nucleic acid Molecules Structural Archive and Gallery

(Deoxyribonucleotide)m (Deoxyribonucleotide)n (Deoxyribonucleotide)n+m 9007-49-2 C00039 DNA DNAn DNAn+1 Deoxyribonucleic acid

(Ribonucleotide)m (Ribonucleotide)n (Ribonucleotide)n+m C00046 RNA RNA(linear) RNAn RNAn+1 Ribonucleic acid
pdb file: 3295.pdb
sdf file: 3295.sdf
directory: 3295

5'-UMP 5'-URIDYLIC ACID 5-24-06-00173 (Beilstein Handbook Reference) 53624-79-6 58-97-9 81795-92-8 BRN 0047486 EINECS 200-408-0 UMP UMP (nucleic acid) Uridine 5'-(dihydrogen phosphate) Uridine 5'-monophosphate Uridine 5'-phosphate Uridine 5'-phosphoric acid Uridine monophosphate Uridine phosphate Uridylic acid
pdb file: 148891.pdb
sdf file: 148891.sdf
directory: 148891

170274-79-0 Deoxyribonucleic acid, d(P-thio)(T-C-T-T-C-C-T-C-T-C-T-C-T-A-C-C-C-A-C-G-C-T-C-T-C), tetracosasodium salt GEM 91 Trecovirsen sodium Trecovirsen sodium [USAN]
pdb file: 215257.pdb
sdf file: 215257.sdf
directory: 215257

NSC169535 Nucleic acid, deoxyribo-, sodium salt, compd with 3,8-diamino-5-ethyl-6-phenylphenanthridinium chloride
pdb file: 442303.pdb
sdf file: 442303.sdf
directory: 442303

Deoxyribonucleic acid, sodium salt, from herring sperm, reaction product with dipotassium tetrachloroplatinate (2-) (SP-4-1) NSC175427
pdb file: 445468.pdb
sdf file: 445468.sdf
directory: 445468

Daunorubicin hydrochloride DNA NSC169533 Nucleic acid, deoxyribo-, sodium salt, compound with (8S-cis)-8-acetyl-10-[(3-amino-2,3,6-trideoxy-.alpha.-L-lyxo-hexopyranosyl)oxy]-7,8,9,10-tetrahydro-6,8,11-trihydroxy-1-methoxy-5,12-naphthacenedione hydrochloride
pdb file: 562792.pdb
sdf file: 562792.sdf
directory: 562792

Adriamycin-DNA hydrochloride NSC169534 Nucleic acid, deoxyribo-, sodium salt, compd. with (8S-cis)-10-[(3-amino-2,3,6-trideoxy-.alpha.-L-lyxo-hexopyranosyl)oxy]-7,8,9,10-tetrahydro-6,8,11-trihydroxy-8-(hydroxyacetyl)-1-methoxy-5,12-naphthacenedione hydrochloride Nucleic acid, deoxyribo-, sodium salt, compound with (8S-cis)-10-[(3-amino-2,3,6-trideoxy-.alpha.-L-lyxo-hexopyranosyl)oxy]-7,8,9,10-tetrahydro-6,8,11-trihydroxy-8-(hydroxyacetyl)-1-methoxy-5,12-naphthacenedione hydrochloride
pdb file: 562793.pdb
sdf file: 562793.sdf
directory: 562793

Deoxyribonucleic acid, sodium salt, from herring sperm, reaction product with (SP-4-2)-diamminedichloroplatinum NSC175426
pdb file: 563820.pdb
sdf file: 563820.sdf
directory: 563820

Actinomycin D, sodium deoxyribonucleic acid complex NSC191297
pdb file: 565029.pdb
sdf file: 565029.sdf
directory: 565029

Benzoic acid, [1-[4-[(3-amino-2,3,6-trideoxy-.alpha.-L-lyxo-hexopyranosyl)oxy]-1,2,3,4,6,11-hexahydro-2,5,12-trihydroxy-7-methoxy-6,11-dioxo-2-naphthacenyl]ethylidene]hydrazide, hydrochloride, (2S-cis)-, compd. with deoxyribonucleic acid sodium salt (1:9) NSC208737
pdb file: 566035.pdb
sdf file: 566035.sdf
directory: 566035

Deoxyribonucleic acid, sodium salt, from herring sperm, reaction product with (SP-4-2)-diamminedichloroplatinum NSC226990
pdb file: 567232.pdb
sdf file: 567232.sdf
directory: 567232

Deoxyribonucleic acid, sodium salt, from herring sperm, reaction product with (SP-4-2)-diamminedichloroplatinum NSC265472
pdb file: 569806.pdb
sdf file: 569806.sdf
directory: 569806

115004-45-0 5'- CmpC mpAAT TCT GAA AAT GGA TAmpA mpA -3' AIDS-000316 AIDS000316 Anti-TAT splice acceptor site DNA, d(C-P-deoxy-P-methyl-C-P-deoxy-P-methyl-A-A-T-T-C-T-G-A-A-A-A-T-G-G-A-T-A-P-deoxy-P-methyl-A-P-deoxy-P-methyl-A) Deoxyribonucleic acid, d(C-P-deoxy-P-methyl-C-P-deoxy-P-methyl-A-A-T-T-C-T-G-A-A-A-A-T-G-G-A-T-A-P-deoxy-P-methyl-A-P-deoxy-P-methyl-A)
pdb file: 594996.pdb
sdf file: 594996.sdf
directory: 594996

136088-27-2 AIDS-003064 AIDS003064 Cholestane, deoxyribonucleic acid deriv. Cholesteryl oligonucleotide Cholesteryl oligonucleotide(pTGGCGTACTCACCAGTCGCCGC) DNA, d(T-G-G-C-G-T-A-C-T-C-A-C-C-A-G-T-C-G-C-C-G-C), 5'-[(3.bETA.)-cholest-5-en-3-yl hydrogen phosphate]
pdb file: 597523.pdb
sdf file: 597523.sdf
directory: 597523

170274-79-0 5'-C spT spC spT spC spG spC spA spC spC spC spA spT spC spT spC spT spC spC spT spT spC spT-3' AIDS-029878 AIDS029878 Deoxyribonucleic acid, d (P-thio) (C-T-C-T-C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C-T-T-C-T), tetracosasodium salt GEM 91 GEM91 Gene expression modulator 91 Trecovirsen Sodium
pdb file: 612906.pdb
sdf file: 612906.sdf
directory: 612906

5'-pnG pnC pnT pnC pnC pnC pnG pnG pnG pnC pnT pnC pnG pnA pnC pnC-3' AIDS-070600 AIDS070600 Anti-TAR peptide nucleic acid oligonucleotide PNA Peptide Nucleic Acid (5'-GCTCCCGGGCTCGACC-3')
pdb file: 625953.pdb
sdf file: 625953.sdf
directory: 625953

185229-68-9 Alicaforsen DNA, d((R)-P-thio)(G-C-C-A-A-G-C-T-G-G-C-A-T-C-C-G-T-C-A) Deoxyribonucleic acid, d((R)-P-thio)(G-C-C-C-A-A-G-C-T-G-G-C-A-T-C-C-G-T-C-A) ISIS 2302 ISIS-2302 Intercellular adhesion molecule-1 antisense oligodeoxynucleotide
pdb file: 733437.pdb
sdf file: 733437.sdf
directory: 733437

139166-85-1 176026-19-0 203265-73-0 209534-83-8 256361-71-4 321219-01-6 Peptide nucleic acid, (H-T-T-T-T-T-T-T-T-T-T)-L-lys-NH2 Peptide nucleic acid, T10-lysine Pna H-T(10)-lys(NH2) Pna T10Lys T10Lys
pdb file: 741856.pdb
sdf file: 741856.sdf
directory: 741856