Thiosulfuric acid (H2S2O3), S-(2-((4-cyclohexylbutyl)amino)ethyl) ester (9CI)
pdb file: 678098.pdb
sdf file: 678098.sdf
directory: 678098

3'-Uridylic acid 84-53-7 EINECS 201-538-0 Uridine 3'-(dihydrogen phosphate)
pdb file: 678968.pdb
sdf file: 678968.sdf
directory: 678968

107-55-1 EINECS 203-501-4 O,O-Di-sec-butyl hydrogen dithiophosphate Phosphorodithioic acid, O,O-bis(1-methylpropyl) ester
pdb file: 679008.pdb
sdf file: 679008.sdf
directory: 679008

(1-Phenylpentyl) hydrogen succinate 1-Phenyl-1-hydroxy-n-pentane hemisuccinate ester 135-36-4 AF 434 BRN 2565324 EINECS 205-186-9 Emisuccinato dell' 1-fenil-1-idrossi-n-pentano [Italian] Succinic acid, alpha-butylbenzyl ester alpha-Butylbenzyl ester of succinic acid
pdb file: 679043.pdb
sdf file: 679043.sdf
directory: 679043

139-99-1 Aquarex SMO Aquarexat SMO EINECS 205-389-2 Methyl oleate, sulfated, sodium salt Octadecanoic acid, 9-(sulfooxy)-, 1-methyl ester, sodium salt Octadecanoic acid, 9-hydroxy-, methyl ester, hydrogen sulfate, sodium salt Sodium 1-methyl 9-(sulphooxy)octadecanoate
pdb file: 679047.pdb
sdf file: 679047.sdf
directory: 679047

576-42-1 D-Glucaric acid, monopotassium salt EINECS 209-402-2 Monopotassium D-glucarate Potassium acid saccharate Potassium bisaccharate Potassium hydrogen glucarate Potassium hydrogen saccharate potassium hydrogen D-glucarate
pdb file: 679223.pdb
sdf file: 679223.sdf
directory: 679223

2-Butenedioic acid (2Z)-, monopropyl ester 925-03-1 EINECS 213-111-6 Monopropyl maleate Propyl hydrogen maleate
pdb file: 679354.pdb
sdf file: 679354.sdf
directory: 679354

144011-44-9 144885-03-0 2-Butenedioic acid (2Z)-, mono(2-methylpropyl) ester 925-05-3 EINECS 213-112-1 Isobutyl hydrogen maleate Maleic acid, monoisobutyl ester
pdb file: 679355.pdb
sdf file: 679355.sdf
directory: 679355

2090-64-4 Carbonic acid, magnesium salt (2:1) EINECS 218-240-1 Magnesium bis(hydrogen carbonate)
pdb file: 679624.pdb
sdf file: 679624.sdf
directory: 679624

2-Butenedioic acid (2Z)-, mono-2-propenyl ester 2424-58-0 335600-31-2 Allyl hydrogen maleate EINECS 219-358-6
pdb file: 679684.pdb
sdf file: 679684.sdf
directory: 679684

2-Butenedioic acid (2Z)-, monocyclohexyl ester 2424-59-1 Cyclohexyl hydrogen maleate EINECS 219-359-1
pdb file: 679685.pdb
sdf file: 679685.sdf
directory: 679685

2-Butenedioic acid (2Z)-, monododecyl ester 2424-61-5 Dodecyl hydrogen maleate EINECS 219-360-7 Lauryl maleate (half ester) Monolauryl maleate
pdb file: 679686.pdb
sdf file: 679686.sdf
directory: 679686

2-Butenedioic acid (2Z)-, monooctadecyl ester 2424-62-6 EINECS 219-361-2 Monostearyl maleate Octadecyl hydrogen maleate
pdb file: 679687.pdb
sdf file: 679687.sdf
directory: 679687

1,3-Benzenedisulfonic acid, 4-((4-(ethylamino)-3-methylphenyl)(4-(ethylimino)-3-methyl-2,5-cyclohexadien-1-ylidene)methyl)-, monosodium salt 2650-17-1 EINECS 220-167-5 Sodium hydrogen 4-((4-(ethylamino)-m-tolyl)(4-(ethylimino)-3-methylcyclohexa-2,5-dien-1-ylidene)methyl)benzene-1,3-disulphonate
pdb file: 679726.pdb
sdf file: 679726.sdf
directory: 679726

551-75-7 608-89-9 91469-75-9 Butanedioic acid, 2,3-dihydroxy- (2R,3R)-, monoethyl ester EINECS 210-171-5 Ethyl hydrogen (R-(R*,R*))-tartrate Ethyl tartrate, acid
pdb file: 679910.pdb
sdf file: 679910.sdf
directory: 679910

2-(4-Nonyl)aminoethanethiol hydrogen sulfate (ester) 924-08-3 BRN 2368332 Ethanethiol, 2-((1-propylhexyl)amino)-, hydrogen sulfate (ester) Ethanethiol, 2-(4-nonyl)amino-, hydrogen sulfate (ester) Thiosulfuric acid, S-(2-((1-propylhexyl)amino)ethyl) ester WR 2386
pdb file: 679980.pdb
sdf file: 679980.sdf
directory: 679980

2-(4-Octyl)aminoethanethiol hydrogen sulfate (ester) 924-09-4 BRN 2366080 Ethanethiol, 2-((1-propylpentyl)amino)-, hydrogen sulfate (ester) Ethanethiol, 2-(4-octyl)amino-, hydrogen sulfate (ester) Thiosulfuric acid, S-(2-((1-propylpentyl)amino)ethyl) ester WR 2402
pdb file: 679981.pdb
sdf file: 679981.sdf
directory: 679981

2-(3-Octyl)aminoethanethiol hydrogen sulfate (ester) 924-19-6 BRN 2366284 Ethanethiol, 2-((1-ethylhexyl)amino)-, hydrogen sulfate (ester) Ethanethiol, 2-(3-octyl)amino-, hydrogen sulfate (ester) Thiosulfuric acid, S-(2-((1-ethylhexyl)amino)ethyl) ester WR 2246
pdb file: 679982.pdb
sdf file: 679982.sdf
directory: 679982

2-(3-Nonyl)aminoethanethiol hydrogen sulfate (ester) 924-20-9 BRN 2368339 Ethanethiol, 2-((1-ethylheptyl)amino)-, hydrogen sulfate (ester) Ethanethiol, 2-(3-nonyl)amino-, hydrogen sulfate (ester) Thiosulfuric acid, S-(2-((1-ethylheptyl)amino)ethyl) ester WR 2926
pdb file: 679983.pdb
sdf file: 679983.sdf
directory: 679983

2-(2-Nonyl)aminoethanethiol hydrogen sulfate (ester) 925-36-0 BRN 2368646 Ethanethiol, 2-((1-methyloctyl)amino)-, hydrogen sulfate (ester) Ethanethiol, 2-(2-nonyl)amino-, hydrogen sulfate (ester) Thiosulfuric acid, S-(2-((1-methyloctyl)amino)ethyl) ester WR 2709
pdb file: 679986.pdb
sdf file: 679986.sdf
directory: 679986

2530-33-8 Butanedioic acid, decyl- Decyl hydrogen succinate Decyl succinate Decylbutanedioic acid EINECS 219-783-7
pdb file: 680325.pdb
sdf file: 680325.sdf
directory: 680325

1,3,5-Triazine-2,4,6-triamine, compd. with molybdic acid (H4Mo8O26) (4:1) 1,3,5-Triazine-2,4,6-triamine, hexa-mu-oxotetra-mu3-oxodi-mu-5-oxotetradecaoxooctamolybdate(4-) (4:1) 65036-95-5 75757-97-0 EINECS 265-322-8 Melamine molybdate Molybdate (Mo8O264-), tetrahydrogen, compd. with 1,3,5-triazine-2,4,6-triamine (1:4) Molybdic acid (H4Mo8O26), compd. with 1,3,5-triazine-2,4,6-triamine (1:4) Tetrahydrogen molybdate, compound with 1,3,5-triazine-2,4,6-triamine (1:4)
pdb file: 680588.pdb
sdf file: 680588.sdf
directory: 680588

65138-73-0 Ammonium decyl hydrogen phosphate EINECS 265-502-6 Phosphoric acid, monodecyl ester, monoammonium salt
pdb file: 680736.pdb
sdf file: 680736.sdf
directory: 680736

2-Naphthalenesulfonic acid, 4-hydroxy-7-((((5-hydroxy-6-((2-methoxyphenyl)azo)-7-sulfo-2-naphthalenyl)amino)carbonyl)amino)-3-((6-sulfo-2-naphthalenyl)azo)-, tetrasodium salt 65186-16-5 EINECS 265-606-1 Tetrasodium hydrogen 7-((((6-((2-methoxyphenyl)azo)-5-oxide-7-sulphonato-2-naphthyl)amino)carbonyl)amino)-4-oxide-3-((6-sulphonato-2-naphthyl)azo)naphthalene-2-sulphonate
pdb file: 680788.pdb
sdf file: 680788.sdf
directory: 680788

1,2-Benzenedicarboxylic acid, 4-sulfo-, monoammonium salt 1,2-Dicarboxybenzene-4-sulfonate, ammonium salt 65229-11-0 Ammonium dihydrogen 4-sulphonatophthalate EINECS 265-643-3
pdb file: 680802.pdb
sdf file: 680802.sdf
directory: 680802

1,3,5-Triazine-2,4,6-triamine, compd. with molybdic acid (H2Mo2O7) (1:1) 1,3,5-Triazine-2,4,6-triamine, heptaoxodimolybdate(2-) (1:1) 65235-34-9 Dihydrogen molybdate, compound with 1,3,5-triazine-2,4,6-triamine (1:1) EINECS 265-649-6 Melamine molybdate (1:1) Molybdate (Mo2O72-), dihydrogen, compd. with 1,3,5-triazine-2,4,6-triamine (1:1)
pdb file: 680803.pdb
sdf file: 680803.sdf
directory: 680803

65520-42-5 Bis(2-(2-(2-butoxyethoxy)ethoxy)ethyl) hydrogen glutarate Dibutylcarbityl glutarate EINECS 265-805-3 Pentanedioic acid, bis(2-(2-(2-butoxyethoxy)ethoxy)ethyl) ester
pdb file: 680870.pdb
sdf file: 680870.sdf
directory: 680870

65573-09-3 Phenol, 4-(1-methylethyl)-, hydrogen phosphorodithioate Phosphorodithioic acid, O,O-bis(4-isopropylphenyl) ester
pdb file: 680879.pdb
sdf file: 680879.sdf
directory: 680879

65573-10-6 Phenol, 4-(1-methylethyl)-, hydrogen phosphorodithioate, sodium salt Phosphorodithioic acid, O,O-bis(4-isopropylphenyl) ester, sodium salt
pdb file: 680880.pdb
sdf file: 680880.sdf
directory: 680880

1H-Pyrazole-3-carboxylic acid, 4,5-dihydro-5-oxo-1-(4-sulfophenyl)-, monosodium salt 52126-51-9 EINECS 257-677-2 Sodium hydrogen 4,5-dihydro-5-oxo-1-(4-sulphonatophenyl)-1H-pyrazole-3-carboxylate
pdb file: 681514.pdb
sdf file: 681514.sdf
directory: 681514

183804-49-1 2-Naphthalenecarboxylic acid, 4-((4-chloro-5-methyl-2-sulfophenyl)azo)-3-hydroxy-, calcium salt (2:1) 52202-90-1 C.I. Pigment Red 52:1 Calcium dihydrogen bis(4-((4-chloro-6-sulphonato-m-tolyl)azo)-3-hydroxy-2-naphthoate) EINECS 257-731-5
pdb file: 681544.pdb
sdf file: 681544.sdf
directory: 681544

52221-06-4 AI3-06610 EINECS 257-751-4 Hexanedioic acid, mono(1-methylethyl) ester Isopropyl hydrogen adipate
pdb file: 681554.pdb
sdf file: 681554.sdf
directory: 681554

52435-04-8 EINECS 257-915-5 Phosphoric acid, mono(4-nitrophenyl) ester, compd. with 2-amino-2-(hydroxymethyl)-1,3-propanediol (1:1) p-Nitrophenyl dihydrogen phosphate, compound with 2-amino-2-(hydroxymethyl)propane-1,3-diol (1:1)
pdb file: 681620.pdb
sdf file: 681620.sdf
directory: 681620

52483-84-8 EINECS 257-949-0 Phosphoric acid, mono(4-nitrophenyl) ester, compd. with cyclohexanamine (1:2) Phosphoric acid, mono(4-nitrophenyl) ester, cyclohexanamine salt (1:2) p-Nitrophenyl dihydrogen phosphate, compound with cyclohexylamine (1:2)
pdb file: 681631.pdb
sdf file: 681631.sdf
directory: 681631

(S)-5-Oxo-1,2-pyrrolidinedicarboxylic acid, 1-(1,1-dimethylethyl) ester 1,2-Pyrrolidinedicarboxylic acid, 5-oxo-, 1-(1,1-dimethylethyl) ester, (2S)- 1-(tert-Butyl) hydrogen (S)-5-oxopyrrolidine-1,2-dicarboxylate 53100-44-0 EINECS 258-362-2
pdb file: 681825.pdb
sdf file: 681825.sdf
directory: 681825

2-Propenoic acid, 2-(phosphonooxy)-, monosodium salt 2-Propenoic acid, 2-phosphonoxy monosodium salt 53823-68-0 EINECS 258-810-7 Sodium hydrogen 2-(phosphonatooxy)acrylate
pdb file: 682029.pdb
sdf file: 682029.sdf
directory: 682029

7789-77-7 Calcium monohydrogen phosphate dihydrate Calcium phosphate, dibasic, dihydrate Dicalcium phosphate dihydrate Phosphoric acid, calcium salt (1:1), dihydrate
pdb file: 682244.pdb
sdf file: 682244.sdf
directory: 682244

129-51-1 6815-20-9 78207-84-8 9,10-Didehydro-N-((S)-2-hydroxy-1-methylethyl)-6-methylergoline-8beta-carboxamide maleate (1:1) (salt) 912-07-2 Cornocentin Crude ergot D-Ergonovine maleate EINECS 204-953-5 Ergoline-8-beta-carboxamide, 9,10-didehydro-N-((S)-2-hydroxy-1-methylethyl)-6-methyl-, maleate (1:1) (salt) Ergoline-8-carboxamide, 9,10-didehydro-N-((1S)-2-hydroxy-1-methylethyl)-6-methyl-, (8beta)-, (2Z)-2-butenedioate (1:1) (salt) Ergoline-8-carboxamide, 9,10-didehydro-N-(2-hydroxy-1-methylethyl)-6-methyl-, (8beta(S))-, (Z)-2-butenedioate (1:1) (salt) Ergomet Ergometrin maleate Ergometrine acid maleate Ergometrine hydrogen maleate Ergometrine maleate Ergometrine maleate (1:1) Ergonovine Maleate [USAN] Ergonovine hydrogen maleate Ergonovine maleate Ergonovine, maleate (1:1) Ergonovine, maleate (1:1) (salt) Ergotocin maleate Ergotrate Ermetrin Metriclavin NSC 93752 Oxytocic
pdb file: 682332.pdb
sdf file: 682332.sdf
directory: 682332

(gamma-S)ATP 35094-46-3 Adenosine 5'-(3-thio)triphosphate Adenosine 5'-(gamma-S)triphosphate Adenosine 5'-(trihydrogen diphosphate), monoanhydride with phosphorothioic acid Adenosine 5'-(trihydrogen diphosphate), p'-anhydride with phosphorothioic acid Adenosine 5'-O-(3-thiotriphosphate) Adenosine 5'-O-(gamma-thiotriphosphate) Adenosine 5'-thiotriphosphate Adenosine-5'-(3-thiotriphosphate) gamma-Thio-ATP
pdb file: 682399.pdb
sdf file: 682399.sdf
directory: 682399

113662-23-0 127000-20-8 Acide gadobenique [INN-French] Acido gadobenico [INN-Spanish] Acidum gadobenicum [INN-Latin] Gadobenic acid Gadolinate(2-), (4-carboxy-5,8,11-tris(carboxymethyl)-1-phenyl-2-oxa-5,8,11-triazatridecan-13-oato(5-)-N5,N8,N11,O4,O5,O8,O11,O13)-, dihydrogen
pdb file: 682612.pdb
sdf file: 682612.sdf
directory: 682612

65138-77-4 Ethanol, 2-(2-(tridecyloxy)ethoxy)-, dihydrogen phosphate Phosphoric acid, mono(2-(2-tridecyloxyethoxy)ethyl) ester
pdb file: 682676.pdb
sdf file: 682676.sdf
directory: 682676

65859-40-7 Benzenamine, 4-tert-dodecyl-, compd. with phosphoric acid, monomethyl ester (2:1) EINECS 265-949-7 Methyl dihydrogen phosphate, compound with 4-tert-dodecylaniline (1:2) Phosphoric acid, monomethyl ester, compd. with 4-tert-dodecylbenzenamine (1:2)
pdb file: 682702.pdb
sdf file: 682702.sdf
directory: 682702

2-(2-(2-(Dodecyloxy)ethoxy)ethoxy)ethyl hydrogen maleate 2-Butenedioic acid (2Z)-, mono(2-(2-(2-(dodecyloxy)ethoxy)ethoxy)ethyl) ester 66104-67-4 78601-00-0 EINECS 266-156-9 Maleic acid, mono(2-(2-(2-(dodecyloxy)ethoxy)ethoxy)ethyl) ester Mono(lauryl-triethyleneglycol ether) maleate
pdb file: 682757.pdb
sdf file: 682757.sdf
directory: 682757

67763-13-7 Dimethyl hydrogen phosphite, tert-dodecylamine salt Dimethyl phosphonate, compound with tert-dodecylamine (1:1) EINECS 267-036-9 Phosphonic acid, dimethyl ester, compd. with tert-dodecanamine (1:1)
pdb file: 683019.pdb
sdf file: 683019.sdf
directory: 683019

1,2,4-Benzenetricarboxylic acid, cobalt(2+) salt (1:1) 528-44-9 67801-57-4 Cobalt hydrogen benzene-1,2,4-tricarboxylate Cobalt trimellitate EINECS 267-177-6
pdb file: 683084.pdb
sdf file: 683084.sdf
directory: 683084

67815-66-1 7-Amino-4-hydroxy-8-((4-nitro-2-carboxyphenyl)azo)-2-naphthalenesulfonic acid, monosodium salt Benzoic acid, 2-((2-amino-5-hydroxy-7-sulfo-1-naphthalenyl)azo)-5-nitro-, monosodium salt EINECS 267-194-9 Sodium hydrogen 2-((2-amino-5-hydroxy-7-sulphonato-1-naphthyl)azo)-5-nitrobenzoate
pdb file: 683096.pdb
sdf file: 683096.sdf
directory: 683096

2-Butenedioic acid (2Z)-, mono-3,6,9,12,15,18-hexaoxaoctacos-1-yl ester 3,6,9,12,15,18-Hexoxaoctacosyl hydrogen maleate 67845-43-6 EINECS 267-313-4 Mono(beta-(decyloxy)penta(enthyleneoxy)ethyl) maleate
pdb file: 683168.pdb
sdf file: 683168.sdf
directory: 683168

67845-60-7 Dibutyl hydrogen phosphite, compound with methyl-1H-benzotriazole (1:1) Dibutyl hydrogen phosphonate, tolyltriazole salt EINECS 267-332-8 Phosphorous acid, dibutyl ester, compd. with methyl-1H-benzotriazole (1:1)
pdb file: 683176.pdb
sdf file: 683176.sdf
directory: 683176

67846-08-6 Diethyl hydrogen phosphate, compound with N-(2-((2-((carbamoyl)amino)ethyl)ethylamino)ethyl)octadecanamide (1:1) EINECS 267-354-8 Phosphoric acid, diethyl ester, compd. with N-(2-((2-((aminocarbonyl)amino)ethyl)ethylamino)ethyl)octadecanamide (1:1)
pdb file: 683188.pdb
sdf file: 683188.sdf
directory: 683188

67846-09-7 EINECS 267-355-3 Ethyl dihydrogen phosphate, compound with N,N-dimethyldodecylamine(1:1) Phosphoric acid, monoethyl ester, compd. with N,N-dimethyl-1-dodecanamine (1:1)
pdb file: 683189.pdb
sdf file: 683189.sdf
directory: 683189

1,2,4-Benzenetricarboxylic acid, 1,2-bis(phenylmethyl) ester 1,2-Dibenzyl hydrogen benzene-1,2,4-tricarboxylate 67846-10-0 EINECS 267-356-9
pdb file: 683190.pdb
sdf file: 683190.sdf
directory: 683190

67846-18-8 EINECS 267-362-1 Octyl dihydrogen phosphate, compound with N,N-dimethyloctadecylamine (1:1) Phosphoric acid, monooctyl ester, compd. with N,N-dimethyl-1-octadecanamine (1:1)
pdb file: 683195.pdb
sdf file: 683195.sdf
directory: 683195

67846-41-7 EINECS 267-364-2 Isopentyl octyl hydrogen phosphate, compound with 2-(dibutylamino)ethanol (1:1) Phosphoric acid, 3-methylbutyl octyl ester, dibutylethanolamine salt Phosphoric acid, mono(3-methylbutyl) monooctyl ester, compd. with 2-(dibutylamino)ethanol (1:1)
pdb file: 683198.pdb
sdf file: 683198.sdf
directory: 683198

2-Hydroxyethyl methyl hydrogen phosphate 67846-69-9 EINECS 267-383-6 Phosphoric acid, 2-hydroxyethyl methyl ester Phosphoric acid, mono(2-hydroxyethyl) monomethyl ester
pdb file: 683214.pdb
sdf file: 683214.sdf
directory: 683214

67873-98-7 Dimethylstearyl hydrogen ammonium diethyl phosphate Phosphoric acid, diethyl ester, compd. with N,N-dimethyl-1-octadecanamine (1:1)
pdb file: 683238.pdb
sdf file: 683238.sdf
directory: 683238

67873-99-8 Methyl distearyl hydrogen ammonium diethyl phosphate Phosphoric acid, diethyl ester, compd. with N-methyl-N-octadecyl-1-octadecanamine (1:1)
pdb file: 683239.pdb
sdf file: 683239.sdf
directory: 683239

67874-01-5 Di(2-hydroxyethyl) stearyl hydrogen ammonium diethyl phosphate Phosphoric acid, diethyl ester, compd. with 2,2'-(octadecylimino)bis(ethanol) (1:1)
pdb file: 683240.pdb
sdf file: 683240.sdf
directory: 683240

67874-53-7 EINECS 267-480-3 Octyl dihydrogen phosphate, compound with 2,2'-iminodiethanol Phosphated octyl alcohol, diethanolamine salt Phosphoric acid, monoctyl ester, diethanolmine salt Phosphoric acid, monoctyl ester, diethanolomine salt Phosphoric acid, monooctyl ester, compd. with 2,2'-iminobis(ethanol)
pdb file: 683265.pdb
sdf file: 683265.sdf
directory: 683265

67874-55-9 EINECS 267-482-4 Imidodisulfuric acid, methoxy-, monosodium salt Monosodium O-methylhydroxylamine-N,N-disulfonate Sodium dihydrogen methoxyimidodisulphate
pdb file: 683266.pdb
sdf file: 683266.sdf
directory: 683266

2-((2-Hydroxy-1-napthalenyl)azo)-1-naphthalenesulfonic acid, magnesium salt (2:1) 67893-11-2 Dihydrogen bis(2-((2-hydroxy-1-naphthyl)azo)naphthalene-1-sulphonato(2-))magnesate(2-) EINECS 267-614-0 Magnesate(2-), bis(2-((2-(hydroxy-kappaO)-1-naphthalenyl)azo-kappaN1)-1-naphthalenesulfonato(2-)-kappaO)-, dihydrogen
pdb file: 683343.pdb
sdf file: 683343.sdf
directory: 683343

1,3,5-Triallyl mellitate 1,3,5-Triallyl trihydrogen benzenehexacarboxylate 67952-51-6 Benzenehexacarboxylic acid, 1,3,5-tri-2-propenyl ester EINECS 267-904-7
pdb file: 683510.pdb
sdf file: 683510.sdf
directory: 683510

1-Pentanol, 4-methyl-, hydrogen phosphate, compd. with 2,2',2''-nitrilotris(ethanol) (1:1) 67953-26-8 Phosphoric acid, bis(4-methylpentyl) ester, compd. with tris(2-hydroxyethyl)amine (1:1)
pdb file: 683531.pdb
sdf file: 683531.sdf
directory: 683531

1-Nonanol, 8-methyl-, hydrogen phosphate 67953-31-5 Phosphoric acid, diisodecyl ester
pdb file: 683535.pdb
sdf file: 683535.sdf
directory: 683535

67969-86-2 Decyl dihydrogen phosphate, compound with 2-(dibutylamino)ethanol EINECS 267-988-5 Phosphoric acid, monodecyl ester, compd. with 2-(dibutylamino)ethanol Phosphoric acid, monodecyl ester, dibutylethanolamine salt
pdb file: 683550.pdb
sdf file: 683550.sdf
directory: 683550

3244-88-0 68109-73-9 Acid violet 19 Benzenesulfonic acid, 2-amino-5-((4-amino-3-sulfophenyl)(4-imino-3-sulfo-2,5-cyclohexadien-1-ylidene)methyl)-3-methyl-, diammonium salt Diammonium hydrogen 2-amino-4-((4-amino-3-sulphonatophenyl)(4-imino-3-sulphonatocyclohexa-2,5-dien-1-ylidene)methyl)toluene-3-sulphonate EINECS 268-486-9
pdb file: 683826.pdb
sdf file: 683826.sdf
directory: 683826

2,7-Naphthalenedisulfonic acid, 5-(acetylamino)-4-hydroxy-3-((3-phosphonophenyl)azo)-, disodium salt 5-(Acetylamino)-4-hydroxy-3-((3-phosphonophenyl)azo)-2,7-naphthalenedisulfonic acid, disodium salt 68110-24-7 89591-46-8 Disodium hydrogen 5-acetamido-4-hydroxy-3-((m-phosphonatophenyl)azo)naphthalene-2,7-disulphonate EINECS 268-512-9
pdb file: 683848.pdb
sdf file: 683848.sdf
directory: 683848

2,7-Naphthalenedisulfonic acid, 4-amino-3-((2,5-disulfophenyl)azo)-5-hydroxy-6-((3-phosphonophenyl)azo)-, tetrasodium salt 4-Amino-5-hydroxy-6-((3-phosphonophenyl)azo)-3-((2,5-disulfophenyl)azo)-2,7-naphthalenedisulfonic acid, tetrasodium salt 68110-25-8 EINECS 268-513-4 Tetrasodium hydrogen 4-amino-3-((2,5-disulphonatophenyl)azo)-5-hydroxy-6-((m-phosphonatophenyl)azo)naphthalene-2,7-disulphonate
pdb file: 683849.pdb
sdf file: 683849.sdf
directory: 683849

68110-43-0 Diisooctyl hydrogen phosphate, compound with 2,2',2''-nitrilotriethanol (1:1) EINECS 268-524-4 Phosphoric acid, diisooctyl ester, compd. with 2,2',2''-nitrilotris(ethanol) (1:1) Phosphoric acid, diisooctyl ester, triethanolamine salt
pdb file: 683857.pdb
sdf file: 683857.sdf
directory: 683857

68110-44-1 EINECS 268-526-5 Isooctyl dihydrogen phosphate, compound with 2,2',2''-nitrilotriethanol (1:2) Phosphoric acid, isooctyl ester, ditriethanolamine salt Phosphoric acid, monoisooctyl ester, compd. with 2,2',2''-nitrilotris(ethanol) (1:2)
pdb file: 683858.pdb
sdf file: 683858.sdf
directory: 683858

1,2-Benzenedicarboxylic acid, mono(1-methyl-2-((2-methyl-1-oxo-2-propenyl)oxy)ethyl) ester 1-Methyl-2-((2-methyl-1-oxoallyl)oxy)ethyl hydrogen phthalate 65859-45-2 EINECS 265-951-8 Methacryloxyisopropyl acid phthalate
pdb file: 683884.pdb
sdf file: 683884.sdf
directory: 683884

66161-60-2 Decyl hydrogen sulphate, compound with 1,1',1''-nitrilotripropan-2-ol EINECS 266-195-1 Sulfuric acid, monododecyl ester, compd. with 1,1',1''-nitrilotris(2-propanol) (1:1) TIPA-Lauryl sulfate Triisopropanolamine lauryl sulfate
pdb file: 683902.pdb
sdf file: 683902.sdf
directory: 683902

2-Ethylhexyl dihydrogen phosphate, compound with tert-dodecylamine 67763-14-8 EINECS 267-037-4 Mono(2-ethylhexyl)phosphate tert-dodecylamine salt Phosphoric acid, mono(2-ethylhexyl) ester, compd. with tert-dodecanamine
pdb file: 684008.pdb
sdf file: 684008.sdf
directory: 684008

(1-Methyl-2-((1-oxo-9-octadecenyl)amino)ethyl) hydrogen maleate 2-Butenedioic acid (2Z)-, mono(1-methyl-2-(((9Z)-1-oxo-9-octadecenyl)amino)ethyl) ester 67815-89-8 EINECS 267-201-5 Mono(2-oleoylamido-1-methylethyl)maleate
pdb file: 684058.pdb
sdf file: 684058.sdf
directory: 684058

2-Octadecyl-1-(2-(carbamyloxy)ethyl)imidazolium, monoethylphosphate 67815-94-5 EINECS 267-203-6 Ethyl dihydrogen phosphate, compound with 2-(2-octadecylimidazolidin-1-yl)ethyl carbamate (1:1) Phosphoric acid, monoethyl ester, compd. with 2-(2-octadecyl-1-imidazolidinyl)ethyl carbamate (ester) (1:1)
pdb file: 684060.pdb
sdf file: 684060.sdf
directory: 684060

1,3-Dimethylbutyl hydrogen phosphorodithioate, compound with (Z)-9-octadecen-1-amine (1:1) 2-Pentanol, 4-methyl-, hydrogen phosphorodithioate, compd. with (9Z)-9-octadecen-1-amine (1:1) 67892-36-8 EINECS 267-568-1 Phosphorodithioic acid, O,O-bis(1,3-dimethylbutyl)ester, oleylaminesalt
pdb file: 684150.pdb
sdf file: 684150.sdf
directory: 684150

1-(2-((2-Hydroxyethyl)anilino)ethyl) hydrogen 2-dodecenylsuccinate 67952-64-1 Butanedioic acid, dodecenyl-, 1-(2-((2-hydroxyethyl)phenylamino)ethyl) ester EINECS 267-917-8 Succinic acid, dodecenyl-, N-phenyldiethanolamine ester
pdb file: 684199.pdb
sdf file: 684199.sdf
directory: 684199

1-Nonanol, 8-methyl-, dihydrogen phosphate 67953-17-7 Phosphoric acid, monoisodecyl ester
pdb file: 684212.pdb
sdf file: 684212.sdf
directory: 684212

2-Ethylhexyl alcohol, phosphate, dipotassium salt 2-Ethylhexyl dihydrogen phosphate, dipotassium salt 67989-97-3 Dipotassium 2-ethylhexyl phosphate EINECS 268-022-5 Mono phosphate ester of 2-ethyl hexanol, dipotassium salt Phosphoric acid, mono(2-ethylhexyl) ester, dipotassium salt
pdb file: 684227.pdb
sdf file: 684227.sdf
directory: 684227

2-Ethylhexyl dihydrogen phosphate, compound with 2,2',2''-nitrilotriethanol (1:2) 2-Ethylhexyl dihydrogen phosphate, ditriethanolamine salt 68109-82-0 EINECS 268-493-7 Phosphoric acid, mono(2-ethylhexyl) ester, compd. with 2,2',2''-nitrilotris(ethanol) (1:2)
pdb file: 684309.pdb
sdf file: 684309.sdf
directory: 684309

2-Ethylhexyl hydrogen 3,3'-((phenylmethylene)bis(thio))dipropionate 68109-84-2 Bis(carboxyethane-2-thio)phenyl methylene, mono(2-ethylhexyl) ester EINECS 268-495-8 Propanoic acid, 3,3'-((phenylmethylene)bis(thio))bis-, mono(2-ethylhexyl) ester Propanoic acid, 3-((((2-carboxyethyl)thio)phenylmethyl)thio)-, 1-(2-ethylhexyl) ester
pdb file: 684310.pdb
sdf file: 684310.sdf
directory: 684310

( -)-Oxazepam hemisuccinate ( -)-Oxazepam succinate (7-Chloro-2,3-dihydro-2-oxo-5-phenyl-1H-benzo-1,4-diazepin-3-yl) hydrogen succinate (RS)-Oxazepam H 123632-29-1 24353-21-7 36406-19-6 36434-10-3 3693-18-3 4700-56-5 7-Chloro-1,3-dihydro-3-hemisuccinyloxy-2H-1,4-benzodiazepin-2-one BRN 0769233 Butanedioic acid, mono(7-chloro-2,3-dihydro-2-oxo-5-phenyl-1H-1,4-benzodiazepin-3-yl) ester EINECS 225-175-2 Empracil Nulans Oxazepam hemisuccinate Oxazepam succinate SAS 538 Succinic acid, monoester with 7-chloro-1,3-dihydro-3-hydroxy-5-phenyl-2H-1,4-benzodiazepin-2-one
pdb file: 684547.pdb
sdf file: 684547.sdf
directory: 684547

119797-12-5 Manganate(4-), ((N,N'-1,2-ethanediylbis(N-((3-hydroxy-2-methyl-5-((phosphonooxy)methyl)-4-pyridinyl)methyl)glycinato))(6-))-, tetrahydrogen Manganese dipyridoxyl diphosphate Manganese-dpdp Mn-Dpdp N,N'-Bis(pyridoxal-5-phosphate)ethylenediamine-N,N'-diacetic acid
pdb file: 684996.pdb
sdf file: 684996.sdf
directory: 684996

13058-04-3 2,6,10-Dodecatrien-1-ol, 3,7,11-trimethyl-, trihydrogen pyrophosphate Diphosphoric acid, mono(3,7,11-trimethyl-2,6,10-dodecatrienyl) ester Farnesol pyrophosphate Farnesyl diphosphate Farnesyl pyrophosphate Farnesyl trihydrogen pyrophosphate Farnesylpyrophosphate
pdb file: 685138.pdb
sdf file: 685138.sdf
directory: 685138

10049-23-7 15852-22-9 22451-06-5 Dihydrogen trioxotellurate EINECS 233-173-8 Telluric acid (H2TeO3) Tellurous acid
pdb file: 685292.pdb
sdf file: 685292.sdf
directory: 685292

15845-66-6 4-01-00-01329 (Beilstein Handbook Reference) BRN 0969557 Ethyl hydrogen phosphonate (9CI) Ethyl phosphite Ethyl phosphonate Fosetyl Monoethyl phosphite Monoethyl phosphonate Phosphonic acid, monoethyl ester TL 463
pdb file: 685295.pdb
sdf file: 685295.sdf
directory: 685295

2381-08-0 3-Sulfinoalanine Alanine 3-sulfinic acid Alanine, 3-sulfino- Cysteine hydrogen sulfite ester Cysteine sulfinate Cysteine sulfinic acid
pdb file: 685381.pdb
sdf file: 685381.sdf
directory: 685381

7632-05-5 7782-85-6 Disodium phosphate heptahydrate Phosphoric acid, disodium salt, heptahydrate Sodium monohydrogen phosphate heptahydrate (2:1:1:7) Sodium phosphate, diabasic, heptahydrate Sodium phosphate, dibasic, heptahydrate
pdb file: 685388.pdb
sdf file: 685388.sdf
directory: 685388

27470-51-5 3,5-Pyrazolidinedione, 4-butyl-4-(hydroxymethyl)-1,2-diphenyl-, hydrogen succinate (ester) 3-((4-Butyl-3,5-dioxo-1,2-diphenyl-4-pyrazolidinyl)methoxycarbonyl)propionsaeure 4-Butyl-4-(beta-carboxypropionyl-oxymethyl)-1,2-diphenyl-3,5-pyrazolidinedione 4-Butyl-4-(hydroxymethyl)-1,2-diphenyl-3,5-pyrazolidinedione hydrogen succinate (ester) 4-Butyl-4-hydroxymethyl-1,2-diphenyl-3,5-pyrazolidinedione hydrogen succinate 4-Hydroxymethylbutazolidine hemisuccinate AE 17 AE-17 Aflogan Alfide BRN 0904563 Butanedioic acid, mono((4-butyl-3,5-dioxo-1,2-diphenyl-4-pyrazolidinyl)methyl) ester (9CI) Calibene Danilon EINECS 248-477-6 Flamilon Flogos Solurol Succinic acid, monoester with 4-butyl-4-(hydroxymethyl)-1,2-diphenyl-3,5-pyrazolidinedione Suxibuzona [INN-Spanish] Suxibuzone Suxibuzone [INN:JAN] Suxibuzonum [INN-Latin]
pdb file: 685518.pdb
sdf file: 685518.sdf
directory: 685518

(+)-N-((1-Hydroxymethyl)propyl)-1-methyl-D-lysergamide bimaleate 1-(Hydroxymethyl)propylamide of 1-methyl-(+)-lysergic acid hydrogen maleate 1-Methyl-D-lysergic acid butanolamide dimaleate 1257-58-5 129-49-7 29605-96-7 32537-90-9 52502-68-8 87387-76-6 9,10-Didehydro-N-(1-(hydroxymethyl)propyl)-1,6-dimethylergoline-8beta-carboxamide maleate (1:1) (salt) Deseril Deseril-retard Desernil bismaleate EINECS 204-950-9 Ergoline-8-beta-carboxamide, 9,10-didehydro-N-(1-(hydroxymethyl)propyl)-1,6-dimethyl-, maleate (1:1) (salt) Ergoline-8-carboxamide, 9,10-didehydro-N-((1S)-1-(hydroxymethyl)propyl)-1,6-dimethyl-, (8beta)-, (2Z)-2-butenedioate (1:1) (salt) Ergoline-8-carboxamide, 9,10-didehydro-N-(1-(hydroxymethyl)propyl)-1,6-dimethyl-, (8beta)-, (Z)-2-butenedioate (1:1) (salt) Ergoline-8beta-carboxamide, 9,10-didehydro-N-(1-(hydroxymethyl)propyl)-1,6-dimethyl-, maleate (1:2) (salt) (8CI) Lysergamide, N-((1-hydroxymethyl)propyl)-1-methyl-, maleate Methysergide bimaleate Methysergide dimaleate Methysergide hydrogen maleate Methysergide maleate Methysergide maleate [USAN] NSC 186061 Sansert
pdb file: 685585.pdb
sdf file: 685585.sdf
directory: 685585

1,2-di-Olein 2-aminoethyl hydrogen phosphate 2462-63-7 9-Octadecenoic acid (9Z)-, 1-((((2-aminoethoxy)hydroxyphosphinyl)oxy)methyl)-1,2-etanediyl ester DOPEA Dioleoyl phosphatidylethanolamine Dioleoylphosphatidylethanolamine Dope cpd Olein, 1,2-di-, 2-aminoethyl hydrogen phosphate
pdb file: 685590.pdb
sdf file: 685590.sdf
directory: 685590

330-13-2 4-Nitrophenyl dihydrogen phosphate, sodium salt 54306-27-3 EINECS 259-088-6 Phosphoric acid, mono(4-nitrophenyl) ester, sodium salt
pdb file: 685929.pdb
sdf file: 685929.sdf
directory: 685929

1-Hydroxyethane-1,1-diphosphonic acid, tripotassium salt 60376-08-1 EINECS 262-203-2 Phosphonic acid, (1-hydroxyethylidene)bis-, tripotassium salt Tripotassium hydrogen (1-hydroxyethylidene)bisphosphonate
pdb file: 686282.pdb
sdf file: 686282.sdf
directory: 686282

2-Cyclohexene-1-octanoic acid, 5(or 6)-carboxy-4-hexyl-, potassium salt 5(6)-Carboxy-4-hexyl-2-cyclohexene-1-octanoic acid, potassium salt 68127-33-3 EINECS 268-571-0 Potassium C21-dicarboxylate Potassium acrylinoleate Potassium cyclocarboxypropyloleate Potassium hydrogen 5(or 6)-carboxylato-4-hexylcyclohex-2-ene-1-octanoate
pdb file: 686494.pdb
sdf file: 686494.sdf
directory: 686494

2-Cyclohexene-1-octanoic acid, 5(or 6)-carboxy-4-hexyl-, sodium salt 5(6)-Carboxy-4-hexyl-2-cyclohexene-1-octanoic acid, sodium salt 68127-35-5 EINECS 268-573-1 Sodium hydrogen 5(or 6)-carboxylato-4-hexylcyclohex-2-ene-1-octanoate omega-(5(6)-Carboxy-4-hexyl-2-cyclohexene)octanoate, sodium salt
pdb file: 686495.pdb
sdf file: 686495.sdf
directory: 686495

4-Tridecyl hydrogen 2-dodec-1-enylsuccinate 68140-46-5 Butanedioic acid, 1-dodecenyl-, 4-tridecyl ester EINECS 268-798-5 Monotridecyl 1-dodecenylsuccinate
pdb file: 686514.pdb
sdf file: 686514.sdf
directory: 686514

68155-99-7 Bis(2-ethylhexyl) hydrogen phosphate, compound with tert-dodecylamine (1:1) EINECS 268-996-1 Phosphoric acid, bis(2-ethylhexyl) ester, compd. with tert-dodecanamine (1:1) tert-Dodecylamine di-2-ethylhexyl phosphate
pdb file: 686542.pdb
sdf file: 686542.sdf
directory: 686542

68227-24-7 EINECS 269-338-6 Octyl dihydrogen phosphate, compound with 1-aminopropan-2-ol Phosphoric acid, monooctyl ester, compd. with 1-amino-2-propanol Phosphoric acid, monooctyl ester, isopropanolamine salt
pdb file: 686577.pdb
sdf file: 686577.sdf
directory: 686577