Google

deriv 6 Molecules Structural Archive and Gallery


C04629 Trimethylamine(alkyl-substituted derivatives)

pdb file: 7049.pdb
sdf file: 7049.sdf
directory: 7049


C06049 N-Formylderivatives

pdb file: 8096.pdb
sdf file: 8096.sdf
directory: 8096


2,2'-Disulfo-4,4'-stilbenediamine 2,2'-Stilbenedisulfonic acid, 4,4'-diamino- 4,4'-Diamino-2,2'-stilbenedisulfonic acid 81-11-8 Amsonic acid Benzene, 1,1'-(1,2-ethenediyl)bis-, diamino disulfo deriv. Benzenesulfonic acid, 2,2'-(1,2-ethenediyl)bis[5-amino- DASD Diamino stilbene disulfonic acid Flavonic acid NSC163 Tinopal BHS p,p'-Diaminodiphenylethylene-o,o'-disulfonic acid p,p'-Diaminostilbene-o,o'-disulfonic acid

pdb file: 50149.pdb
sdf file: 50149.sdf
directory: 50149


140-05-6 2-Methoxyethyl 12-acetoxy-9-octadecenoate 2-Methoxyethyl acetyl ricinoleate 9-Octadecenoic acid, 12-(acetyloxy)-, 2-methoxyethyl ester, [R-(Z)]- Ethylene glycol monomethyl ether acetylricinoleate Glycol monomethyl ether acetylricinoleate KP 120 Methoxyglycol acetyl ricinoleate Methyl Cellosolve acetylricinoleate NSC2199 Ricinoleic acid, 2-methoxyethyl ester, acetate Ricinoleic acid, acetyl methoxyglycol deriv. WLN: 1VOY6 & 2U8VO2O1

pdb file: 51932.pdb
sdf file: 51932.sdf
directory: 51932


77-58-7 Bis(lauroyloxy)di(n-butyl)stannane Butynorate DBTL Davainex Dibutyl-zinn-dilaurat Dibutylbis(laurato)tin Dibutylbis(lauroyloxy)tin Dibutylstannylene dilaurate Dibutyltin didodecanoate Dibutyltin dilaurate Dibutyltin laurate Dibutyltin n-dodecanoate Laudran di-n-butylcinicity Lauric acid, dibutylstannylene deriv. Lauric acid, dibutylstannylene salt Lauric acid, dibutyltin deriv. Mark 1038 NSC2607 Stabilizer D-22 Stanclere DBTL Stannane, bis(dodecanoyloxy) di-n-butyl- Stannane, bis(lauroyloxy)dibutyl- Stannane, dibutylbis(lauroyloxy)- Stannane, dibutylbis[(1-oxododecyl)oxy]- Stavinor 1200 SN T 12 T 12 (catalyst) TVS Tin Lau TVS-TL 700 Tin dibutyl dilaurate Tin, di-n-butyl-, di(dodecanoate) Tin, dibutylbis(lauroyloxy)- Tinostat WLN: 11VO-SN-4&4&OV11

pdb file: 52282.pdb
sdf file: 52282.sdf
directory: 52282


303-60-6 Benzo[g]pteridine, D-allitol deriv. Benzo[g]pteridine-2,4(3H,10H)-dione, 7,8-dimethyl-10-(D-galacto-2,3,4,5,6-pentahydroxyhexyl)- D-Allitol, 1-deoxy-1-(3,4-dihydro-7,8-dimethyl-2,4-dioxobenzo-[g]pteridin-10(2H)-yl)- GALACTOFLAVINE Isoalloxazine, 7,8-dimethyl-10-(D-allo-2,3,4,5,6-pentahydroxyhexyl)- Isoalloxazine, 7,8-dimethyl-10-(D-galacto-2,3,4,5,6-pentahydroxyhexyl)- NSC3099

pdb file: 52676.pdb
sdf file: 52676.sdf
directory: 52676


1,2-Dihydro-2,2,4-trimethylquinoline 147-47-7 2,2,4-Trimethyl-1,2-dihydroquinoline 2,2,4-Trimethyl-1,2-dihydroquinone Acetonanil Acetone anil Acetone anil (quinoline derivative) Flectol H NSC4175 Quinoline, 1,2-dihydro-2,2,4-trimethyl- WLN: T66 BM CHJ C1 C1 E1

pdb file: 53598.pdb
sdf file: 53598.sdf
directory: 53598


1127-68-0 CYCLOPENTANEACETIC ACID DERIV NSC7496

pdb file: 56391.pdb
sdf file: 56391.sdf
directory: 56391


6293-80-7 ERYTHROMYCIN, O-SULFOBENZOYL DERIV Erythromycin, o-sulfobenzoyl deriv. NSC9162 o-Sulfobenzoylerythromycin

pdb file: 57736.pdb
sdf file: 57736.sdf
directory: 57736


3,4-Dibenzoylfuroxan 6635-54-7 Dibenzoylfuroxan Dibenzoylfuroxane Furazan (8CI), dibenzoyl-, 2-oxide Furazan (9CI), methanone deriv. Methanone (9CI), 3,4-furazandiylbis(phenyl-, N-oxide NSC18870

pdb file: 81828.pdb
sdf file: 81828.sdf
directory: 81828


1524-86-3 2H-Naphth[2',1':4,5]indeno[1,2-d][1,3]dioxole, pregn-4-ene-3,20-dione deriv. Corticosterone, 9-fluoro-16.alpha.,17-(isopropylidenedioxy)- NSC21915 Pregn-4-ene-3,20-dione, 9-fluoro-11,21-dihydroxy-16,17-[(1-methylethylidene)bis(oxy)-, (11.beta.,16.alpha.)- Pregn-4-ene-3,20-dione, 9-fluoro-11.beta.,16.alpha.,17,21-tetrahydroxy-, cyclic 16,17-acetal with acetone Pregn-4-ene-3,20-dione, 9-fluoro-11.beta.,21-dihydroxy-16.alpha.,17-(isopropylidenedioxy)-

pdb file: 84205.pdb
sdf file: 84205.sdf
directory: 84205


DIOXOLO QUINOLINE-7-CARBOXYLIC ACID DERIV NSC26704

pdb file: 87509.pdb
sdf file: 87509.sdf
directory: 87509


1,3,5,2,4,6-Triazatriphosphorine, 2,2,4,4,6,6-hexakis(1-aziridinyl)-2,2,4,4,6,6-hexahydro- 1-Aziridinylphosphonitrile trimer 2,2,4,4,6,6-Hexahydro-2,2,4,4,6,6-hexakis(1-aziridinyl)-1,3,5,2,4,6-triazatriphosphorine 2,2,4,4,6,6-Hexakis(1-aziridinyl)-2,2,4,4,6,6-hexahydro-1,3,5,2,4,6-triazatriphosphorine 2,2,4,4,6,6-Hexakis(1-aziridinyl)cyclotriphosphaza-1,3,5-triene 52-46-0 APN Apholate Aziridine, 1,3,5,2,4,6-triazatriphosphorine derivative CB 40068 ENT 26,316 ENT 26316 Hexa(1-aziridinyl)-1,3,5-phosphotriazine Hexa(1-aziridinyl)triphosphatriazine Hexa(1-aziridinyl)triphosphotriazine Hexakis (1-aziridinyl)phosphonitrilate Hexakis(aziridinyl)phosphotriazine NSC-26812 NSC26812 Olin mo. 2174 Pholate SQ 8388 WLN: T6NPNPNPJ B- AT3NTJ& B- AT3NTJ& D- AT3NTJ& D- AT3NTJ& F- AT3NTJ& F- AT3NTJ

pdb file: 87565.pdb
sdf file: 87565.sdf
directory: 87565


27868-07-1 Lanost-8-en-3.beta.-ol, 24,25-dibromo-, acetate Lanosta-8,24-dien-3.beta.-ol, acetate, dibromo deriv. Lanosteryl acetate dibromide NSC34203

pdb file: 91962.pdb
sdf file: 91962.sdf
directory: 91962


6273-79-6 Furo[3,2-b]furan-2,5-dione, 3,6-diphenyl- MUCONIC ACID DERIV NSC35419 Pulvic di-.gamma.-lactone Pulvic dilactone Pulvinic acid lactone Pulvinic anhydride Pulvinic dilactone

pdb file: 92523.pdb
sdf file: 92523.sdf
directory: 92523


2H-Benzo[a]quinolizine, 3-ethyl-1,3,4,6,7,11b-hexahydro-9,10-dimethoxy-2-[(1,2,3,4-tetrahydro-6,7-dimethoxy-1-isoquinolyl)methyl]-, compd. with Bi(III)I3 Bismuth, triiodo(6',7',10,11-tetramethoxyemetan)- EMETINE, CMPD WITH BISMUTH (III) EMETINE, COMPOUND WITH BISMUTH III Emetine, bismuth iodide derivative Emetine, compd. with Bi(III)I3 Emetine, compd. with BiI3 Emetinetriiodobismuth(III) NSC44185

pdb file: 98401.pdb
sdf file: 98401.sdf
directory: 98401


16091-70-6 HEPTANOIC ACID LACTONE DERIV HEPTANOIC ACID, DL-3-(1-HYDROXY-1-METHLETHYL)-6-OXO, NSC45645

pdb file: 99229.pdb
sdf file: 99229.sdf
directory: 99229


17-.beta.-hydroxy-17-methyl-4-oxa-5-.alpha.-androstan-3-one 1H-Benz[e]indene-6-propionic acid, dodecahydro-3,7-dihydroxy-3,3a,6-trimethyl-, .delta.-lactone 3,5-Seco-A-nor-5.alpha.-androstan-3-oic acid, 5,17.beta.-dihydroxy-17-methyl-, .delta.-lactone 4-Oxa-5.alpha.-androstan-3-one, 17.beta.-hydroxy-17-methyl- 4-Oxaandrostan-3-one, 17-hydroxy-17-methyl-, (5.alpha.,17.beta.)- 4-oxaandrostan-3-one deriv. of Cyclopenta[5,6]naphtho[2,1-b]pyran 4424-45-7 NSC63294

pdb file: 109988.pdb
sdf file: 109988.sdf
directory: 109988


1H-Naphth[2',1':4,5]indeno[2,1-b]furan, pregn-17(20)-en-21-oic acid deriv. 337-67-7 5.alpha.-Pregn-17(20)-en-21-oic acid, 3.beta.,16.beta.-dihydroxy-11-oxo-, .gamma.-lactone 5.alpha.-Pregn-17(20)-en-21-oic acid, 3.beta.,16.beta.-dihydroxy-11-oxo-,-lactone NSC66816 Pregn-17(20)-en-21-oic acid, 3,16-dihydroxy-11-oxo-, .gamma.-lactone, (3.beta.,5.alpha.,16.beta.)-

pdb file: 111697.pdb
sdf file: 111697.sdf
directory: 111697


1-Piperidinecarbodithioic acid, S-piperidino deriv 6250-27-7 N,N'-Bis(pentamethylene)thiocarbamoylsulfenamide NSC71123 Pentamethyleneammonium N,N-pentamethylenedithiocarbamate Piperidine cyclopentamethylenedithiocarbamate Piperidine, 1-[(1-piperidinylthioxomethyl)thio]- Piperidine, 1-[(piperidinothiocarbonyl)thio]- Piperidine, 1-mercapto-, 1-piperidinecarbodithioate Piperidyl pentamethylenedithiocarbamate Vulkacit P

pdb file: 114234.pdb
sdf file: 114234.sdf
directory: 114234


2149-76-0 5-Aminouridine 5-Aminouridine, alkylidene derivs. NSC72560 Uridine, 5-amino-

pdb file: 115212.pdb
sdf file: 115212.sdf
directory: 115212


7791-71-1 Monotritylthymidine NSC75113 Thymidine, 5'-O-(triphenylmethyl)- Thymidine, trityl deriv

pdb file: 116807.pdb
sdf file: 116807.sdf
directory: 116807


16985-78-7 4H-Pyran-4-one, 5-hydroxy-2-(hydroxymethyl)-, vanadyl deriv. NSC79528 Vanadium, oxobis(5-hydroxy-2-(hydroxymethyl)-4H-pyran-4-onato)- Vanadium, oxobis[(6-hydroxymethyl)-4-oxo-4H-pyran-3-yl]oxy]-

pdb file: 119478.pdb
sdf file: 119478.sdf
directory: 119478


16505-91-2 2H-Thiopyran, D-glucopyranose deriv. 5-Thio-D-glucopyranose D-glucopyranose, 5-thio- Glucopyranose, 5-thio, D- NSC204984

pdb file: 124689.pdb
sdf file: 124689.sdf
directory: 124689


1,3-Dithiane, urea deriv. 60285-33-8 NSC207115 Urea, N-(2-chloroethyl)-N'-(2-methyl-1,3-dithian-5-yl)-N-nitroso-, S,S,S',S'-tetraoxide, trans-

pdb file: 125568.pdb
sdf file: 125568.sdf
directory: 125568


116-49-4 Amoebicon Arsanilic acid, N-glycoloyl-, bismuth deriv Bismuth glycolyl arsanilate Bismuth p-glycolylaminophenylarsonate Bismuth p-glycolylarsanilate Bismuth, (hydrogen N-glycoloylarsanilato)oxo- Bismuth, [[4-[(hydroxyacetyl)amino]phenyl]arsonato(1-)]oxo- Bismuthoxy-p-N-glycolylarsanilate Bismuthyl N-glycolylarsanilate Broxolin Chemo Puro Dysentulin Glycobiarsol Milibis NSC221709 Viasept Wintodon [[4-[(HYDROXYACETYL)AMINO]PHENYL]ARSONATO(1-)OXOBISMUTH

pdb file: 130484.pdb
sdf file: 130484.sdf
directory: 130484


LU-22506 NORFORMYCIN DERIV NSC226650 WIN 35116

pdb file: 131702.pdb
sdf file: 131702.sdf
directory: 131702


NORFORMYCIN DERIV NSC226659 WIN 35693

pdb file: 131703.pdb
sdf file: 131703.sdf
directory: 131703


1491-41-4 1H-Benz[de]isoquinoline-1,3(2H)-dione, 2-[(diethoxyphosphinyl)oxy]- B-9002 BAY 9002 Bayer 25820 Bayer 9002 Bayer S-940 Bayer S940 E 9002 ENT 25,567 ENT-25567 Maretin N-Hydroxynaphthalimide diethyl phosphate N-Hydroxynaphthylimide diethyl phosphate NSC229795 Naftalofos Naphthalimide, N-hydroxy-, diethyl phosphate Naphthalophos O,O-Diethyl N-hydroxynaphthalimide phosphate Phosphoric acid, diethyl ester, N-naphthalimide deriv. Phosphoric acid, diethyl ester, naphthalimido deriv. Phtalophos Rametin Rawetin S 940 S-940 WLN: T666 1A M CVNVJ DOPO&O2&O2

pdb file: 132609.pdb
sdf file: 132609.sdf
directory: 132609


CYSTEINE DERIV L-Cysteine, N-[N-[N-[(phenylmethoxy)carbonyl]-.beta.-alanyl]-S-(phenylmethyl)-L-cysteinyl]-S-(triphenylmethyl)-, methyl ester NSC234762

pdb file: 133724.pdb
sdf file: 133724.sdf
directory: 133724


1H-Dibenzo[de,h]quinoline, 9-[4,5-dimethoxy-2-[(1,2,3,4-tetrahydro-6,7-dimethoxy-2-methyl-1-isoquinolinyl)methyl]phenoxy]-2,3,7,11b-tetrahydro-5,6-dimethoxy-1-methyl-, [R-(R*,R*)]- DIBENZOQUINLINE DERIV 105AAA NSC235761

pdb file: 133813.pdb
sdf file: 133813.sdf
directory: 133813


DIBENZOQUINOLINE DERIV 105AAB NSC236085

pdb file: 133853.pdb
sdf file: 133853.sdf
directory: 133853


55726-47-1 BEHENOYL-ARABINOFURANOSYL-CYTOSINE BH-AC BHAC DOCOSANAMIDE,NUCLEOSIDE DERIV Docosanamide, N-(1-.beta.-D-arabinofuranosyl-1,2-dihydro-2-oxo-4-pyrimidinyl)- Enocitabine N4-BEHENOYL-1-B-D-ARABINOSYLCYTOSINE NSC239336 SUNRABIN

pdb file: 134247.pdb
sdf file: 134247.sdf
directory: 134247


2,7-(Epoxypentadeca[1,11,13]trienimino)naphtho[2,1-b]furan, rifamycin deriv. 51757-10-9 NSC239375 Rifamycin, 1,4-dideoxy-1,4-dihydro-1,4-dioxo-, 21-formate

pdb file: 134260.pdb
sdf file: 134260.sdf
directory: 134260


4,24-Dioxa-9,22-diazatetracyclo[19.3.1.110,14.03,5]hexacosane, maytansine deriv. 57103-69-2 Ansamitocin P-1 MAYTANACINE Maytansine, O3-acetyl-O3-de[2-(acetylmethylamino)-1-oxopropyl]- NSC239387

pdb file: 134267.pdb
sdf file: 134267.sdf
directory: 134267


1492-93-9 4'-[BIS(2-CHLOROETHYL)AMINO]-2-FLUOROACETANILIDE 4'-[Bis(2-chloroethyl)amino]-2-fluoroacetanidide Acetamide, N-[4-[bis(2-chloroethyl)amino]phenyl]-2-fluoro- Acetanilide, 4'-[bis(2-chloroethyl)amino]-2-fluoro- NSC240362 WLN: G2N2GR DMV1F p-Fluoroacetylaminophenyl derivative of nitrogen mustard

pdb file: 134402.pdb
sdf file: 134402.sdf
directory: 134402


20826-80-6 NORFORMIN DERIV NSC244445 WIN 34997

pdb file: 135782.pdb
sdf file: 135782.sdf
directory: 135782


NORFORMIN DERIV NSC244446 WIN 35147

pdb file: 135783.pdb
sdf file: 135783.sdf
directory: 135783


(5-Butyl-2-benzimidazole)carbamic acid methyl ester 14255-87-9 2-Benzimidazolecarbamic acid, 5-butyl-, methyl ester 2H-Benzimidazole, carbamic acid deriv. 5-Butyl-2-(carbomethoxyamino)benzimidazole Carbamic acid, (5-butyl-1H-benzimidazol-2-yl)-, methyl ester Helatac Helmatac Methyl 5(6)-butyl-2-benzimidazolecarbamate Methyl 5-butyl-2-benzimidazolecarbamate Methyl 5-butylbenzimidazole-2-carbamate NSC256420 Parbendazole SK&F 29044 SKF 29044 WLN: T56 BM DNJ CMVO1 G4 Worm Guard

pdb file: 138433.pdb
sdf file: 138433.sdf
directory: 138433


2H-1,3,2-Oxazaphosphorine, hydroperoxide deriv. 39800-25-4 4-Hydroperoxytrilophosphamide Hydroperoxide, 2-[bis(2-chloroethyl)amino]-3-(2-chloroethyl)tetrahydro-2H-1,3,2-oxazaphosphorin-4-yl, P-oxide NSC260608

pdb file: 138956.pdb
sdf file: 138956.sdf
directory: 138956


59086-90-7 Euphorbia esula, ingenol derivative INGENOL DIBENZOATE Ingenol 3,20-dibenzoate NSC262646

pdb file: 139226.pdb
sdf file: 139226.sdf
directory: 139226


59086-90-7 Euphorbia esula, ingenol derivative Ingenol 3,20-dibenzoate NSC266220

pdb file: 140063.pdb
sdf file: 140063.sdf
directory: 140063


(+)-Simalikalactone D 2H-3,11c-(Epoxymethano)phenanthro[10,1-bc]pyran,picras-3-ene-2,16-dione deriv. 35321-80-3 NSC266494 Picras-3-ene-2,16-dione, 13,20-epoxy-1,11,12- trihydroxy-15-(2-methyl-1-oxobutoxy)-,[1.beta.,11.beta.,12.alpha.,15.beta.(R)]- SIMALIKALACTONE D Similikalactone D

pdb file: 140187.pdb
sdf file: 140187.sdf
directory: 140187


1-Naphthacenecarboxylic acid, 2-ethyl-1,2,3,4,6,11-hexahydro-2,5,7,10-tetrahydroxy-6,11-dioxo-4-[[2,3,6-trideoxy-3-(dimethylamino)-.alpha.-L-lyxo-hexopyranosyl]oxy]-, methyl ester, hydrochloride, monosaccharide deriv. 1-Naphthacenecarboxylic acid, 2-ethyl-1,2,3,4,6,11-hexahydro-2,5,7,10-tetrahydroxy-6,11-dioxo-4-[[2,3,6-trideoxy-3-(dimethylamino)-4-O-glycosyl-.alpha.-L-lyxo-hexopyranosyl]oxy]-, methyl ester, hydrochloride ANTHRACYCLINE DERIV CL 86-5 HCl CL-86-S hydrochloride NSC267695

pdb file: 140428.pdb
sdf file: 140428.sdf
directory: 140428


NSC267712 RESIBUFOGENIN, METHACRYLATE DERIV

pdb file: 140439.pdb
sdf file: 140439.sdf
directory: 140439


76675-88-2 BUFADIENOLIDE DERIV NSC267900

pdb file: 140447.pdb
sdf file: 140447.sdf
directory: 140447


76685-42-2 BUFADIENOLIDE DERIV NSC267901

pdb file: 140448.pdb
sdf file: 140448.sdf
directory: 140448


BUFADIENOLIDE DERIV NSC267902

pdb file: 140449.pdb
sdf file: 140449.sdf
directory: 140449


76675-89-3 BUFADIENOLIDE DERIV NSC267903

pdb file: 140450.pdb
sdf file: 140450.sdf
directory: 140450


76675-90-6 BUFADIENOLIDE DERIV NSC267904

pdb file: 140451.pdb
sdf file: 140451.sdf
directory: 140451


76675-91-7 BUFADIENOLIDE DERIV NSC267905

pdb file: 140452.pdb
sdf file: 140452.sdf
directory: 140452


76675-92-8 BUFADIENOLIDE DERIV NSC267906

pdb file: 140453.pdb
sdf file: 140453.sdf
directory: 140453


BUFADIENOLIDE DERIV NSC267908

pdb file: 140454.pdb
sdf file: 140454.sdf
directory: 140454


2,5-Cyclohexadien-1-one, 2,5-dimethoxy-4-(3-phenyl-2-propenylidene)- 2,5-Dimethoxy-4-(3-phenylpropenylidene)-2,5-cyclohexadienone 37775-60-3 NSC269108 OBTUSAQUINONE DERIV JURD 2068

pdb file: 140756.pdb
sdf file: 140756.sdf
directory: 140756


NSC269109 OBTUSAQUINONE DERIV JURD 2293

pdb file: 140757.pdb
sdf file: 140757.sdf
directory: 140757


62745-66-8 NSC269110 OBTUSAQUINONE DERIV JURD 2371

pdb file: 140758.pdb
sdf file: 140758.sdf
directory: 140758


89504-49-4 NSC269111 OBTUSAQUINONE DERIV JURD 2272

pdb file: 140759.pdb
sdf file: 140759.sdf
directory: 140759


NSC269112 OBTUSAQUINONE DERIV JURD 2289

pdb file: 140760.pdb
sdf file: 140760.sdf
directory: 140760


NSC269113 OBTUSAQUINONE DERIV JURD 2587

pdb file: 140761.pdb
sdf file: 140761.sdf
directory: 140761


NSC269114 OBTUSAQUINONE DERIV JURD 2105

pdb file: 140762.pdb
sdf file: 140762.sdf
directory: 140762


67264-20-4 NSC269115 OBTUSAQUINONE DERIV JURD 2287

pdb file: 140763.pdb
sdf file: 140763.sdf
directory: 140763


63194-69-4 NSC269116 OBTUSAQUINONE DERIV JURD 2155

pdb file: 140764.pdb
sdf file: 140764.sdf
directory: 140764


51167-48-7 NSC269117 OBTUSAQUINONE DERIV JURD 2154

pdb file: 140765.pdb
sdf file: 140765.sdf
directory: 140765


24126-85-0 NSC269119 OBTUSAQUINONE DERIV JURD 1824

pdb file: 140767.pdb
sdf file: 140767.sdf
directory: 140767


24126-88-3 NSC269120 OBTUSAQUINONE DERIV JURD 1830

pdb file: 140768.pdb
sdf file: 140768.sdf
directory: 140768


72590-07-9 NSC269124 OBTUSAQUINONE DERIV JURD 2358

pdb file: 140772.pdb
sdf file: 140772.sdf
directory: 140772


66092-34-0 NSC269125 OBTUSAQUINONE DERIV JURD 2359

pdb file: 140773.pdb
sdf file: 140773.sdf
directory: 140773


72590-24-0 NSC269126 OBTUSAQUINONE DERIV JURD 2561

pdb file: 140774.pdb
sdf file: 140774.sdf
directory: 140774


72590-26-2 NSC269127 OBTUSAQUINONE DERIV JURD 2562

pdb file: 140775.pdb
sdf file: 140775.sdf
directory: 140775


63194-78-5 NSC269128 OBTUSAQUINONE DERIV JURD 2337

pdb file: 140776.pdb
sdf file: 140776.sdf
directory: 140776


63194-80-9 NSC269129 OBTUSAQUINONE DERIV JURD 2351

pdb file: 140777.pdb
sdf file: 140777.sdf
directory: 140777


71712-07-7 NSC269130 OBTUSIQUINONE DERIV JURD 2335

pdb file: 140778.pdb
sdf file: 140778.sdf
directory: 140778


59895-54-4 NSC269131 OBTUSIQUINONE DERIV JURD 2280

pdb file: 140779.pdb
sdf file: 140779.sdf
directory: 140779


2270-41-9 ANGUIDINE DERIV SCIRPENTRIOL BL 5731 NSC269142 Scirpene-3,4,15-triol Trichothec-9-ene-3,4,15-triol, 12,13-epoxy-, (3.alpha.,4.beta.)-

pdb file: 140789.pdb
sdf file: 140789.sdf
directory: 140789


61251-97-6 B5 B800157K386 BACCHARIN NSC269757 Trichothecene deriv. Verrucarin A, 7'-deoxo-2'-deoxy-2',3':9,10-diepoxy-9,10-dihydro-4'-hydroxy-7'-(1-hydroxyethyl)-

pdb file: 140916.pdb
sdf file: 140916.sdf
directory: 140916


5.beta.-Ergosta-2,24-dien-26-oic acid, 5,6.beta.-epoxy-4.beta.,22,27-trihydroxy-1-oxo-, .delta.-lactone, (20S,22R)- 5119-48-2 Ergosta-2,24-dien-26-oic acid, 5,6-epoxy-4,22,27-trihydroxy-1-oxo-, .delta.-lactone, (4.beta.,5.beta.,6.beta.,22R)- NSC273757 WITHAFERIN DERIV JPR, IOWA U. COMPOUND Withaferin A

pdb file: 141790.pdb
sdf file: 141790.sdf
directory: 141790


70259-92-6 METHYLENEBUTYROLACTAMS DERIV JS-I-87 NSC276424

pdb file: 142149.pdb
sdf file: 142149.sdf
directory: 142149


70259-90-4 METHYLENEBUTYROLACTAMS DERIV NSC276425

pdb file: 142150.pdb
sdf file: 142150.sdf
directory: 142150


70259-94-8 METHYLENEBUTYROLACTAMS DERIV NSC276426

pdb file: 142151.pdb
sdf file: 142151.sdf
directory: 142151


70259-91-5 METHYLENEBUTYROLACTAMS DERIV GP-4 NSC276427

pdb file: 142152.pdb
sdf file: 142152.sdf
directory: 142152


70259-93-7 METHYLENEBUTYROLACTAMS DERIV NSC276428

pdb file: 142153.pdb
sdf file: 142153.sdf
directory: 142153


70259-95-9 METHYLENEBUTYROLACTAMS DERIV NSC276429

pdb file: 142154.pdb
sdf file: 142154.sdf
directory: 142154


70259-96-0 METHYLENEBUTYROLACTAMS DERIV NSC276430

pdb file: 142155.pdb
sdf file: 142155.sdf
directory: 142155


70259-97-1 METHYLENEBUTYROLACTAMS DERIV NSC276431

pdb file: 142156.pdb
sdf file: 142156.sdf
directory: 142156


70259-57-3 METHYLENEBUTYROLACTAMS DERIV JS-II-9 NSC276432

pdb file: 142157.pdb
sdf file: 142157.sdf
directory: 142157


3,4-Diacetoxyscirpen-15-ol 6200-90-4 ANGUIDINE DERIV (3,4-DIACETOXYSCIRPNE-15-OL) NSC283150

pdb file: 143782.pdb
sdf file: 143782.sdf
directory: 143782


74560-38-6 NSC283445 Spiro(3,5-methano-14H,20H,21H-oxireno[h][1,6,12]trioxacyclooctadecino[3,4-d][1]benzopyran-4(3H),2'-oxirane), verrucarin A deriv. VERRUCARIN A, 9,10-EPOXIDE Verrucarin A 9,10-epoxide Verrucarin A, 9,10-epoxy-9,10-dihydro-, (9R,10S)-

pdb file: 143816.pdb
sdf file: 143816.sdf
directory: 143816


79298-09-2 NSC284621 STRIGOL DERIV

pdb file: 143992.pdb
sdf file: 143992.sdf
directory: 143992


1-Naphthacenecarboxylic acid, 2-ethyl-1,2,3,4,6,11-hexahydro-2,5,7,10-tetrahydroxy-6,11-dioxo-4-[[2,3,6-trideoxy-3-(dimethylamino)-4-O-glycosyl-.alpha.-L-lyxo-hexopyranosyl]oxy]-, methyl ester, hydrochloride ANTHRACYCLINE DERIV CL 86-5 HCl CL-86-S hydrochloride NSC284671

pdb file: 144001.pdb
sdf file: 144001.sdf
directory: 144001


ARISTOTELINE DERIV B668273K008 NSC286326

pdb file: 144198.pdb
sdf file: 144198.sdf
directory: 144198


5,8-Quinolinedione, 7-amino-6-methoxy-2-(2-pyridinyl)- 57179-31-4 NSC287443 QUINOLINE, 7-AMINO-6-METHOXY-2,2-PYRIDYL DERIV

pdb file: 144465.pdb
sdf file: 144465.sdf
directory: 144465


5-Pyrimidineacetaldehyde, .alpha.-(1-formyl-2-hydroxyethoxy)-1,2,3,4-tetrahydro-2,4-dioxo- 5-Pyrimidineacetaldehyde, .alpha.-(1-formyl-2-hydroxyethoxy)-1,2,3,4-tetrahydro-2,4-dioxo-, [S-(R*,S*)]- 86762-35-8 NSC291643 Pyrimidineacetaldehyde derivative

pdb file: 145498.pdb
sdf file: 145498.sdf
directory: 145498


NAPHTHOFURANDIONE DERIV NSC293065 Naphtho[1,2-b]furan-2,8(3H,4H)-dione, 3a,5,5a,9,9a,9b-hexahydro-5a,9-dimethyl-3-methylene-, (3a.alpha.,5a.beta.,9.alpha.,9a.alpha.,9b.beta.)-

pdb file: 145859.pdb
sdf file: 145859.sdf
directory: 145859


NAPHTHOFURANDIONE DERIV NSC293066 Naphtho[1,2-b]furan-2,8(3H,4H)-dione, 3a,5,5a,9,9a,9b-hexahydro-5a,9-dimethyl-3-methylene-, (3a.alpha.,5a.beta.,9.beta.,9a.beta.,9b.beta.)-

pdb file: 145860.pdb
sdf file: 145860.sdf
directory: 145860


NAPHTHOFURANDIONE DERIV NSC293067

pdb file: 145861.pdb
sdf file: 145861.sdf
directory: 145861


Artocarpin derivative NSC293073

pdb file: 145862.pdb
sdf file: 145862.sdf
directory: 145862


17a-Aza-D-homoandrostan-17-one, 3-[[4-[bis(2-chloroethyl)amino]phenoxy]acetyl]oxy]-, (3.beta.,5.alpha.)- 17a-Aza-D-homoandrostan-17-one, 3-[[[4-[bis(2-chloroethyl)amino]phenoxy]acetyl]oxy]-, (3.beta.,5.alpha.)- 72273-04-2 NSC294859 Naphtho[2,1-f]quinoline, 17a-aza-D-homoandrostan-17-one deriv.

pdb file: 146507.pdb
sdf file: 146507.sdf
directory: 146507


80178-14-9 ANGUIDINE DERIV 15-CHLOROACETYLSCIRPENE-3,4-DIOL NSC294913 Spiro(2,5-methano-1-benzoxepin-10,2'-oxirane), trichothec-9-ene-3,4,15-triolderiv. Trichothec-9-ene-3,4,15-triol, 12,13-epoxy-,15-(chloroacetate), (3.alpha.,4.beta.)-

pdb file: 146532.pdb
sdf file: 146532.sdf
directory: 146532


80178-17-2 ANGUIDINE DERIV 4-CHLOROACETYLSCIRPENE-3,15-DIOL NSC294914 Trichothec-9-ene-3,4,15-triol, 12,13-epoxy-, 4-(chloroacetate), (3.alpha.,4.beta.)-

pdb file: 146533.pdb
sdf file: 146533.sdf
directory: 146533


80178-15-0 ANGUIDINE DERIV 3-CHLOROACETYLSCIRPENE-4,15-DIOL NSC294915 Trichothec-9-ene-3,4,15-triol, 12,13-epoxy-, 3-(chloroacetate), (3.alpha.,4.beta.)-

pdb file: 146534.pdb
sdf file: 146534.sdf
directory: 146534


80178-16-1 ANGUIDINE DERIV 3,15-DI(CHLOROACETYL)SCIRPENE-4-OL NSC294916 Trichothec-9-ene-3,4,15-triol, 12,13-epoxy-, 3,15-bis(chloroacetate), (3.alpha.,4.beta.)-

pdb file: 146535.pdb
sdf file: 146535.sdf
directory: 146535


DRIMENE, DERIV NSC294922

pdb file: 146538.pdb
sdf file: 146538.sdf
directory: 146538


2619-59-2 ANGUIDINE DERIV (15-ACETOXY-3-KETO-SCIRPENE) NSC297275

pdb file: 147148.pdb
sdf file: 147148.sdf
directory: 147148


15-Acetoxy-4-keto-3-mesyloxy-scirpene 2269-40-1 ANGUIDINE DERIV 15-ACETOXY-4-KETO-3-MESYLOXYSCIRPENE NSC297276

pdb file: 147149.pdb
sdf file: 147149.sdf
directory: 147149


2H-1,3-Thiazine-5-carbonitrile, 3,4-dihydro-6-[(3-methoxypropyl)amino]-2-(3-nitrophenyl)-4-oxo- NSC300542 THIAZINE-5CARBONITRILE DERIV

pdb file: 148062.pdb
sdf file: 148062.sdf
directory: 148062


(3.alpha.,4.beta.)-3,15-Diacetoxyscirpene-4-ol 6121-60-4 ANGUIDINE DERIV 3,15-DIACETOXYSCIRPENE-4-OL NSC301462 Trichothec-9-ene-3,4,15-triol, 12,13-epoxy-, 3,15-diacetate, (3.alpha.,4.beta.)-

pdb file: 148246.pdb
sdf file: 148246.sdf
directory: 148246


17-Hydroxy-7alpha-mercapto-3-oxo-17alpha-pregn-4-ene-21-carboxylic acid, gamma-lactone acetate 17-alpha-Pregn-4-ene-21-carboxylic acid, 17-hydroxy-7-alpha-mercapto-3-oxo-, gamma-lactone acetate 17alpha-Pregn-4-ene-21-carboxylic acid, 17-hydroxy-7alpha-mercapto-3-oxo-, gamma-lactone, acetate 3'-(3-Oxo-7-alpha-acetylthio-17-beta-hydroxyandrost-4-en-17-beta-yl)propionic acid lactone 3-(3-Keto-7-alpha-acetylthio-17-beta-hydroxy-4-androsten-17-alpha-yl)propionic acid lactone 4-18-00-01601 (Beilstein Handbook Reference) 496916-40-6 52-01-7 7-alpha-(acetylthio)-17-alpha-hydroxy-3-oxopregn-4-ene-21-carboxylic acid, gamma-lactone (9CI) 7-alpha-Acetylthio-3-oxo-17-alpha-pregn-4-ene-21,17-beta-carbolactone Acelat Aldactazide Aldactone Aldactone A Alderon BRN 0057767 Dira EINECS 200-133-6 Espironolactona [INN-Spanish] Euteberol HSDB 3184 Melarcon NSC 150399 Pregn-4-ene-21-carboxylic acid, 7-(acetylthio)-17-hydroxy-3-oxo-, gamma-lactone, (7alpha,17alpha)- SC 15983 SC 9420 SPIRONOLACTONE Spiresis Spiridon Spiro(17H-cyclopenta(a)phenanthrene-17,2'(5'H)-furan), pregn-4-ene-21-carboxylic acid deriv. Spiro(17H-cyclopenta(a)phenauthrene-17,2'-(3'H)-furan) Spiro-Tablinen Spiroctan Spirolactone Spirolang Spirone Spironocompren Spironolactone A Spironolactone [BAN:INN:JAN] Spironolactonum [INN-Latin] Spironolattone [DCIT] Uractone Urusonin Verospiron Verospirone Xenalon

pdb file: 148637.pdb
sdf file: 148637.sdf
directory: 148637


1,3,5,2,4,6-Triazatriphosphorine, 2,2,4,4,6,6-hexakis(1-aziridiny l)-2,2,4,4,6,6-hexahydro- 1,3,5,2,4,6-Triazatriphosphorine, 2,2,4,4,6,6-hexakis(1-aziridinyl)-2,2,4,4,6,6-hexahydro- 1-Aziridinylphosphonitrile trimer 2,2,4,4,6,6-Hexahydro-2,2,4,4,6,6-hexakis(1-aziridinyl)-1,3,5,2,4,6-triazatriphosphorine 2,2,4,4,6,6-Hexakis(1-aziridinyl)-2,2,4,4,6,6-hexahydro-1,3,5,2,4,6-triazatriphosphorine 2,2,4,4,6,6-Hexakis(1-aziridinyl)cyclotriphosphaza-1,3,5-triene 5-20-01-00125 (Beilstein Handbook Reference) 52-46-0 AI3-26316 APHOLATE APN Afolat [Czech] Aziridine, 1,3,5,2,4,6-triazatriphosphorine derivative BRN 1334691 CB 40068 ENT 26,316 HSDB 6197 Hexa(1-aziridinyl)-1,3,5-phosphotriazine Hexa(1-aziridinyl)triphosphotriazine Hexakis (1-aziridinyl)phosphonitrilate Hexakis(aziridinyl)phosphotriazine Hexakis-(1-aziridinyl)phosphonitrile Myko 63 NSC 26812 NSC-26812 Olin MO. 2174 PN6 Pholate SQ 8388

pdb file: 148649.pdb
sdf file: 148649.sdf
directory: 148649


2-alpha-Ethynyl-17-alpha-methyl-A-norandrostane-2-beta,17-beta-diol 52-73-3 A-NORANDROSTANE-2-beta,17-beta-DIOL, 2-alpha-ETHYNYL-17-alpha-METHYL- Dicyclopenta[a,f]naphthalene, A-norandrostane-2,17-diol deriv

pdb file: 148660.pdb
sdf file: 148660.sdf
directory: 148660


(S)-3'-((2-Amino-3-(4-methoxyphenyl)-1-oxopropyl)amino)-3'-deoxy-N,N-dimethyladenosine 3'-(L-alpha-Amino-p-methoxyhydrocinnamamido)-3'-deoxy-N,N-dimethyladenosine 3123L 53-79-2 58-58-2 6-Dimethylamino-9-(3'-(p-methoxy-L-phenylalanylamino)-beta-D-ribofuranosyl)-purine Achromycin Achromycin (purine derivative) Adenosine, 3'-((2-amino-3-(4-methoxyphenyl)-1-oxopropyl)amino)-3'-deoxy-N,N-dimethyl-, (S)- Adenosine, 3'-(alpha-amino-p-methoxyhydrocinnamamido)-3'-deoxy-N,N-dimethyl-, L- CL 13,900 CL 16536 NSC-3055 P-638 PUROMYCIN Puromicina [INN-Spanish] Puromycin [USAN:BAN:INN] Puromycine [INN-French] Puromycinum [INN-Latin] Stillomycin Stylomycin

pdb file: 148693.pdb
sdf file: 148693.sdf
directory: 148693


(4S,4aS,5aS,12aS)-4-(Dimethylamino)-1,4,4a,5,5a,6,11,12a-octahydro-3,6,10,12,12a-pentahydroxy-6-methyl-1,11-dioxo-2-naphthacenecarboxamide 2-Naphthacenecarboxamide, 4-(dimethylamino)-1,4,4a,5,5a,6,11,12a-octahydro-3,6,10,12,12a-pentahydroxy-6-methyl-1,11-dioxo- 2-Naphthacenecarboxamide, 4-(dimethylamino)-1,4,4a,5,5a,6,11,12a-octahydro-3,6,10,12,12a-pentahydroxy-6-methyl-1,11-dioxo-, (4S-(4alpha,4aalpha,5aalpha,6beta,12aalpha))- 4-(Dimethylamino)-1,4,4a,5,5a,6,11,12a-octahydro-3,6,1 0,12,12a-pentahydroxy-6-methyl-1,11-dioxo-2-naphthacenecarboxamide 6-Methyl-1,11-dioxy-2-naphthacenecarboxamide 60-54-8 64-75-5 6591-49-7 Abramycin Abricycline Achromycin Achromycin (naphthacene derivative) Agromicina Ambramicina Ambramycin Amycin Bio-tetra Biocycline Cefracycline Cefracycline suspension Centet (base) Ciclibion Copharlan Criseociclina Cyclomycin Cyclopar Democracin Deschlorobiomycin EINECS 200-481-9 HSDB 3188 Hostacyclin Lexacycline Limecycline Liquamycin (Veterinary) Mericycline Micycline Mysteclin-F NSC 108579 Neocycline Omegamycin Orlycycline Panmycin Piracaps (base) Polycycline Polycycline (VAN) Polycycline (antibiotic) Polyotic Purocyclina Robitet Roviciclina SK-Tetracycline Solvocin Sumycin Sumycin syrup T-125 TETRACYCLINE Talsutin Tetra-co Tetrabon Tetraciclina [INN-Spanish] Tetracycl Tetracycline (internal use) Tetracycline I Tetracycline II Tetracycline [USAN:BAN:INN:JAN] Tetracyclinum [INN-Latin] Tetracyn Tetradecin Tetrafil Tetraverine Tsiklomistsin Tsiklomitsin Veracin Vetacyclinum Vetquamycin-324 (free

pdb file: 148954.pdb
sdf file: 148954.sdf
directory: 148954


(Acetato)phenylmercury (Acetato-O)phenylmercury (Acetoxymercuri)benzene 112415-59-5 1337-06-0 61840-45-7 62-38-4 64684-45-3 8013-47-6 AI3-14668 Acetate de phenylmercure [ISO-French] Acetate phenylmercurique [French] Acetic acid, phenylmercury deriv. Acetic acid, phenylmercury(II) salt Acetoxyphenylmercury Agrosan D Agrosan GN 5 Algimycin 200 Anticon Antimucin WBR Antimucin WDR Benzene, (acetoxymercuri)- Benzene, (acetoxymercurio)- Bufen Bufen 30 CCRIS 4858 Caswell No. 656 Cekusil Celmer Ceresol Contra Creme Dyanacide EINECS 200-532-5 EPA Pesticide Chemical Code 066003 Femma Fenylmercuriacetat [Czech] Fenylmerkuriacetat [Czech] Fungicide R Fungitox OR Gallotox HSDB 1670 Hexasan Hexasan (fungicide) Hl-331 Hong nien Hostaquick Hostaquik Intercide 60 Intercide PMA 18 Kwiksan Liquiphene Lorophyn Meracen Mercron Mercuriphenyl acetate Mercuron Mercury(II) acetate, phenyl-

pdb file: 149001.pdb
sdf file: 149001.sdf
directory: 149001


2,4,6(1H,3H,5H)-Pyrimidinetrione, 5-ethyl-5-(3-methylbutyl)-, monosodium salt 5-Ethyl-5-(3-methylbutyl)-2,4,6-(1H,3H,5H)-pyrimidinetrione sodium salt 5-Ethyl-5-(3-methylbutyl)barbituric acid sodium derivative 5-Ethyl-5-isopentylbarbituric acid sodium salt 5-Isoamyl-5-ethylbarbituric acid, sodium deriv 57-43-2 64-43-7 AMOBARBITAL SODIUM Alitinal Amobarbital natrium Amobarbital sodium [USAN] Amobarbital sodium salt Amobarbital spota Amsebarb Amylobarbitone, sodium deriv Amytal elixier Amytal sodique Amytal sodium Barbamyl Barbamylum Barbituric acid, 5-ethyl-5-isopentyl-, sodium deriv. Barbituric acid, 5-ethyl-5-isopentyl-, sodium salt Dorlotyn Dorminal Drinamyl Dusotal EINECS 200-584-9 Eunoctal Inmetal Isomytal Lysmidone sodico Robarb Kapseln Sodium 5-ethyl-5-isopentylbarbiturate Sodium amobarbital Sodium amylobarbitone Sodium amytal Sodium barbamyl Sodium ethylisoamylbarbiturate Sodium isoamylethyl barbiturate Talamo Tuinal iso-Amylaethylbarbitursaeures natrium t-Barb

pdb file: 149051.pdb
sdf file: 149051.sdf
directory: 149051


125199-87-3 358-50-9 70620-28-9 7428-79-7 77-58-7 8028-83-9 AI3-26331 Bis(lauroyloxy)di(n-butyl)stannane Butynorate CCRIS 4786 Cata-Chek 820 DBTL DXR 81 Davainex Di-n-butyltin dilaurate Dibutyl-tin-dilaurate Dibutyl-zinn-dilaurat [German] Dibutylbis(1-oxododecyl)oxy)stannane Dibutylbis(laurato)tin Dibutylbis(lauroxy)stannane Dibutylbis(lauroyloxy)tin Dibutylstannium dilaurate Dibutylstannylene dilaurate Dibutyltin didodecanoate Dibutyltin dilaurate Dibutyltin laurate Dibutyltin n-dodecanoate EINECS 201-039-8 Fomrez sul-4 HSDB 5214 KS 20 Kosmos 19 Lankromark LT 173 Laudran di-n-butylcinicity [Czech] Lauric acid, dibutylstannylene deriv. Lauric acid, dibutylstannylene salt Lauric acid, dibutyltin deriv. Laustan-B Mark 1038 Mark BT 11 Mark BT 18 NSC 2607 Neostann U 100 Ongrostab BLTM SM 2014C Stabilizer D-22 Stanclere DBTL Stannane, bis(dodecanoyloxy) di-n-butyl- Stannane, bis(dodecanoyloxy)di-n-butyl Stannane, bis(lauroyloxy)dibutyl- Stannane, dibutylbis((1-oxododecyl)oxy)- Stannane, dibutylbis(lauroyloxy)-

pdb file: 149446.pdb
sdf file: 149446.sdf
directory: 149446


(E)-4,4'-Diamino-2,2'-stilbendisulfonsaeure 2,2'-(1,2-Ethenediyl)bis(5-amino-benzenesulfonic acid) 2,2'-(1,2-Ethylenediyl)bis(5-aminobenzenesulfonic acid) 2,2'-Disulfo-4,4'-stilbenediamine 2,2'-Stilbenedisulfonic acid, 4,4'-diamino- 25394-13-2 3-14-00-02266 (Beilstein Handbook Reference) 4,4'-DIAMINO-2,2'-STILBENEDISULFONIC ACID 4,4'-Diaminostilbene-2,2'-disulphonic acid 4-4'-Diamino-2,2'-stilbenedisulphonic acid 65941-98-2 7336-20-1 81-11-8 Amsonic acid Amsonsaeure BRN 0629516 Benzene, 1,1'-(1,2-ethenediyl)bis-, diamino disulfo deriv. Benzenesulfonic acid, 2,2'-(1,2-ethenediyl)bis(5-amino- Benzenesulfonic acid, 2,2'-(1,2-ethylenediyl)bis(5-amino- (9CI) CCRIS 4778 DAS DASD Diaminostilbenedisulfonic acid EINECS 201-325-2 Flavonic acid HSDB 4239 NCI-C60162 NSC 163 Tinopal BHS p,p'-Diaminodiphenylethylene-o,o'-disulfonic acid p,p'-Diaminostilbene-o,o'-disulfonic acid

pdb file: 149647.pdb
sdf file: 149647.sdf
directory: 149647


1,2,3-Benzotriazin-4(3H)-one, 3-(mercaptomethyl)-, O,O-dimethyl phosphorodithioate 3-(Mercaptomethyl)-1,2,3-benzotriazin-4(3H)-one O,O-dimethyl phosphorodithioate S-ester 3-Dimethoxyphosphinothioylthiomethyl-1,2,3-benzotriazin-4(3H)-one 4-26-00-00460 (Beilstein Handbook Reference) 54182-73-9 86-50-0 AI3-23233 Azinfos-methyl [Dutch] Azinphos Azinphos methyl Azinphos-methyl Azinphos-methyl [BSI:ISO] Azinphos-metile [Italian] Azinphosmethyl BAY 17147 BAY 9027 BRN 0280476 Bayer 17147 Bayer 9027 Benzotriazine derivative of a methyl dithiophosphate Benzotriazinedithiophosphoric acid dimethoxy ester CCRIS 63 Carfene Caswell No. 374 Cotneon Cotnion Cotnion methyl Crysthion 2L Crysthyon Dimethyldithiophosphoric acid N-methylbenzazimide ester EINECS 201-676-1 ENT 23,233 EPA Pesticide Chemical Code 058001 EPA Shaughnessy

pdb file: 149847.pdb
sdf file: 149847.sdf
directory: 149847


1,1'-Methylenebis(4-chlorobenzene) 101-76-8 4,4'-Dichlorodiphenylmethane 4-05-00-01848 (Beilstein Handbook Reference) AI3-09103 BIS(4-CHLOROBENZENE)METHANE BRN 1873121 Benzene, 1,1'-methylenebis(4-chloro- Bis(4-chlorophenyl)methane Bis(p-chlorophenyl)methane DBM (the methane derivative) (VAN) DDM DDM (degradation product) Di-(4-chlorophenyl)methane Di-(p-chlorophenyl)methane EINECS 202-973-9 Methane, bis(4-chlorophenyl)- Methane, bis(p-chlorophenyl)- NSC 406594 p,p'-Dichlorodiphenylmethane

pdb file: 150656.pdb
sdf file: 150656.sdf
directory: 150656


(Orthoborato(3-)-O)phenylmercurate(2-), dihydrogen 102-98-7 Boric acid, phenylmercury deriv. Caswell No. 656C Dihydrogen (orthoborato(3-)-O)phenylmercurate(2-) EINECS 203-068-1 EPA Pesticide Chemical Code 066005 Exomycol gel Famosept Fenosept Formasept Mercurate(2-), (orthoborato(3-)-O)phenyl-, dihydrogen Mercurate(2-), (orthoborato(3-)-O)phenyl-, dihydrogen (9CI) Mercurate(2-), (orthoboroato(3-)-O)phenyl, dihydrogen Mercury, (dihydrogen borato)phenyl- Mercury, (dihydrogen orthoborato)phenyl- (8CI) Mercury, (orthoborato(1-)-O)phenyl- Merfen Merphen Metasol BT NSC 163948 PHENYLMERCURIC BORATE PMB PMB (VAN) Phenyl mercuric borate Phenylmercuriborate Phenylmercuric borate (VAN) Phenylmercury borate Ryfen Spidox Spidoxol

pdb file: 150710.pdb
sdf file: 150710.sdf
directory: 150710


116-06-3 2-Methyl-2-(methylthio)propanal, O-((methylamino)carbonyl)oxime 2-Methyl-2-(methylthio)propionaldehyde O-(methylcarbamoyl)oxime 2-Methyl-2-methylthio-propionaldehyd-O-(N-methyl-carbamoyl)-oxim [German] 2-Metil-2-tiometil-propionaldeid-O-(N-metil-carbamoil)-ossima [Italian] AI3-27093 ALDICARB Aldicarb [ISO] Aldicarbe [French] CCRIS 17 Carbamic acid, methyl-, O-((2-methyl-2-(methylthio)propylidene)amino) deriv. Carbamyl Caswell No. 011A EINECS 204-123-2 ENT 27,093 EPA Pesticide Chemical Code 098301 HSDB 1510 NCI-C08640 NSC 379586 OMS-771 Propanal, 2-methyl-2-(methylthio)-, O-((methylamino)carbonyl)oxime Propionaldehyde, 2-methyl-2-(methylthio)-, O-(methylcarbamoyl)oxime RCRA waste no. P070 RCRA waste number P070 Sulfone aldoxycarb TEMIK G Temik Temik 10 G Temik G10 UC-21149 Union carbide 21149 Union carbide UC-21149

pdb file: 151436.pdb
sdf file: 151436.sdf
directory: 151436


(Hydrogen N-glycoloylarsanilato)oxobismuth 116-49-4 Amoebicon Arsanilic acid, N-glycoloyl-, bismuth deriv Bismuth glycollylarsanilate Bismuth glycolyl arsanilate Bismuth p-glycolylaminophenylarsonate Bismuth p-glycolylarsanilate Bismuth, ((4-((hydroxyacetyl)amino)phenyl)arsonato(1-))oxo- Bismuth, (hydrogen N-glycoloylarsanilato)oxo- (8CI) Bismuthoxy-p-N-glycolylarsanilate Bismuthyl N-glycolylarsanilate Broxolin Chemo Puro Dysentulin EINECS 204-143-1 GLYCOBIARSOL Glicobiarsol [INN-Spanish] Glycobiarsol [INN] Glycobiarsolum [INN-Latin] Milibis NSC 221709 Viasept Wintodon

pdb file: 151450.pdb
sdf file: 151450.sdf
directory: 151450


(1,1'-Biphenyl)-2-ol, sodium salt 132-27-4 2-Biphenylol sodium salt 2-Biphenylol, sodium salt 2-Hydroxybiphenyl sodium salt 2-Hydroxydiphenyl sodium 2-Hydroxydiphenyl, sodium salt 2-PHENYLPHENOL, SODIUM SALT 2-Phenylphenol sodium salt 90-43-7 AI3-09076 Bactrol CCRIS 693 Caswell No. 787 D.C.S. Dowicide Dowicide A Dowicide A & A flakes Dowicide A Flakes Dowizid A EINECS 205-055-6 EPA Pesticide Chemical Code 064104 Mil-Du-Rid Mystox WFA NSC 1547 Natriphene OPP-sodium Orphenol Phenol, o-phenyl-, sodium deriv. Phenylphenol, sodium salt Preventol ON & ON Extra Preventol ON extra Preventol-ON Sodium (1,1'-biphenyl)-2-olate Sodium 2-biphenylate Sodium 2-biphenylolate Sodium 2-hydroxydiphenyl Sodium 2-phenylphenate Sodium 2-phenylphenoxide Sodium o-phenylphenate Sodium o-phenylphenol Sodium o-phenylphenolate Sodium o-phenylphenoxide Sodium o-phenylphenyolate

pdb file: 151744.pdb
sdf file: 151744.sdf
directory: 151744


140-05-6 2-Methoxyethyl (R)-12-(acetoxy)oleate 2-Methoxyethyl 12-acetoxy-9-octadecenoate 2-Methoxyethyl acetyl ricinoleate 2-Methoxyethylester kyseliny acetylricinolove [Czech] 4-03-00-01030 (Beilstein Handbook Reference) 9-Octadecenoic acid, 12-(acetyloxy)-, 2-methoxyethyl ester, (R-(Z))- (9CI) BRN 1729808 EINECS 205-395-5 Ethylene glycol monomethyl ether acetylricinoleate Glycol monomethyl ether acetylricinoleate KP 120 METHYL CELLOSOLVE ACETYLRICINOLEATE Methoxyglycol acetyl ricinoleate NSC 2199 Ricinoleic acid, 2-methoxyethyl ester, acetate Ricinoleic acid, acetyl methoxyglycol deriv.

pdb file: 151935.pdb
sdf file: 151935.sdf
directory: 151935


1,2-DIHYDRO-2,2,4-TRIMETHYLQUINOLINE 147-47-7 2,2,4-Trimethyl-1,2-dihydrochinolin [Czech] 2,2,4-Trimethyl-1,2-dihydroquinoline 2,2,4-Trimethyl-1,2-dihydroquinone AI3-17714 Acetone anil Acetone anil (quinoline deriv.) Acetone anil (quinoline derivative) Agerite resin D CCRIS 4795 EINECS 205-688-8 Flectol A Flectol H Flectol pastilles HSDB 1103 NCI-C60902 NSC 4175 Polnox R Quinoline, 1,2-dihydro-2,2,4-trimethyl- Trimethyl dihydroquinoline Trimethyl-1,2-dihydroquinoline Vulkanox HS/LG Vulkanox HS/powder

pdb file: 152139.pdb
sdf file: 152139.sdf
directory: 152139


1-Methyl-5-allyl-5-(1-methyl-2-pentynyl)barbituric acid sodium salt 2,4,6(1H,3H,5H)-Pyrimidinetrione, 1-methyl-5-(1-methyl-2-pentynyl)-5-(2-propenyl)-, (+-)-, monosodium salt 22151-68-4 309-36-4 32671-83-3 33975-80-3 5-Allyl-1-methyl-5-(1-methyl-2-pentynyl)barbituric acid sodium salt 60634-69-7 Barbituric acid, 5-allyl-1-methyl-5-(1-methyl-2-pentynyl)-, sodium deriv. Barbituric acid, 5-allyl-1-methyl-5-(1-methyl-2-pentynyl)-, sodium salt Brevimytal Brevital Brietal Brietal sodique Brietal sodium CCRIS 4716 EINECS 206-217-9 Enallynymal sodium Lilly 22451 Methohexital Sodium [USAN] Methohexital sodium Methohexitone sodium SODIUM METHOHEXITAL Sodium 5-allyl-1-methyl-5-(1-methyl-2-pentynyl)barbiturate Sodium methohexitone Sodium-dl-5-allyl-1-methyl-5-(1-methyl-2-pentynyl)barbiturate

pdb file: 152601.pdb
sdf file: 152601.sdf
directory: 152601


337-47-3 4,6-(1H,5H)-Pyrimidinedione, dihydro-5-(1-methylbutyl)-5-(2-propenyl)-2-thioxo-, monosodium salt 5-Allyl-5-(1-methylbutyl)-2-thio-barbituric acid sodium salt 5-Allyl-5-(1-methylbutyl)-2-thiobarbiturate sodium 5-Allyl-5-(1-methylbutyl)-2-thiobarbituric acid, sodium derivative BARBITURIC ACID, 5-ALLYL-5-(1-METHYLBUTYL)-2-THIO-, SODIUM SALT DEA No. 2100 EINECS 206-415-5 Sodium 5-allyl-5-(1-methylbutyl)-2-thiobarbiturate Sodium thiamylal Surital Surital sodium Surital sodium deriv. Surital sodium salt Thiamylal sodium Thiamylal sodium [USAN:JAN] Thiamylal sodium salt Thiomylal sodium Thioseconal sodium

pdb file: 152771.pdb
sdf file: 152771.sdf
directory: 152771


(Cyanoguanidino)methylmercury 1-Cyano-3-(methylmercurio)guanidine 502-39-6 AI3-28723 Agrosol Caswell No. 268 Cyano(methylmercuri)guanidine EINECS 207-935-5 EPA Pesticide Chemical Code 051909 Guanidine, cyano(methylmercurio)- Guanidine, cyano-, methylmercury deriv. HSDB 1551 METHYLMERCURIC DICYANAMIDE MMD Mercury, (3-cyanoguanidinato-N')methyl- Mercury, (3-cyanoguanidino)methyl- Mercury, (cyanoguanidinato(1-))methyl- Mercury, (cyanoguanidinato)methyl- Mercury, (cyanoguanidinato)methyl- (8CI) Mercury, (cyanoguanidinato-N')methyl- Mercury, (cyanoguanidinato-N')methyl- (9CI) Mercury, (cyanoguanidine)methyl- Methyl mercuric dicyandiamide Methylmercuric cyanoguanidine Methylmercuric dicyandiamide Methylmercury dicyandiamide Methylmercury dicyanodiamide Methylmerkuridikyandiamid [Czech] Morsodren Morton EP-227 Morton Soil Drench Morton Soil Drench-C Morton Soil-Drench-C N-Cyano-N'-(methylmercury)guanidine NSC 20000 Pandrinox Pano-drench Pano-drench 4 Panodrin A-13 Panogen Panogen (old) Panogen 15 Panogen 43 Panogen 8 Panogen PX Panogen turf fungicide Panogen turf spray Panospray 30 R 8

pdb file: 153683.pdb
sdf file: 153683.sdf
directory: 153683


4,6(1H,5H)-Pyrimidinedione, dihydro-5-(2-methylpropyl)-5-(2-propenyl)-2-thioxo-, sodium salt 5-Allyl-5-isobutyl-2-thiobarbituric acid sodium salt 510-90-7 A mixture of 100 parts by weight of the monosodium derivative of 5-allyl-5-isobutyl-2-thiobarbituric acid and 6 parts by weight of exsiccated sodium carbonate BARBITURIC ACID, 5-ALLYL-5-ISOBUTYL-2-THIO-, SODIUM SALT Baytenal Baytinal Butalital sodico [INN-Spanish] Buthalital sodique [INN-French] Buthalital sodium Buthalital sodium [INN] Buthalitalum natricum [INN-Latin] Buthalitone sodium Sodium 5,5-allyl-(2'-methylpropyl)thiobarbiturate Sodium buthalital Sodium buthaliton Sodium buthalitone Thialbutone sodium Thialisobumalnatrium Transithal Ulbreval

pdb file: 153816.pdb
sdf file: 153816.sdf
directory: 153816


2-Propenoic acid, 3-(4-hydroxy-5-benzofuranyl)-, delta-lactone 2H-Furo(2,3-H)-1-benzopyran-2-one 2H-Furo(2,3-h)(1)benzopyran-2-one 3-(4-Hydroxy-5-benzofuranyl)-2-propenoic acid gamma-lactone 39310-13-9 4-Hydroxy-5-benzofuranacrylic acid gamma-lactone 5-19-04-00447 (Beilstein Handbook Reference) 523-50-2 Angecin Angelicin Angelicin (VAN) Angelicin (coumarin deriv) Angelicin (coumarin derivative) Angelicin plus ultraviolet A radiation [Angelicins] BRN 0153970 CCRIS 4276 Furo(2,3-h)coumarin Furo(5',4':7,8)coumarin HSDB 3554 ISOPSORALEN NSC 404563

pdb file: 153958.pdb
sdf file: 153958.sdf
directory: 153958


1-Aminopropane-2-thiol 2-MERCAPTOPROPYLAMINE 2-Methyl-2-mercaptoethylamine 2-Propanethiol, 1-amino- 4146-16-1 598-36-7 EINECS 209-930-3 MPA NSC 125386 Propamine Propamine (thiol derivative) beta-Mercaptopropylamine

pdb file: 155020.pdb
sdf file: 155020.sdf
directory: 155020


2H-1,2,4-Benzothiadiazine-7-sulfonamide, 6-chloro-3-(cyclopentylmethyl)-3,4-dihydro-, 1,1-dioxide 3-Cyclopentylmethyl hydrochlorothiazide deriv 6-Chloro-3-(cyclopentylmethyl)-3,4-dihydro-2H-1,2,4-benzothiadiazine-7-sulfonamide 1,1-dioxide 742-20-1 BRN 0630346 Benesal (VAN) CYCLOPENTHIAZIDE Ciba 8341-Su Ciclopentiazida [INN-Spanish] Ciclopentiazide [DCIT] Cyclomethiazide Cyclometiazid Cyclopenthiazide [USAN:BAN:INN:JAN] Cyclopenthiazidum [INN-Latin] Cyclopentiazid EINECS 212-012-5 NSC 107679 Navidreks Navidrex Navidrex K Navidrix SU 8341 Salimed Salimid Salurilo-C Tsiklometiazid Ultra-Minzil

pdb file: 156280.pdb
sdf file: 156280.sdf
directory: 156280


68-11-1 814-71-1 Acetic acid, mercapto-, calcium salt Acetic acid, mercapto-, calcium salt (2:1) CALCIUM THIOGLYCOLATE Calcium bis(mercaptoacetate) Calcium mercaptoacetate Calcium thioglycollate Depil EINECS 212-402-5 Ebacream HSDB 1962 Jully Mercaptoacetic acid calcium derivative Surgex Vikor

pdb file: 156494.pdb
sdf file: 156494.sdf
directory: 156494


(+)-N-(5-Amino-5-carboxypentylaminomethyl)-4-dimethylamino-1,4,4a,5,5a,6,11,12a-octahydro-3,6,10,12,12a-pentahydroxy-6-methyl-1,11-dioxonaphthacene-2-carboxamide 15302-19-9 2-Naphthacenecarboxamide, 4-(dimethylamino)-1,4,4a,5,5a,6,11,12a-octahydro-3,6,10,12,12a-pentahydroxy-6-methyl-1,11-dioxo-, lysinemethylene deriv. 31041-50-6 8059-91-4 992-21-2 Armyl Ciclisin Ciclolysal EINECS 213-592-2 Infaciclina L-Lysine, N6-(((((4S,4aS,5aS,6S,12aS)-4-(dimethylamino)-1,4,4a,5,5a,6,11,12a-octahydro-3,6,10,12,12a-pentahydroxy-6-methyl-1,11-dioxo-2-naphthacenyl)carbonyl)amino)methyl)- L-Lysine, N6-((((4-(dimethylamino)-1,4,4a,5,5a,6,11,12a-octahydro-3,6,10,12,12a-pentahydroxy-6-methyl-1,11-dioxo-2-naphthacenyl)carbonyl)amino)methyl)-, (4S-(4alpha,4aalpha,6beta,12aalpha))- Limeciclina [INN-Spanish] Lisinbiotic Lymecycline Lymecycline [BAN:INN] Lymecyclinum [INN-Latin] Lysine, N(sup 6)-((4-(dimethylamino)-1,4,4a,5,5a,6,11,12a-octahydro-3,6,10,12,12a-pentahydroxy-6-methyl-1,11-dioxo-2-naphthacenecarboxamido)methyl)-, (+)- Mucomycin N(sup 2)-(((+)-5-Amino-5-carboxypentylamino)methyl)tetracycline N-Lysinomethyltetracycline N6-((4-(Dimethylamino)-1,4,4a,5,5a,6,11,12a-octahydro-3,6,10,12,12a-pentahydroxy-6-methyl-1,11-dioxo-2-naphthacenecarboxamido)methyl)lysine Tetraciclina-L-metilenlisina [Italian] Tetracycline, lysinomethyl- Tetracycline-L-methylene lysine Tetracycline-L-methylenelysine Tetralisal Tetralysal Vebicyclysal

pdb file: 157142.pdb
sdf file: 157142.sdf
directory: 157142


1215-16-3 3-13-00-00167 (Beilstein Handbook Reference) 4'-(Bis(2-chloroethyl)amino)acetanilide ACETANILIDE, 4'-(BIS(2-CHLOROETHYL)AMINO)- Acetamide, N-(4-(bis(2-chloroethyl)amino)phenyl)- (9CI) Acetyl-N-(p-aminophenyl)-nitrogen mustard BRN 2131179 Lonin 3 N-(4-(Bis(2-chloroethyl)amino)phenyl)acetamide N-(p-Acetyl-amino-phenyl)-2,2'-dichlorodiethylamine p-Acetylaminophenyl derivative of nitrogen mustard

pdb file: 157878.pdb
sdf file: 157878.sdf
directory: 157878


1320-18-9 2,4-D 2-butoxymethylethyl ester 2,4-D PGBE 2,4-D esters 2,4-D propylene glycol butyl ether ester 2,4-D, PROPYLENE GLYCOL BUTYL ETHER ESTER 2,4-Dichlorophenoxy, 2-butoxymethylethyl ester 2,4-Dichlorophenoxyacetic acid propylene glycol butyl ether ester Acetic acid, (2,4-dichlorophenoxy)-, 2-butoxymethylethyl ester Acetic acid, (2,4-dichlorophenoxy)-, butoxy propylene deriv Acetic acid, (2,4-dichlorophenoxy)-, propylene glycol butyl ester Acetic acid, 2,4-dichlorophenoxy-, butoxypropyl ester DuPont Lawn Weeder Esteron 99 Weed Killer Esteron 99 Weed Killer Concentrate Esteron Ten-Ten HSDB 3426 Propylene glycol butyl ether 2,4-dichlorophenoxyacetate Verton 2D Verton 4D

pdb file: 158099.pdb
sdf file: 158099.sdf
directory: 158099


12002-07-2 1330-00-3 1330-16-1 9056-93-3 Bicyclo(3.1.1)heptane, 2,6,6-trimethyl-, didehydro deriv. Caswell No. 664 EINECS 215-533-6 EPA Pesticide Chemical Code 067001 PINENE Pinane, didehydro derivative Polychloropinene

pdb file: 158167.pdb
sdf file: 158167.sdf
directory: 158167


1,1'-Biphenyl, chloro derivs 1,1'-Biphenyl, chloro derivs. 1336-36-3 Aroclor Aroclors Biphenyl, chlorinated Biphenyl, polychloro- CCRIS 526 Caswell No. 672A Chlophen Chlorextol Chlorinated biphenyl Chlorinated diphenyl Chlorinated diphenylene Chloro 1,1-biphenyl Chloro biphenyl Clophen Dykanol EINECS 215-648-1 EPA Pesticide Chemical Code 017801 Fenclor Fenclor 42 HSDB 3945 Inerteen Kanechlor Montar Monter Noflamol PCB PCB's PCBs POLYCHORINATED BIPHENYLS Phenochlor Phenoclor Polychlorinated biphenyl Polychlorinated biphenyls Polychlorinated biphenyls (containing 60 or more chlorine by MW) Polychlorinated biphenyls, liquid [UN2315] [Class 9] Polychlorinated biphenyls, solid [UN2315] [Class 9] Polychlorobiphenyl Polychlorobiphenyls Pyralene Pyranol Santotherm Santotherm fr Sovol Therminol Therminol fr-1 UN2315

pdb file: 158219.pdb
sdf file: 158219.sdf
directory: 158219


1341-24-8 29731-15-5 CCRIS 638 CHLOROACETOPHENONE Ethanone, 1-phenyl-, monochloro deriv. omega-Chloroacetophenone

pdb file: 158234.pdb
sdf file: 158234.sdf
directory: 158234


1476-53-5 303-81-1 Albadry Albamycin (capsule) Albamycin Capsules Antibiotic from Streptomyces spheroides Benzamide, N-(7-((3-O-(aminocarbonyl)-6-deoxy-5-C-methyl-4-O-methyl-beta-L-lyxo-hexopyranosyl)oxy)-4-hydroxy-8-methyl-2-oxo-2H-1-benzopyran-3-yl)-4-hydroxy-3-(3-methyl-2-butenyl)-, monosodium salt Cardelmycin sodium salt Cathomycin Drygard/Biodry EINECS 216-023-6 Inabiocin Monosodium novobiocin NOVOBIOCIN SODIUM NSC 2382 Novobiocin monosodium Novobiocin monosodium salt Novobiocin natrium Novobiocin sodium [USAN] Novobiocin sodium salt (VAN) Novobiocin, monosodium salt Novobiocin, sodium deriv. Novobiocina Bomaca PA 93 Na salt Sodium albamycin Sodium novobiocin Streptonivicin sodium salt U 6591 U-6591 Vulcamycin component of Albamycin Capsules

pdb file: 158444.pdb
sdf file: 158444.sdf
directory: 158444


1491-41-4 1H-Benz(de)isoquinoline-1,3(2H)-dione, 2-((diethoxyphosphinyl)oxy)- AI3-25567 B-9002 BAY 9002 BRN 1551429 Bayer 25820 Bayer 9002 Bayer S940 Caswell No. 495AA Chemagro B-9002 E 9002 EINECS 216-078-6 ENT 25,567 ENT 25567 EPA Pesticide Chemical Code 204100 Maretin N-(Diethoxyphosphinoyloxy)-1,8-naphthalindicarboximid N-Hydroxynaphthalimide diethyl phosphate N-Hydroxynaphthalimide diethylphosphate N-Hydroxynaphthylimide diethyl phosphate NAPHTHALIMIDE, N-HYDROXY-, DIETHYL PHOSPHATE NSC 229795 Naftalofos Naftalofos [USAN:INN] Naftalofosum [INN-Latin] Naphthalophos O,O-Diethyl N-hydroxynaphthalimide phosphate Phosphoric acid, diethyl ester, N-naphthalimide deriv. Phosphoric acid, diethyl ester, naphthalimido deriv. Phtalophos Phtalophos (VAN) Rametin Rawetin S 940 S-940

pdb file: 158469.pdb
sdf file: 158469.sdf
directory: 158469


1492-93-9 4'-(Bis(2-chloroethyl)amino)-2-fluoroacetanidide 4'-(Bis(2-chloroethyl)amino)-2-fluoroacetanilide 4-13-00-00138 (Beilstein Handbook Reference) ACETANILIDE, 4'-(BIS(2-CHLOROETHYL)AMINO)-2-FLUORO- Acetamide, N-(4-(bis(2-chloroethyl)amino)phenyl)-2-fluoro- (9CI) BRN 2815229 Fluoroacetyl-N-(p-aminophenyl)-nitrogen mustard N-(p-(alpha-Fluoroacetylamino)phenyl)-2,2'-dichlorodiethylamine NSC 240362 p-Fluoroacetylaminophenyl derivative of nitrogen mustard

pdb file: 158474.pdb
sdf file: 158474.sdf
directory: 158474


1,3,5-Triazine-2,4,6(1H,3H,5H)-trione, 1,3-dichloro-, potassium salt 1,3-Dichloro-1,3,5-triazine-2,4,6(1H,3H,5H)-trione, potassium salt 1,3-Dichloro-s-triazine-2,4,6(1H,3H,5H)-trione, potassium salt 1,3-Dichloro-s-triazine-2,4,6(1H,3H,5H)trione potassium salt 14426-07-4 156620-80-3 174016-61-6 2244-21-5 25727-26-8 2782-57-2 3,5-Dichlorotetrahydro-2,4,6-trioxo-s-triazin-1(2H)-yl potassium 57073-47-9 68462-52-2 73694-07-2 ACL 59 ACL-59 AI3-26480 CCRIS 4878 CP17251 Caswell No. 689 Dichloro-s-triazin-2,4,6(1H,3H,5H)-trione potassium deriv Dichloro-s-triazine-2,4,6(1H,3H,5H)-trione potassium Dichloroisocyanuric acid potassium salt Dichloroisocyanuric acid, potassium salt EINECS 218-828-8 EPA Pesticide Chemical Code 081403 Fluonon HSDB 5871 Isocyanuric acid, dichloro-, potassium salt Laitonon NSC 251767 Neochlor 59 POTASSIUM DICHLOROISOCYANURATE Potassium dichloro isocyanurate Potassium dichloro isocyanurate (DOT) Potassium dichloro-s-triazinetrione Potassium dichloro-s-triazinetrione, dry (DOT) Potassium troclosene Troclosene potassique [INN-French] Troclosene potassium Troclosene potassium [USAN:INN] Trocloseno potasico [INN-Spanish] s-Triazine-2,4,6(1H,3H,5H)-trione, 1,3-dichloro-, potassium salt

pdb file: 159950.pdb
sdf file: 159950.sdf
directory: 159950


2440-29-1 Butyric acid, phenylmercury deriv. MERCURY, (BUTYRATO)PHENYL- Mercury butyrate, phenyl- Mercury, (butyryloxy)phenyl- Mercury, phenyl(butyryloxy)- NSC 11833 Phenylmercury butyrate

pdb file: 160309.pdb
sdf file: 160309.sdf
directory: 160309


2444-90-8 4,4'-(1-Methylethylidene)bisphenol disodium salt 4,4'-Isopropylidinebisphenol, disodium salt 80-05-7 BISPHENOL A DISODIUM SALT Bisphenol A sodium salt Diphenylolpropane disodium salt Disodium 4,4'-isopropylidenediphenolate EINECS 219-488-3 HSDB 5660 Phenol, 4,4'-(1-methylethylidene)bis-, disodium salt Phenol, 4,4'-isopropylenedi-, disodium salt (8CI) Phenol, 4,4'-isopropylidenedi-, disodium deriv. (6CI) Phenol, 4,4'-isopropylidenedi-, disodium salt Sodium, (isopropylidenebis(p-phenyleneoxy))di- (7CI)

pdb file: 160321.pdb
sdf file: 160321.sdf
directory: 160321


1-MA-4OEAA [Russian] 1-Methylamino-4-ethanolaminoanthraquinone 1-Methylamino-4-oxyethylaminoanthraquinone [Russian] 2475-46-9 4-14-00-00462 (Beilstein Handbook Reference) 71486-78-7 71807-37-9 9,10-Anthracenedione, 1,4-diamino-, N,N'-mixed 2-hydroxyethyl and Me derivs. 9,10-Anthracenedione, 1-((2-hydroxyethyl)amino)-4-(methylamino)- Acetate Brilliant Blue 4B Acetoquinone Light Pure Blue R Akasperse Blue GLF Altocyl Brilliant Blue B Amacel Blue BNN Amacel Brilliant Blue B Artisil Blue BSG Artisil Blue BSQ Atlantic Disperse Blue BNA BRN 2060684 C. I. Disperse Blue 41 C. I. Disperse Blue 66 C.I. 61505 C.I. Disperse Blue 3 CCRIS 3734 CI 61505 CI DISPERSE BLUE 3 Calcosyn Sapphire Blue 2GS Calcosyn Sapphire Blue R Celanthrene Brilliant Blue Celanthrene Brilliant Blue FFS Celliton Blue FFR Celliton

pdb file: 160382.pdb
sdf file: 160382.sdf
directory: 160382


106691-70-7 149-30-4 2(3H)-Benzothiazolethione, sodium salt 2-Benzothiazolethiol, sodium deriv. 2-Benzothiazolethiol, sodium salt 2-Mercaptobenzothiazole, sodium 2-Mercaptobenzothiazole, sodium deriv. 2-Mercaptobenzothiazole, sodium salt 2492-26-4 26249-01-4 AI3-17229 Benzothiazolethiol, sodium salt Caswell No. 541C Duodex EINECS 219-660-8 EPA Pesticide Chemical Code 051704 HSDB 6141 Mercaptobenzothiazol, sodium salt solution Mercaptobenzothiazole sodium salt NSC 191935 NaMBT Nacap SODIUM 2-MERCAPTOBENZOTHIAZOLE Sodium 2(3H)-benzothiazolethionate Sodium 2-benzothiazolethioate Sodium 2-benzothiazolethiolate Sodium 2-mercaptobenzothiazol solution Sodium 2-mercaptobenzothiazolate Sodium MBT Sodium benzothiazol-2-yl sulphide Sodium benzothiazolethiolate Sodium mercaptobenzothiazolate Sodium mercaptobenzothiazole Sodium, (2-benzothiazolylthio)- Sodium-2-mercaptobenzothiazol solution Vancide 51

pdb file: 160413.pdb
sdf file: 160413.sdf
directory: 160413


2642-71-9 3,4-Dihydro-4-oxo-3-benzotriazinylmethyl O,O-diethyl phosphorodithioate 3-Diethoxyphosphinothioylthiomethyl-1,2,3-benzotriazin-4(3H)-one 3-Diethyloxyphosphinothioylthiomethyl-1,2,3-benzotriazin-4(3H)-one 4-26-00-00460 (Beilstein Handbook Reference) AI3-22014 Athyl-gusathion Azinfos-ethyl [Dutch] Azinophos-ethyl Azinos Azinphos ethyl Azinphos-aethyl [German] Azinphos-ethyl Azinphos-ethyl [BSI:ISO] Azinphos-etile [Italian] Azinugec E BAY 16255 BAY 16259 BRN 0297468 Bayer 16259 Benzotriazine derivative of an ethyl dithiophosphate Bionex Caswell No. 344 Cotnion-ethyl Crysthion EINECS 220-147-6 ENT 22,014 EPA Pesticide Chemical Code 058002 ETHYL GUTHION Ethyl Gusathion Ethyl azinphos Ethyl homolog of guthion Gusathion Gusathion A Gusathion A-M Gusathion H Gusathion H and K Gusathion K Gusathion K forte Gusation A Gutex Guthion (ethyl) HSDB 411 O,O-Diaethyl-S-((4-oxo-3H-1,2,3-benzotriazin-3-yl)-methyl)-dithiophosphat [German] O,O-Diaethyl-S-(4-oxobenzotriazin-3-methyl)-dithiophosphat [German] O,O-Diethyl S-((4-oxo-1,2,3-benzotriazin-3(4H)-yl)methyl) phosphorodithioate (9CI) O,O-Diethyl S-(4-oxobenzotriazino-3-methyl)phosphorodithioate

pdb file: 160683.pdb
sdf file: 160683.sdf
directory: 160683


1H-Benz(de)isoquinoline-1,3(2H)-dione, 2-((diethoxyphosphinothioyl)oxy)- 2668-92-0 5-21-11-00362 (Beilstein Handbook Reference) AI3-24970 BAY 22,408 BRN 1501838 ENT 24970 NAPHTHALIMIDE, N-HYDROXY-, O,O-DIETHYL PHOSPHOROTHIOATE Naphthaloximide-O,O-diethyl phosphorothioate Naphthaloximidodiethyl thiophosphate O,O-Diethyl O-naphthalimide phosphorothioate O,O-Diethyl O-naphthaloximido phosphorothioate O,O-Diethyl O-naphthaloximidophosphorothionate O,O-Diethyl-O-naphthylamidophosphorothioate Phosphorothioic acid, O,O-diethyl O-naphthylamido ester Phosphorothioic acid, O,O-diethyl ester, O-naphthalimido derivative S 125

pdb file: 160728.pdb
sdf file: 160728.sdf
directory: 160728


2750-76-7 4-O-(2-(Diethylamino)-2-oxoethyl)rifamycin 53109-90-3 Acetamide, 2-((1,2-dihydro-5,6,17,19,21-pentahydroxy-23-methoxy-2,4,12,16,18,20,22-heptamethyl-1,11-dioxo-2,7-(epoxypentadeca(1,11,13)trienimino)naphtho(2,1-b)furan-9-yl)oxy)-N,N-diethyl-, 21-acetate EINECS 220-390-8 M/14 (VAN) N,N-Diethylrifamycin B amide NCI 143-418 NSC 133099 NSC-133099 RF M-14 RIFAMIDE Rifamida [INN-Spanish] Rifamide [USAN:BAN:INN] Rifamidum [INN-Latin] Rifampicin M/14 Rifamycin B N,N-diethylamide Rifamycin B N,N-diethylamide derivative Rifamycin B diethylamide Rifamycin M14 Rifamycin, 4-O-(2-(diethylamino)-2-oxoethyl)- Rifocin M Rifocina M Rifomycin B diethylamide Rifomycin M14 Stereoisomer of N,N-Diethyl-2-((1,2-dihydro-5,6,17,19,21-pentahydroxy-23-methoxy-2,4,12,16,18,20,22-heptamethyl-1,11-dioxo-2,7-(epoxypentadeca(1,11,13)trienimino)naphtho(2,1-b)furan-9-yl)oxy)acetamide 21-acetate

pdb file: 160811.pdb
sdf file: 160811.sdf
directory: 160811


1,3,5-Triazine-2,4,6(1H,3H,5H)-trione, 1,3-dichloro-, sodium salt 1-Sodium-3,5-dichloro-1,3,5-triazine-2,4,6-trione 1-Sodium-3,5-dichloro-s-triazine-2,4,6-trione 10119-30-9 12676-23-2 13023-28-4 16499-74-4 200401-83-8 25717-18-4 2782-57-2 2893-78-9 76560-28-6 81918-50-5 ACL 60 CCRIS 4788 CDB 63 CP 17254 Caswell No. 759 Dichloroisocyanurate sodium Dichloroisocyanuric acid sodium salt Dichloroisocyanuric acid, sodium salt Dichlorosymtriazine-2,4,6(1H,3H,5H)trione sodium derivative Dikonit Dimanin C EINECS 220-767-7 EPA Pesticide Chemical Code 081404 Fi Clor 60S HSDB 4235 Isocyanuric acid, dichloro-, sodium salt NCI-C55732 OCI 56 SDIC SODIUM DICHLOROISOCYANURATE Simpla Sodium dichlorisocyanurate Sodium dichloro-s-triazinetrione Sodium dichlorocyanurate Sodium salt of dichloro-s-triazine-2,4,6-trione Sodium salt of dichloro-s-triazinetrione Troclosene sodium s-Triazine-2,4,6(1H,3H,5H)-trione, 1,3-dichloro-, sodium salt s-Triazine-2,4,6(1H,3H,5H)-trione, dichloro-, sodium salt

pdb file: 161031.pdb
sdf file: 161031.sdf
directory: 161031


111866-22-9 14024-60-3 2,4-PENTANEDIONE, NICKEL(II) deriv. 2,4-Pentanedione, nickel(II)deriv. 3264-82-2 39691-34-4 46370-07-4 51185-42-3 58320-35-7 63353-43-5 65140-00-3 94552-58-6 94552-59-7 AI3-26159 Acetylacetonato nickel Acetylacetonatonickel (II) Bis(2,4-pentanedionato)nickel Bis(acetylacetonate)nickel Bis(acetylacetonate)nickel (VAN) Bis(acetylacetonato)nickel Bis(acetylacetone)nickel Bis(pentane-2,4-dionato-O,O')nickel Bis-2,4-pentanedionatonickel(II) EINECS 221-875-7 NSC 4657 Ni(II) Acetylacetone complex (1:2) Nickel acetonylacetonate Nickel acetylacetonate Nickel bis(2,4-pentanedionate) Nickel bis(acetylacetonate) Nickel(2+) acetylacetonate Nickel(II) acetylacetonate Nickel, bis(2,4-pentanedionato)- (8CI) Nickel, bis(2,4-pentanedionato-O,O')- Nickel, bis(2,4-pentanedionato-O,O')-, (SP-4-1) Nickel, bis(2,4-pentanedionato-O,O')-, (SP-4-1)- (9CI) Nickel, bis(2,4-pentanedionato-kappaO,kappaO')-, (SP-4-1)- Nickelous acetylacetonate

pdb file: 161635.pdb
sdf file: 161635.sdf
directory: 161635


148980-10-3 4',5'-Dibromfluorescein 4372-02-5 Bromo Acid Yellowish C.I. 45370 C.I. Acid Orange 11 D and C Orange No. 6 Dibromofluorescein Disodium 2-(4,5-dibromo-6-oxido-3-oxoxanthen-9-yl)benzoate EINECS 224-468-2 Eosine 2J Eosine S 10 FLUORESCEIN, 4',5'-DIBROMO-, DISODIUM SALT (8CI) Fluorescein, 4',5'-dibromo-, sodium deriv., sodium salt Spiro(isobenzofuran-1(3H),9'-(9H)xanthen)-3-one, 4',5'-dibromo-3',6'-dihydroxy-, disodium salt

pdb file: 163210.pdb
sdf file: 163210.sdf
directory: 163210


20330-10-3 2H-Pyran-2,4(3H)-dione, 3-acetyl-6-methyl-, ion(1-), sodium 2H-Pyran-2,4(3H)-dione, 3-acetyl-6-methyl-, ion(1-), sodium salt 2H-Pyran-2,4(3H)-dione, 3-acetyl-6-methyl-, monosodium salt 2H-Pyran-2,4(3H)-dione, 3-acetyl-6-methyl-, sodium salt 3-(1-Hydroxyethylidene)-6-methyl-2H-pyran-2,4(3H)-dione, sodium salt 3-Acetyl-6-methyl-2H-pyran-2,4(3H)-dione sodium salt 4-Hexenoic acid, 2-acetyl-5-hydroxy-3-oxo, delta-lactone, sodium derivative 4418-26-2 56172-68-0 71756-27-9 74240-24-7 78891-90-4 CCRIS 1895 Caswell No. 278A DHA-S DHA-sodium DHN Dehydroacetic acid, sodium salt EINECS 224-580-1 EPA Pesticide Chemical Code 027802 HSDB 4236 Harven Kyselina dehydroacetova sodna sul [Czech] New Side S 01 Prevan SODIUM DEHYDROACETATE Sodium 1-(3,4-dihydro-6-methyl-2,4-dioxo-2H-pyran-3-ylidene)ethanolate Sodium 3-acetyl-6-methyl-2,4-pyrandione Sodium 3-acetyl-6-methyl-2H-pyran-2,4(3H)-dione Sodium Dehydroacetate [USAN]

pdb file: 163286.pdb
sdf file: 163286.sdf
directory: 163286


5026-62-0 99-76-3 BENZOIC ACID, p-HYDROXY-, METHYL ESTER, SODIUM DERIV. Benzoic acid, 4-hydroxy-, methyl ester, sodium salt Bonomold OMNa EINECS 225-714-1 Methyl p-hydroxybenzoate, sodium salt Methylparaben sodium [USAN] Methylparaben, sodium salt Preserval MS Sodium 4-(methoxycarbonyl)phenolate Sodium 4-carbomethoxyphenolate Sodium methyl p-hydroxybenzoate Sodium methylparaben Sodium p-methoxycarbonylphenoxide Sodium, (p-carboxyphenoxy)-, methyl ester (7CI) Solparol

pdb file: 163896.pdb
sdf file: 163896.sdf
directory: 163896


(4beta,5beta,6beta,22R)-5,6-Epoxy-4,22,27-trihydroxy-1-oxoergosta-2,24-dien-26-oic acid, delta-lactone 5-19-06-00604 (Beilstein Handbook Reference) 5-beta-ERGOSTA-2,24-DIEN-26-OIC ACID, 5,6-beta-EPOXY-4-beta,22,27-TRIHYDROXY-1-O 5-beta-Ergosta-2,24-dien-26-oic acid, 5,6-beta-epoxy-4-beta,22,27-trihydroxy-1-oxo-, delta-lactone, (20S,22R)- 5119-48-2 5beta-Ergosta-2,24-dien-26-oic acid, 5,6beta-epoxy-4beta,22,27-trihydroxy-1-oxo-, delta-lactone, (20S,22R)- (8CI) BRN 1335150 Ergosta-2,24-dien-26-oic acid, 5,6-epoxy-4,22,27-trihydroxy-1-oxo-, gamma-lactone, (4bta,5beta,6beta,22R)- NSC 273757 NSC-101088 WITHAFERIN DERIV JPR, IOWA U. COMPOUND Withaferin A Withaferine A

pdb file: 163973.pdb
sdf file: 163973.sdf
directory: 163973


1,2-Benzisothiazol-3(2H)-one, 1,1-dioxide, sodium salt, dihydrate 1,2-Benzisothiazolin-3-one 1,1-dioxide sodium salt dihydrate 1,2-Benzisothiazolin-3-one, 1,1-dioxide, sodium deriv., dihydrate 6155-57-3 SACCHARIN SODIUM Saccharin natrium-2-wasser Saccharin sodium [USAN:JAN] Saccharin sodium dihydrate Saccharin soluble dihydrate Sodium o-benzosulfamide, dihydrate Sodium saccharin dihydrate Sucredulcor Sucromat Pulver Sun-Suc

pdb file: 165181.pdb
sdf file: 165181.sdf
directory: 165181


2-(1-Methyl-n-propyl) 4,6-dinitrophenol, ammonium salt 2-sec-Butyl-4,6-dinitrophenol, ammonium salt 4,6-Dinitro-2-sec-butylphenol ammonium salt 4,6-Dinitro-2-sec.butylfenolate ammony [Czech] 4,6-Dinitro-o-sec-butylphenol ammonium salt 6365-83-9 88-85-7 Ammonium 2-sec-butyl-4,6-dinitrophenolate BUTOPHEN Chemox selective DNBP ammonium salt Dinoseb (amine) Dinoterb-ammonium Dow selective EINECS 228-858-3 Phenol, 2-sec-butyl-4,6-dinitro-, amine deriv. Phenol, 2-sec-butyl-4,6-dinitro-, ammonium salt Selective Sinox W

pdb file: 165456.pdb
sdf file: 165456.sdf
directory: 165456


7578-43-0 Acetic acid, ((carboxymethylimino)bis(ethylenenitrilo))tetra-, sodium derivative Diethylenetriamine pentaacetic acid, sodium salt GLYCINE, N,N-BIS(2-(BIS(CARBOXYMETHYL)AMINO)ETHYL)-, SODIUM SALT

pdb file: 166743.pdb
sdf file: 166743.sdf
directory: 166743


1-Menthene 1-Methyl-2-(1-methylethyl)-1-cyclohexene, didehydro deriv. 11028-39-0 Hexahydrocarquejene o-1-MENTHENE

pdb file: 168188.pdb
sdf file: 168188.sdf
directory: 168188


11050-21-8 CIGUATOXIN CTX 1 Ciguatoxin 1 Ciguatoxin CTX 1 HSDB 7241 P-CTX 1 Pacific ciguatoxin 1 Spiro(furan-2(3H),2'(3'H)-oxepino(2'''',3'''':5''',6''')pyrano(2''',3''':5'',6'')pyrano(2'',3'':6',7')oxepino(2',3':6,7)oxepino(3,2-b)pyrano(2''''',3''''':6'''',7'''')oxepino(2'''',3'''':5''',6''')pyrano(2''',3''':7'',8'')oxocino(2'',3'':5',6')pyrano(2',3':6,7)oxepino(2,3-h)oxonin), ciguatoxin deriv.

pdb file: 168199.pdb
sdf file: 168199.sdf
directory: 168199


(T-4)-Bis(1-hydroxy-2(1H)-pyridinethionato-O,S)zinc 109702-19-4 118480-78-7 1192-70-7 1320-68-9 13463-41-7 14376-32-0 15686-64-3 162400-43-3 16782-00-6 17652-47-0 192458-89-2 2(1H)-Pyridinethione, 1-hydroxy-, zinc complex 2-Mercaptopyridine 1-oxide zinc salt 2-Pyridinethiol-1-oxide, zinc salt 208398-70-3 226883-65-4 244778-79-8 31089-48-2 3138-01-0 35430-20-7 3590-23-6 39412-61-8 51148-10-8 51406-57-6 55172-61-7 74261-71-5 AI3-62421 BC-J Biocut ZP Bis(1-hydroxy-2(1H)-pyridinethionato)zinc Bis(2-pyridinethiol-1-oxide)zinc Bis(2-pyridylthio)zinc 1,1'-dioxide Breck One Dandruff Shampoo CCRIS 4894 Caswell No. 923 EINECS 236-671-3 EPA Pesticide Chemical Code 088002 Evafine P 50 FSB 8332 Finecide ZPT HSDB 4498 Head and Shoulders Hokucide ZPT NSC 290409 Niccanon SKT OM-1563 Omadine Zinc PYRITHIONE ZINC Piritionato cincico [INN-Spanish] Pyrithione zinc [USAN:BAN:INN] Pyrithione zinc derivative Pyrithione zincique [INN-French] Pyrithionum zincicum [INN-Latin] Sebulon Shampoo

pdb file: 168786.pdb
sdf file: 168786.sdf
directory: 168786


15130-95-7 2,4,6(1H,3H,5H)-Pyrimidinetrione, 5,5-di-2-propenyl-, monosodium salt (9CI) 5,5-Diallylbarbituric acid sodium salt Allobarbital sodium BARBITURIC ACID, 5,5-DIALLYL-, SODIUM SALT Barbituric acid, 5,5-diallyl-, monosodium salt (8CI) Barbituric acid, 5,5-diallyl-, sodium deriv. (7CI) EINECS 239-194-9 Sodium 5,5-diallylbarbiturate Sodium allobarbital

pdb file: 169711.pdb
sdf file: 169711.sdf
directory: 169711


12001-86-4 16037-91-5 35-03-0 Antimony sodium gluconate Antimony(V) derivative of sodium gluconate D-Gluconic acid, 2,4:2',4'-O-(oxydistibylidyne)bis-, Sb,Sb'-dioxide, trisodium salt, nonahydrate D-Gluconic acid, cyclic ester with antimonic acid (H8Sb2O9) (2:1), trisodium salt, nonahydrate Estibogluconato sodico [INN-Spanish] Estibogluconato sodico [Spanish] Myostibin Natrii stibogluconas [INN-Latin] Pentostam SODIUM STIBOGLUCONATE Sodium stibogluconate [BAN:DCF:INN] Solustibosan Solustin Solusurmin Solyusurmin Stibanate Stibanose Stibatin Stibinol Stibogluconate de sodium [INN-French] Stibogluconate sodique Trinatrium bis(gluconato(3)-O2,O3,O4)hydroxooxido-oxy-bis-antimonat(V)

pdb file: 170219.pdb
sdf file: 170219.sdf
directory: 170219


1,4:3,6-Dianhydro-D-glucitol 5-nitrate 16051-77-7 5-Ismn AHR 4698 BM 22-145 BRN 5851319 CCRIS 1911 Conpin Conpin Retardkaps Corangin Corangin SR D-Glucitol, 1,4:3,6-dianhydro-, 5-nitrate Duride EINECS 240-197-2 Edistol Elantan Elantan Long Elantan Retard Epicordin Etimonis Fem-Mono Furo(3,2-b)furan, D-glucitol deriv. Glucitol, 1,4:3,6-dianhydro-, 5-nitrate, D- IHD IS 5MN ISMN ISMN AL ISMN AbZ ISMN Apogepha ISMN Atid ISMN Basics ISMN Heumann ISMN Hexal ISMN Lannacher ISMN Stada ISMO ISOSORBIDE MONONITRATE Imazin Imdur Imdur 60 Imdur Durules Imodur Imtrate Ismexin Ismo-20 Ismox Isomon Isomonat Isomonit Isopen-20 Isosobide-5-mononitrate [UN3251] [Flammable solid] Isosorbide 5-mononitrate Isosorbide 5-nitrate Isosorbide mononitrate [USAN:BAN:INN:JAN] Isosorbide-5-mononitrate Isosorbidi mononitras [Latin] Iturol Medocor Monicor Monis

pdb file: 170226.pdb
sdf file: 170226.sdf
directory: 170226


11016-13-0 11019-85-5 12-O-TETRADECANOYLPHORBOL-13-ACE 12-O-Tetradecanoyl phorbol acetate 12-O-Tetradecanoylphorbol 13-acetate 12-O-Tetradecanoylphorbol-13-acetate 12-O-Tetradekanoylphorbol-13-acetat [German] 12-Tetradecanoylphorbol 13-acetate 12-Tetradecanoylphorbol 13-monoacetate 12-Tetradecanoylphorbol-13-acetate 13-O-Acetylphorbol 12-myristate 13-Tetradecanoylphorbol acetate 16561-29-8 20839-11-6 26894-58-6 27534-73-2 27936-27-2 4beta-Phorbol 12-myristate 13-acetate 4beta-Phorbol-12-myristate-13-acetate 5H-Cyclopropa(3,4)benz(1,2-e)azulen-5-one, 1,1a-beta,1b-alpha,4,4a,7a-beta,7b,8,9,9a-decahydro-4a-alpha,7b-beta,9-alpha,9a-beta-tetrahydroxy-3-(hydroxymethyl)-1,1,6,8-beta-tetramethyl-, 9a-acetate 9-myristate BRN 2407201 CCRIS 716 Factor A1 Factor A1 (croton oil) HSDB 3542 Myristic acid, 9-ester with 1,1a-alpha,1b-beta,4,4a,7a-alpha,7b,8,9,9a-decahydro-4a-beta,7b-alpha,9-beta,9a-alpha-tetrahydroxy-3-(hydroxymethyl)-1,1,6,8-alpha-tetramethyl-5H-cyclopropa(3,4)benz(1,2-e)azulen-5-one, 9a-acetate Myristic acid, 9-ester with 1,1aalpha,1bbeta,4,4a,7aalpha,7b,8,9,9a-decahydro-4abeta,7balpha,9beta,9aalpha-tetrahydroxy-3-(hydroxymethyl)-1,1,6,8alpha-tetramethyl-5H-cyclopropa(3,4)benz(1,2-e)azulen-5-one 9a-acetate, (+)- NSC 262244 PMA PMA (tumor promoter) Pentahydroxy-tigliadienone-monoacetate(c)monomyristate(b) Phorbol 12-myristate 13-acetate Phorbol 12-tetradecanoate 13-acetate Phorbol acetate, myristate Phorbol ester Phorbol monoacetate monomyristate Phorbol myristate acetate Phorbol-12-myristate 13-acetate Phorbol-12-myristate-13-acetate Phorbol-myristate acetate TPA TPA (phorbol derivative) Tetradecanoic acid, 9a-(acetyloxy)-1a,1b,4,4a,5,7a,7b,8,9,9a-decahydro-4a,7b-dihydroxy-3-(hydroxymethyl)-1,1,6,8-tetramethyl-5-oxo-1H-cyclopropa(3,4)benz(1,2-e)azulen-9-yl ester, (1aR-(1aalpha,1bbeta,4abeta,7aalpha,7balpha,8alpha,9beta,9aalpha))- Tetradecanoylphorbol acetate

pdb file: 170453.pdb
sdf file: 170453.sdf
directory: 170453


17626-59-4 2,4,6(1H,3H,5H)-Pyrimidinetrione, 5-(1-cyclohexen-1-yl)-5-ethyl-, monosodium salt (9CI) 5-(1-Cyclohexen-1-yl)-5-ethylbarbituric acid sodium salt BARBITURIC ACID, 5-(1-CYCLOHEXEN-1-YL)-5-ETHYL-, SODIUM SALT Cyclobarbital sodium Cyclobarbital, sodium deriv. Cyclobarbitone sodium EINECS 241-605-1 Phanodorn sodium Sodium 5-(1-cyclohexen-1-yl)-5-ethylbarbiturate

pdb file: 171089.pdb
sdf file: 171089.sdf
directory: 171089


17867-69-5 2-((Hexyloxy)carbonyloxy)benzoic acid BRN 2944262 Benzoic acid, 2-((hexyloxy)carbonyloxy)- (9CI) Benzoic acid, o-hexyloxycarbonyloxy- CARBONIC ACID, HEXYL ESTER, ESTER with SALICYLIC ACID SKF 26070 Salicylic acid, hexylcarbonate deriv. n-Hexyl-O-carboxyphenylcarbonate o-Carboxyphenyl carbonic acid hexyl ester

pdb file: 171234.pdb
sdf file: 171234.sdf
directory: 171234


18277-24-2 2,4,6(1H,3H,5H)-Pyrimidinetrione, 5-(2-bromo-2-propenyl)-5-(1-methylethyl)-, monosodium salt 5-(2-Bromoallyl)-5-isopropylbarbituric acid sodium salt 545-93-7 BARBITURIC ACID, 5-(2-BROMOALLYL)-5-ISOPROPYL-, SODIUM SALT Nostal sodium Propallylonal sodium Propallylonal, sodium deriv. (6CI)

pdb file: 171388.pdb
sdf file: 171388.sdf
directory: 171388


125-88-2 2,4,6(1H,3H,5H)-Pyrimidinetrione, 5-(1-methylethyl)-5-(2-propenyl)-, monosodium salt 2,4,6(1H,3H,5H)-Pyrimidinetrione, 5-(1-methylethyl)-5-(2-propenyl)-, monosodium salt (9CI) 5-Allyl-5-isopropylbarbituric acid sodium salt 77-02-1 Alubarb Alurate sodium Aprobarbital natrium Aprobarbital sodium Aprobarbital sodium salt Aprobarbitone sodium Aprotal Arbatal BARBITURIC ACID, 5-ALLYL-5-ISOPROPYL-, SODIUM SALT Barbituric acid, 5-allyl-5-isopropyl-, sodium deriv Barital Butalbital sodium EINECS 204-760-6 NSC 120767 Nervolitan Sodium 5-allyl-5-isopropylbarbiturate Sodium aprobarbital Somnipron

pdb file: 173396.pdb
sdf file: 173396.sdf
directory: 173396


127-56-0 144-80-9 ACETAMIDE, N-SULFANILYL-, MONOSODIUM SALT Acetamide, N-((4-aminophenyl)sulfonyl)-, monosodium salt Acetamide, N-sulfanilyl-, N-sodium deriv Acetamide, N-sulfanilyl-, sodium deriv Albucid soluble Albucide Almocetamide Antebor Beocid-isoptal Bleph 10 Cetamide EINECS 204-848-4 Farmamid Galseptil Klaron Locula Minims sulphacetamide N(sup 1)-Acetylsulfanilamide sodium N(sup 1)-Acetylsulfanilamide sodium salt N-Sulfanilylacetamide sodium N-Sulfanilylacetamide, sodium salt Oc-U-Mid Octsetan Opulets sulpjacetamide Prontamid Sebizon lotion Sodium N-sulfanilylacetamide Sodium albucid Sodium sulamyd Sodium sulfacetamide Sodium sulfacyl Sodium sulfanilylacetamide Sodium, N(sup 1)-acetylsulfanilamido- Soluble sulfacetamide Soluble sulfacyl Sulamyd sodium Sulf-10 Ophthalmic Sulfableph Sulfacel-15 Sulfacetamid natrium Sulfacetamide sodium Sulfacetamide sodium anhydrous Sulfacetamide, sodium Sulfacetamide, sodium salt Sulfacetamidum natricum Sulfacyl sodium Sulfacyl sodium salt Sulfacyl

pdb file: 173455.pdb
sdf file: 173455.sdf
directory: 173455


127-58-2 2-Sulfanilamido-4-methylpyrimidine sodium salt 4-Methyl-2-sulfanilamidopyrimidine sodium salt Benzenesulfonamide, 4-amino-N-(4-methyl-2-pyrimidinyl)-, monosodium salt (9CI) Benzenesulfonamide, 4-amino-N-(4-methyl-2-pyrimidinyl)-, monosodiumsalt EINECS 204-851-0 Monosodium 2-sulfanilamido-4-methylpyrimidine N(sup 1)-(4-Methyl-2-pyrimidinyl)sulfanilamide sodium salt NSC 226823 SULFAMERAZINE SODIUM Sodium derivate of N1-(4-methyl-2-pyrimidinyl)sulfanilamide Sodium sulfamerazine Sodium sulphamerazine Solfamerazina sodica [DCIT] Soluble sulfamerazine Solumedine Sulfamerazin natrium Sulfamerazina sodica [INN-Spanish] Sulfamerazine sodique [INN-French] Sulfamerazine sodium Injection [INN] Sulfamerazinum natricum [INN-Latin] Sulfanilamide, N(sup 1)-(4-methyl-2-pyrimidinyl)-, monosodium salt Sulfanilamide, N1-(4-methyl-2-pyrimidinyl)-, monosodium salt (8CI) Sulfapyridine monosodium salt

pdb file: 173456.pdb
sdf file: 173456.sdf
directory: 173456


(+-)-Warfarin sodium 12795-55-0 129-06-6 2H-1-Benzopyran-2-one, 4-hydroxy-3-(3-oxo-1-phenylbutyl)-, sodium salt 3-(alpha-Acetonylbenzyl)-4-hydroxycoumarin sodium salt 4-HYDROXY-3-(3-OXO-1-PHENYLBUTYL)-(2H)1-BENZOPY* 51821-81-9 Aldocumar Athrombin Caswell No. 903A Coumadan Sodico Coumadin sodium Coumadine Coumafene sodium Coumarin, 3-(alpha-acetonylbenzyl)-4-hydroxy-, sodium salt Dicusat EINECS 204-929-4 EPA Pesticide Chemical Code 086003 Jantoven Marevam Marevan Orfarin Panwarfin Prothromadin Ratsul soluble Simarc Sodium coumadin Sodium warfarin Sodium, ((3-(alpha-acetonylbenzyl)-2-oxo-2H-1-benzopyran-4-yl)oxy)- Tintorane UniWarfin Varfine Waran Warcoumin Warfarin sodium Warfarin sodium [USAN] Warfarin, sodium deriv. Warfarin, sodium salt Warfilone Zoocoumarin sodium salt

pdb file: 173504.pdb
sdf file: 173504.sdf
directory: 173504


11000-43-4 21150-20-9 21373-20-6 21373-21-7 23109-05-9 31098-01-8 82346-97-2 9,18-(Iminoethaniminoethaniminoethaniminomethano)pyrrolo(1',2':8,9)(1,5,8,11,14)thiatetraazacyclooctadecino(18,17-b)indole, cyclic peptide deriv. ALPHA-AMANITIN BRN 1071138 Cyclic(L-asparaginyl-4-hydroxy-L-prolyl-(R)-4,5-dihydroxy-L-isoleucyl-6-hydroxy-2-mercapto-L-tryptophylglycyl-L-isoleucylglycyl-L-cysteinyl), cyclic (4-8)-sulfide, (R)-S-oxide EINECS 245-432-2 HSDB 3458 alpha-Amanitine alpha-Amatoxin

pdb file: 173715.pdb
sdf file: 173715.sdf
directory: 173715


(2,2',2''-Nitrilotri(ethanol)-N,O,O',O'')phenylmercury lactate 23319-66-6 4386-88-3 AMMONIUM, TRIS(2-HYDROXYETHYL)(PHENYLMERCURIO)-, LACTATE Caswell No. 657N EINECS 245-581-3 EPA Pesticide Chemical Code 066021 Fenylmerkuri-tris-(2-hydroxyethyl)ammoniumlaktat [Czech] Lactic acid, ion(1-), tris(2-hydroxyethyl)(phenylmercurio)ammonium Lactic acid, tris(2-hydroxyethyl)(phenylmercuri)ammonium deriv. Mercury(1+), (2,2',2''-nitrilotriethanol)phenyl-, lactate (salt) (8CI) PTAB Phenylmercuric triethanolammonium lactate Phenylmercuritriethanolammonium lactate Phenylmercury triethanolamine lactate Puratized Puratized N5E Puratized agricultural spray Puratizedat agricultural spray Puraturf Tris(2-hydroxyethyl)phenylmercuriammonium lactate

pdb file: 173902.pdb
sdf file: 173902.sdf
directory: 173902


2,4,6(1H,3H,5H)-Pyrimidinetrione, 5-(2-methylpropyl)-5-(2-propenyl)-, monosodium salt (9CI) 23554-70-3 5-Allyl-5-isobutylbarbituric acid sodium salt 77-26-9 BARBITURIC ACID, 5-ALLYL-5-ISOBUTYL-, SODIUM SALT Barbituric acid, 5-allyl-5-isobutyl-, sodium deriv. (7CI) Butalbital sodium EINECS 245-732-3 Sodium 5-allyl-5-isobutylbarbiturate Sodium sandoptal

pdb file: 174001.pdb
sdf file: 174001.sdf
directory: 174001


122129-91-3 128766-18-7 133767-33-6 143413-46-1 1977-31-7 219517-51-8 24382-04-5 3-Hydroxy-2-propenal sodium salt 5388-46-5 76888-01-2 82995-28-6 CCRIS 1503 MALONALDEHYDE, SODIUM SALT Malonaldehyde sodium salt Malonaldehyde, ion(1-), sodium Malonaldehyde, sodium deriv. (6CI) Propanedial sodium Propanedial, ion(1-), sodium (9CI) Sodium beta-oxyacrolein

pdb file: 174327.pdb
sdf file: 174327.sdf
directory: 174327


25267-55-4 COPPER TRICHLOROPHENOLATE CTCP Copper 2,4,5-trichlorophenolate Copper, bis(trichlorophenoxy)- (7CI) Phenol, trichloro-, Cu deriv. (6CI) Phenol, trichloro-, copper(2+) salt Trikhlorfenolyat medi [Russian]

pdb file: 174793.pdb
sdf file: 174793.sdf
directory: 174793


1,3-Dithiolane-2-carboxaldehyde, 2,4-dimethyl-, O-((methylamino)carbonyl)oxime 1,3-Dithiolane-2-carboxaldehyde, 2,4-dimethyl-, O-(methycarbamoyl)oxime 1,3-Dithiolane-2-carboxaldehyde, 2,4-dimethyl-, O-(methylcarbamoyl)oxime 1,3-Dithiolane-2-carboxaldehyde, 2,4-dimethyl-O-((methylamino)carbonyl)oxime 1,3-Dithiolane-2-carboxaldehyde, 2,4-dimethyl-O-(methylcarbamoyl)oxime 2,4-Dimethyl-1,3-dithiolane-2-carboxaldehyde O-(methylcarbamoyl)oxime 2,4-Dimethyl-2-formyl-1,3-dithiolane oxime methylcarbamate 2,4-Dimethyl-2-formyl-1,3-dithiolane-oxime-methylcarbamate 2,4-Dimethyl-2-formyl-1,3-dithiolanoximmethylkarbamat [Czech] 26419-73-8 3M Mbr 6168 AI3-27696 Carbamic acid, methyl-, O-(((2,4-dimethyl-1,3-dithiolan-2-yl)methylene)amino) deriv. Carbamic acid, methyl-, O-(((2,4-dimethyl-1,3-dithiolan-2-yl)methylene)amino)- Carbamic acid, methyl-, O-(((2,4-dimethyl-1,3-dithiolan-2-yl)methylene)amino)oxime Carbamic acid, methyl-O-(((2,4-dimethyl-1,3-dithiolan-2-yl)methylene)amino)- Caswell No. 364B ENT 27696 EPA Pesticide Chemical Code 364300 HSDB 6457 MBR 6168 MBR 6268 O-(((2,4-Dimethyl-1,3-dithiolan-2-yl)methylene)amino)methylcarbamic acid RCRA waste no. P185 TIRPATE

pdb file: 175350.pdb
sdf file: 175350.sdf
directory: 175350


27576-03-0 Benzene, ethenyl-, dimethyl deriv. DIMETHYLSTYRENE

pdb file: 175743.pdb
sdf file: 175743.sdf
directory: 175743


28675-08-3 AI3-01203 Benzene, 1,1'-oxybis-, dichloro derivative DICHLOROPHENYL ETHER Dichloro diphenyl ether Dichloro diphenyl oxide Ether, dichlorophenyl Phenyl ether dichloro

pdb file: 176049.pdb
sdf file: 176049.sdf
directory: 176049


28805-90-5 Benzene, dimethyl-, dibromo deriv. DIBROMODIMETHYLBENZENE

pdb file: 176087.pdb
sdf file: 176087.sdf
directory: 176087


(1S-(1alpha,4alpha,4aalpha,6alpha,8abeta))-Decahydro-4-isopropyl-1,6-dimethylnaphthalene, didehydro derivative 108910-53-8 29350-73-0 CADINENE CCRIS 4593 EINECS 249-580-9 Naphthalene, decahydro-1,6-dimethyl-4-(1-methylethyl)-, (1S,4S,4aS,6S,8aS)-, didehydro deriv. Naphthalene, decahydro-1,6-dimethyl-4-(1-methylethyl)-, (1S-(1alpha,4alpha,4aalpha,6alpha,8abeta))-, didehydro deriv.

pdb file: 176271.pdb
sdf file: 176271.sdf
directory: 176271


2,6-Dimethyloctane, hexadehydro derivative 29714-87-2 Dimethyloctatriene (mixed isomer) EINECS 249-805-0 OCIMENE Octatriene, dimethyl-

pdb file: 176381.pdb
sdf file: 176381.sdf
directory: 176381


31571-71-8 67-42-5 ACETIC ACID, (ETHYLENEBIS(OXYETHYLENENITRILO))TETRA-,SODIUM DERIV. Acetic acid, (ethylenebis(oxyethylenenitrilo))tetra-, sodium salt (8CI) Glycine, N,N'-(1,2-ethanediyl)bis(oxy-2,1-ethanediyl)bis(N-(carboxymethyl)-, sodium salt Sodium EGTA

pdb file: 177453.pdb
sdf file: 177453.sdf
directory: 177453


132405-96-0 134206-43-2 32534-81-9 Benzene, 1,1'-oxybis-, pentabromo deriv. Bromkal G 1 CCRIS 4851 DE 71 Diphenyl ether, pentabromo derivative EINECS 251-084-2 HSDB 7109 PENTABROMODIPHENYL OXIDE Pentabromodiphenyl ether Pentabromophenoxybenzene Planelon PB 501 Saytex 125

pdb file: 177704.pdb
sdf file: 177704.sdf
directory: 177704


1,1'-Oxybisbenzene octabromo deriv. 32536-52-0 Benzene, 1,1'-oxybis-, octabromo deriv. Bromkal 79-8DE CD 79 DE 79 Diphenyl ether, octabromo derivative EB 8 EINECS 251-087-9 FR 1208 FR 143 OCTABROMOBIPHENYL ETHER Octabromodiphenyl ether Octabromodiphenyl oxide Phenyl ether, octabromo deriv. Phenyl ether, octabromo deriv. (8CI) Tardex 80

pdb file: 177705.pdb
sdf file: 177705.sdf
directory: 177705


35285-68-8 4-Hydroxybenzoic acid, ethyl ester, sodium salt BENZOIC ACID, p-HYDROXY-, ETHYL ESTER, SODIUM DERIV. Benzoic acid, 4-hydroxy-, ethyl ester, sodium salt EINECS 252-487-6 Ethyl p-hydroxybenzoate, sodium salt Ethylparaben, sodium salt Sodium 4-ethoxycarbonylphenoxide Sodium ethylparaben

pdb file: 178515.pdb
sdf file: 178515.sdf
directory: 178515


35285-69-9 4-Hydroxybenzoic acid, propyl ester, sodium salt 94-13-3 BENZOIC ACID, p-HYDROXY-, PROPYL ESTER, SODIUM DERIV. Benzoic acid, 4-hydroxy-, propyl ester, sodium salt Caswell No. 714A EINECS 252-488-1 EPA Pesticide Chemical Code 061204 Natrium propyl 4-hydroxybenzoat Parasept Propyl p-hydroxybenzoate, sodium salt Propyl-4-hydroxybenzoat natriumsalz Propylparaben sodium [USAN] Propylparaben, sodium salt Sodium 4-propoxycarbonylphenoxide Sodium propylparaben

pdb file: 178516.pdb
sdf file: 178516.sdf
directory: 178516


3,4,5,6-TETRABROMO-O-XYLENE 36059-21-9 CCRIS 4868 EINECS 252-851-4 Xylene, tetrabromo derivative

pdb file: 178735.pdb
sdf file: 178735.sdf
directory: 178735


36483-60-0 BR 33N Benzene, 1,1'-oxybis-, hexabromo deriv. Diphenyl ether, hexabromo derivative EINECS 253-058-6 HEXABROMODIPHENYL ETHER Hexabromodiphenyl oxide Hexabromophenoxybenzene

pdb file: 178822.pdb
sdf file: 178822.sdf
directory: 178822


2-Isopropoxyphenyl N-methylcarbamate, nitrosated 38777-13-8 BRN 2291628 Baygon, nitroso derivative CARBAMIC ACID, N-METHYL-N-NITROSO-, o-ISOPROPOXYPHENYL ESTER CCRIS 1213 Carbamic acid, methylnitroso-, 2-(1-methylethoxy)phenyl ester (9CI) Carbamic acid, methylnitroso-, o-isopropoxyphenyl ester Methylnitrosocarbamic acid o-isopropoxyphenyl ester N-Nitroso-2-isopropoxyphenyl-N-methylcarbamate N-Nitrosopropoxur Nitrosobaygon Nitrosopropoxur Propoxur nitroso Suncide, nitrosated [Japanese] o-Isopropoxyphenyl N-methyl-N-nitrosocarbamate o-Isopropoxyphenyl methylnitrosocarbamate

pdb file: 179358.pdb
sdf file: 179358.sdf
directory: 179358


115633-92-6 40088-47-9 82458-12-6 Benzene, 1,1'-oxybis-, tetrabromo deriv. Diphenyl ether, tetrabromo derivative EINECS 254-787-2 TETRABROMODIPHENYL ETHER Tetrabromobiphenyl ether Tetrabromodiphenyl oxide

pdb file: 179618.pdb
sdf file: 179618.sdf
directory: 179618


40356-57-8 Benzene, 1,1'-oxybis-, octachloro deriv. ETHER, OCTACHLORODIPHENYL Octachloro diphenyl ether

pdb file: 179671.pdb
sdf file: 179671.sdf
directory: 179671


2-Hexen-1-ol, 2-isopropyl-5-methyl-, acetate 2-Hexen-1-ol, 5-methyl-2-(1-methylethyl)-, acetate 2-Isopropyl-5-methyl-2-hexen-1-yl acetate 2-Isopropyl-5-methyl-2-hexene-1-yl acetate 2-Isopropyl-5-methylhex-2-enyl acetate 4-02-00-00196 (Beilstein Handbook Reference) 4-Hexen-1-ol, 5-methyl-2-(1-methylethylidene)-, acetate, dihydro deriv. 40853-56-3 5-Methyl-2-(1-methylethyl)-2-hexen-1-yl acetate ACETIC ACID, 2-ISOPROPYL-5-METHYL-2-HEXEN-1-YL ESTER BRN 1770843 EINECS 255-114-5 Isodihydro lavandulyl acetate

pdb file: 179858.pdb
sdf file: 179858.sdf
directory: 179858


2H-3,11c-(Epoxymethano)phenanthro(10,1-bc)pyran, picras-3-en-21-oic acid deriv. (9CI) 41451-75-6 BRUCEANTIN NSC 165563 NSC-165563 Picras-3-en-21-oic acid, 15-((3,4-dimethyl-1-oxo-2-pentenyl)oxy)-13,20-epoxy-3,11,12-trihydroxy-2,16-dioxo-, methyl ester, (11beta,12alpha,15beta(E))- (9CI)

pdb file: 179998.pdb
sdf file: 179998.sdf
directory: 179998


113152-37-7 49690-94-0 Benzene, 1,1'-oxybis-, tribromo deriv. Diphenyl ether, tribromo derivative EINECS 256-431-1 TRIBROMODIPHENYL OXIDE Tribromodiphenyl ether

pdb file: 180511.pdb
sdf file: 180511.sdf
directory: 180511


52320-86-2 ALANINE, N-(((2-CHLOROETHYL)NITROSOAMINO)CARBONYL)-, DL- BRN 5545020 DL-Alanine, N-(((2-chloroethyl)nitrosoamino)carbonyl)- N-(((2-Chloroethyl)amino)carbonyl)-DL-alanine mononitroso deriv. N-(2-Chloroethyl)-1-nitrosocarbamoylalanine NSC 171564

pdb file: 181208.pdb
sdf file: 181208.sdf
directory: 181208


1,1'-OXYBISHEXACHLORO BENZENE, DERIVATIVE 55720-99-5

pdb file: 182276.pdb
sdf file: 182276.sdf
directory: 182276


57321-63-8 AI3-00034 Benzene, 1,1'-oxybis-, trichloro derivative TRICHLOROPHENYL ETHER Trichlorodiphenyl oxide

pdb file: 182858.pdb
sdf file: 182858.sdf
directory: 182858


62573-57-3 Bux-ten, nitroso deriv. (9CI) CARBAMIC ACID, N-METHYL-N-NITROSO-, m-(3-PENTYLPHENYL) ESTER Carbamic acid, methylnitroso-, 3-(1-ethylpropyl)phenyl ester N-Methyl-N-nitrosocarbamic acid m-3-pentylphenyl ester N-Nitrosobuxten Nitrosobux-ten m-(3-Pentyl)phenyl N-methyl-N-nitrosocarbamate

pdb file: 184357.pdb
sdf file: 184357.sdf
directory: 184357


4,6-Dinitro-o-cresol barium derivative 534-52-1 63989-83-3 o-CRESOL, 4,6-DINITRO-, BARIUM DERIVATIVE

pdb file: 185828.pdb
sdf file: 185828.sdf
directory: 185828


64047-51-4 JERVINE, N-ACETYL- Jervine, acetate Spiro(9H-benzo(a)fluorene-9,2'(3'H)-furo(3,2-b)pyridine), vertatraman-11-one deriv. Veratraman-11-one, 17,23-epoxy-3-hydroxy-, (3beta,23beta)-, acetate (salt)

pdb file: 186217.pdb
sdf file: 186217.sdf
directory: 186217


64049-77-0 AMMONIUM, 4-(METHYLAZA)-1,7-HEPTYLENEBIS(TRIMETHYL-, DIBROMIDE Ciba derivative 9646 N,N,N,N',N',N',4-Heptamethyl-4-azaheptane-1,7-diammonium, dibromide salt

pdb file: 186348.pdb
sdf file: 186348.sdf
directory: 186348


68411-30-3 Benzenesulfonic acid, C10-13-alkyl derivs, sodium salts Benzenesulfonic acid, C10-13-alkyl derivs., sodium salts Benzenesulfonic acid, C1O-13-alkyl derivs., sodium salts Benzenesulfonic acid, linear alkyl-, sodium salt EINECS 270-115-0 HSDB 1980 LAS, sodium salt LAS-Na Linear alkylbenzenesulfonate, sodium salt SODIUM ALKYLBENZENESULFONATE Sodium alkylbenzene sulfonate Straight-chain alkyl benzene sulfonate

pdb file: 188702.pdb
sdf file: 188702.sdf
directory: 188702


(3-Minkamidopropyl)dimethyl (2-hydroxyethyl)ammonium chloride 1-Propanaminium, 3-amino-N-(2-hydroxyethyl)-N,N-dimethyl-, N-mink-oil acyl derivs, chlorides 68953-64-0 EINECS 273-222-0 Minkamidopropyl dimethyl 2-hydroxyethyl ammonium chloride QUATERNIUM-26 Quaternary ammonium compounds, (hydroxyethyl)dimethyl(3-mink oil amidopropyl), chlorides

pdb file: 188770.pdb
sdf file: 188770.sdf
directory: 188770


77096-41-4 BRN 5323120 Benzo(a)heptalene, L-lysine deriv. (9CI) Colchizin Colkhisin L-LYSINE, N(sup 6)-(7-ACETAMIDO-1,2,3-TRIMETHOXY-9-OXO-5,6-DIHYDROBENZ(a)HEPTALE L-Lysine, N(sup 6)-(7-acetamido-1,2,3-trimethoxy-9-oxo-5,6-dihydrobenz(a)heptalen-10-yl)methyl ester L-Lysine, N6-(7-(acetylamino)-5,6,7,9-tetrahydro-1,2,3-trimethoxy-9-oxobenzo(a)heptalen-10-yl)- methyl ester, (S)- (9CI) NSC 183738

pdb file: 191408.pdb
sdf file: 191408.sdf
directory: 191408


107534-94-1 17-Hydroxy-4-aza-A-nor-5-androsten-3-one (4-N,N-bis(2-chloroethylamino)phenyl)butyrate 17-beta-Hydroxy-4-aza-A-nor-5-androsten-3-one p-N,N-bis(2-chloroethyl)aminophenylbutyrate 17-beta-Hydroxy-4-aza-a-nor-5-androsten-3-one-N,N-bis-(2-chloroethyl)aminophenylbutyrate 1H-Indeno(5,4-f)quinoline, 4-azaandrost-5-en-3-one deriv. (9CI) 4-AZAANDROST-5-EN-3-ONE, 17-(4-(4-(BIS(2-CHLOROETHYL)AMINO)PHENYL)-1-OXOBUTOXY)- 4-Azaandrost-5-en-3-one, 17-(4-(4-(bis(2-chloroethyl)amino)phenyl)-1-oxobutoxy)-, (17-beta)- CCRIS 1523

pdb file: 196553.pdb
sdf file: 196553.sdf
directory: 196553


1,1-Dioxide-1,2-benzisothiazol-3(2H)-one, sodium salt 1,2-Benzisothiazol-3(2H)-one, 1,1-dioxide, sodium salt 1,2-Benzisothiazolin-3-one, 1,1-dioxide, sodium deriv. 1,2-Benzisothiazolin-3-one, 1,1-dioxide, sodium salt 128-44-9 38279-26-4 Artificial sweetening substanz gendorf 450 Benzoic acid sulfimide, sodium CCRIS 706 Cristallose Crystallose Dagutan EINECS 204-886-1 FEMA No. 2997 Kristallose Madhurin NSC 4867 ODA SACCHARIN SODIUM Saccharin sodium anhydrous Saccharin sodium, anhydrous Saccharin soluble Saccharin, sodium Saccharin, sodium salt Saccharin, sodium salt (C7H5NO3S.xNa) Saccharine sodium salt Saccharine soluble Saccharinnatrium Saccharoidum natricum Saxin Sodium 1,2 benzisothiazolin-3-one 1,1-dioxide Sodium 1,2 benzisothiazolin-3-one-1,1-dioxide Sodium 1,2-benzisothiazol-3(2H)-one, 1,1-dioxide Sodium 1,2-benzisothiazolin-3-one 1,1-dioxide Sodium 2-benzosulphimide Sodium benzosulphimide Sodium o-benzosulfimide Sodium o-benzosulphimide Sodium saccharide Sodium saccharin Sodium saccharin, anhydrous Sodium saccharinate

pdb file: 197310.pdb
sdf file: 197310.sdf
directory: 197310


129940-98-3 134-03-2 3-Oxo-L-gulofuranolactone sodium 50-81-7 Ascorbate de sodium [INN-French] Ascorbato sodico [DCIT] Ascorbic acid sodium derivative Ascorbic acid sodium salt Ascorbicin Ascorbin CCRIS 3291 Cebitate Cenolate Cevalin EINECS 205-126-1 HBL 508 HSDB 694 Iskia-C L-Ascorbic acid sodium salt L-Ascorbic acid, monosodium salt Monosodium L-ascorbate Natrascorb Natri-C Natrii ascorbas [INN-Latin] SODIUM ASCORBATE Sodascorbate Sodium Ascorbate [USAN:INN] Sodium L-ascorbate Sodium derivative of 3-oxo-L-gulofuranolactone Vitamin C sodium Vitamin C, sodium salt

pdb file: 197315.pdb
sdf file: 197315.sdf
directory: 197315


2,4-Dinitro-6-methylphenol sodium salt 2-METHYL-4,6-DINITROPHENOL SODIUM SALT 2312-76-7 3,5-Dinitro-o-cresol sodium salt 4,6-Dinitro-o-cresol sodium salt 534-52-1 Caswell No. 390A Corodinoc Cresotol DNOC sodium salt Dynosol EINECS 219-007-7 EK 54 EPA Pesticide Chemical Code 037508 Gilboform Krezonite Krezotol Krezotol DNOC Phenol, 2-methyl-4,6-dinitro-, sodium salt Sodium 4,6-dinitro-o-cresolate Sodium 4,6-dinitro-o-cresoxide Sodium 4,6-dinitro-o-cresylate Sodium dinitro-o-cresolate, wetted with not <15 water, by mass [UN1348] [Flammable solid] UN1348 o-Cresol, 4,6-dinitro-, sodium deriv. o-Cresol, 4,6-dinitro-, sodium salt

pdb file: 197566.pdb
sdf file: 197566.sdf
directory: 197566


12068-17-6 Benzene, dodecylphenoxy-, disulfo deriv., sodium salt ar-(Dodecylphenoxy)benzendisulfonic acid, disodium salt

pdb file: 197870.pdb
sdf file: 197870.sdf
directory: 197870


(Acryloyloxy)tributylstannane 13331-52-7 Acrylic acid, tributyltin deriv. BRN 4139485 Caswell No. 867I EINECS 236-381-7 EPA Pesticide Chemical Code 083121 Stannane, (acryloyloxy)tributyl- Stannane, tributyl((1-oxo-2-propenyl)oxy)- Tin, (acryloyloxy)tributyl- Tributylacryloyloxystannane Tributylstannyl acrylate Tributyltin acrylate

pdb file: 197977.pdb
sdf file: 197977.sdf
directory: 197977


(1,1'-Biphenyl)-2-ol, potassium salt 13707-65-8 2-Biphenylol, potassium salt (8CI) Caswell No. 658D EINECS 237-243-9 EPA Pesticide Chemical Code 064108 Phenol, o-phenyl, potassium deriv. (6CI) Potassium 2-biphenylate Potassium 2-phenylphenate Potassium o-phenylphenolate o-Phenylphenol potassium salt p-Phenylphenol potassium salt

pdb file: 198057.pdb
sdf file: 198057.sdf
directory: 198057


(Z)-5,5,12,12-Tetrabutyl-7,10-dioxo-6,11-dioxa-5,12-distannahexadec-8-ene 14275-57-1 6,11-Dioxa-5,12-distannahexadec-8-ene, 5,5,12,12-tetrabutyl-7,10-dioxo-, (Z)- BRN 4163354 Bis(tributyltin) maleate Butenedioic acid, bis(tributylstannyl) deriv. Caswell No. 867EE EINECS 238-166-3 EPA Pesticide Chemical Code 083118 Maleic acid, bis(tributylstannyl) deriv. Maleic acid, bis(tributylstannylene) salt Stannane, (maleoyldioxy)bis(tributyl- Steri septic DM 50 Steri-chem DM-50N Tin, (maleoyldioxy)bis(tributyl- Tributyltin maleate Ultrafresh DM-50

pdb file: 198114.pdb
sdf file: 198114.sdf
directory: 198114


(1,1'-Biphenyl)-4-ol, 3-chloro-, sodium salt 31366-97-9 4-Biphenylol, 3-chloro-, sodium salt Phenol, 2-chloro-4-phenyl-, sodium deriv. Sodium 2-chloro-4-phenylphenate Sodium 2-chloro-4-phenylphenolate

pdb file: 198290.pdb
sdf file: 198290.sdf
directory: 198290


(Methylamino)-1,2,3-propanetriol 1,2,3-Propanetriol, (methylamino)- 31671-74-6 Glycerol, 2-methylamino deriv.

pdb file: 198295.pdb
sdf file: 198295.sdf
directory: 198295


35860-31-2 Benzeneamine, N-phenyl-, hexanitro deriv. Hexanitrodiphenylamine N-Phenylbenzeneamine hexanitro deriv.

pdb file: 198356.pdb
sdf file: 198356.sdf
directory: 198356


53467-00-8 Benzenesulfonic acid, phenoxy-, monododecyl deriv., sodium salt Monododecyl phenoxybenzenesulfonate sodium salt Sodium dodecyl diphenyl oxide sulfonate

pdb file: 198542.pdb
sdf file: 198542.sdf
directory: 198542


1H,3H,5H-Oxazolo(3,4-c)oxazole, poly(oxymethylene) deriv. 5-Hydroxypoly(methyleneoxy)methyl-1-aza-3,7-dioxabicyclo(3,3,0)octane 56709-13-8 Poly(oxymethylene), alpha-(1H,3H,5H-oxazolo(3,4-c)oxazol-3a(4H)-ylmethyl)-omega-hydroxy- Polymethoxy bicyclic oxazolidine

pdb file: 198626.pdb
sdf file: 198626.sdf
directory: 198626


1H,3H,5H-Oxazolo(3,4-c)oxazole, methanol deriv. 5-Hydroxymethoxymethyl-1-aza-3,7-dioxabicyclo(3.3.0)octane 59720-42-2 Caswell No. 494CA EPA Pesticide Chemical Code 107001 Methanol, (1H,3H,5H-oxazolo(3,4-c)oxazol-7a(7H)-ylmethoxy)-

pdb file: 198674.pdb
sdf file: 198674.sdf
directory: 198674


61791-32-0 EINECS 263-164-4 Glycine, N-(2-((2-hydroxyethyl)amino)ethyl)-, N'-coco acyl derivs,monosodium salts Glycine, N-(2-((2-hydroxyethyl)amino)ethyl)-, N'-coco acyl derivs., monosodium salts N-(2-Cocoamidoethyl)-N-(2-hydroxyethyl)glycine, sodium salt (R=coco)

pdb file: 198796.pdb
sdf file: 198796.sdf
directory: 198796


61791-33-1 EINECS 263-166-5 Glycine, N-(2-aminoethyl)-N-(2-hydroxyethyl)-, N-coco acyl derivs. N-(2-Aminoethyl)-N-(2-hydroxyethyl)glycine, N-coco acyl derivs. (R=coco) N-(2-Coconut oil amidoethyl)-N-(2-hydroxyethyl)glycine

pdb file: 198797.pdb
sdf file: 198797.sdf
directory: 198797


61791-41-1 EINECS 263-173-3 Ethanesulfonic acid, 2-(methylamino)-, N-tall-oil fatty acyl derivs, sodium salts N-Methyl-N-(tall-oil acyl)taurine, sodium salt N-Methyl-N-(tall-oil acyl)taurine, sodium salt (R=tall-oil acyl)

pdb file: 198800.pdb
sdf file: 198800.sdf
directory: 198800


61791-56-8 68648-85-1 Disodium N-tallow-beta-iminodipropionate Disodium tallowiminodipropionate EINECS 263-190-6 N-(2-Carboxyethyl)-N-(tallow acyl)-beta-alanine N-(2-Carboxyethyl)-N-(tallow acyl)-beta-alanine (R=tallow acyl) Sodium N-tallow-beta-iminodipropionate beta-Alanine, N-(2-carboxyethyl)-, N-tallow alkyl derivs, disodium salts beta-Alanine, N-(2-carboxyethyl)-, N-tallow alkyl derivs., disodium salts

pdb file: 198805.pdb
sdf file: 198805.sdf
directory: 198805


61878-61-3 Benzene, methyl-, monochloro mononitro deriv. Chloronitrotoluene Chloronitrotoluene, liquid or solid [UN2433] [Keep away from food] UN2433

pdb file: 198815.pdb
sdf file: 198815.sdf
directory: 198815


1-Propanaminium, 2-hydroxy-N,N,N-trimethyl-, 3-(C12-15-alkyloxy) derivs, chlorides 3-(C12-C15) Alkoxy-2-hydroxypropyltrimethylammonium chloride 3-Alkoxy-2-hydroxypropyl trimethyl ammonium chloride 68187-63-3 EINECS 269-114-8

pdb file: 199134.pdb
sdf file: 199134.sdf
directory: 199134


1593-77-7 31717-87-0 4-Cyclododecyl-2,6-dimethylmorpholine 4-Cyclododecyl-2,6-dimethylmorpholine (8CI)(9CI) Cyclododecane, morpholine deriv. (9CI) Doazine Dodemorph Dodemorph [BSI:ISO] Dodemorphe [ISO-French] EINECS 216-474-9 Meltatox Morpholine, 4-cyclododecyl-2,6-dimethyl-

pdb file: 203792.pdb
sdf file: 203792.sdf
directory: 203792


16047-08-8 2,4,6-Trinitrophenol, sodium salt 3324-58-1 88-89-1 EINECS 222-038-9 NSC 221282 Phenol, 2,4,6-trinitro-, sodium salt Picric acid sodium salt Picric acid, sodium derivative Picric acid, sodium salt (8CI) Sodium 2,4,6-trinitrophenolate Sodium picrate Sodium trinitrophenolate Sodium, (picryloxy)-

pdb file: 203931.pdb
sdf file: 203931.sdf
directory: 203931


5,5,14,14-Tetrabutyl-7,12-dioxo-6,13-dioxa-5,14-distannaoctadecane 6,13-Dioxa-5,14-distannaoctadecane, 5,5,14,14-tetrabutyl-7,12-dioxo- 7437-35-6 Adipic acid, bis(tributylstannyl) deriv. BRN 4031588 Bis(tributyltin) adipate Caswell No. 099A EINECS 231-091-7 EPA Pesticide Chemical Code 083117 Stannane, (adipoyldioxy)bis(tributyl- Tin, (adipoyldioxy)bis(tributyl-

pdb file: 204155.pdb
sdf file: 204155.sdf
directory: 204155


7778-73-6 89417-06-1 Caswell No. 641A EINECS 231-911-3 EPA Pesticide Chemical Code 063002 Pentachlorophenol potassium salt Phenol, pentachloro-, potassium deriv. Phenol, pentachloro-, potassium salt Potassium pentachlorophenate Potassium pentachlorophenolate Potassium pentachlorophenoxide Potassium, (pentachlorophenoxy)-

pdb file: 204198.pdb
sdf file: 204198.sdf
directory: 204198


131553-53-2 17501-44-9 2,4-Pentanedione, Zr deriv. (6CI) 2,4-Pentanedione, zirconium complex 65137-05-5 AC 150 AI3-61036 EINECS 241-510-5 NSC 148120 NSC 4660 Nasemu Zirconium Orgatix ZC 150 Tetraacetylacetonate zirconium Tetrakis(2,4-pentanedionato)zirconium Tetrakis(acetylacetonato)zirconium Tetrakis(acetylacetonyl)zirconium Tetrakis(pentane-2,4-dionato-O,O')zirconium Zirconium acetylacetonate Zirconium tetraacetylacetonate Zirconium tetrakis(acetylacetonate) Zirconium(IV) acetylacetonate Zirconium, acetyl-, acetonate Zirconium, tetrakis(2,4-pentanedionato)- (8CI) Zirconium, tetrakis(2,4-pentanedionato-O,O')- Zirconium, tetrakis(2,4-pentanedionato-O,O')-, (SA-8-11''11''1'1'''1'1''')- Zirconium, tetrakis(2,4-pentanedionato-kappaO,kappaO')-, (SA-8-11''11''1'1'''1'1''')- Zirconium, tetrakis(acetylacetonato)-

pdb file: 204611.pdb
sdf file: 204611.sdf
directory: 204611


(Z)-2-(8-Heptadecenyl)-2-imidazoline-1-ethanol (Z)-2-(8-Heptadecenyl)-4,5-dihydro-1H-imidazole-1-ethanol 1H-Imidazole-1-ethanol, 2-(8-heptadecenyl)-4,5-dihydro-, (Z)- 1H-Imidazole-1-ethanol, 2-(8Z)-8-heptadecenyl-4,5-dihydro- 21652-27-7 62449-07-4 63026-52-8 EINECS 244-501-4 Oleic acid, aminoethylethanolamine, imidazoline deriv.

pdb file: 204697.pdb
sdf file: 204697.sdf
directory: 204697


25567-55-9 Caswell No. 796 EPA Pesticide Chemical Code 063005 Phenol, tetrachloro-, sodium deriv. (6CI) Phenol, tetrachloro-, sodium salt Phenol, tetrachloro-, sodium salt (8CI,9CI) Sodium tetrachlorophenate Sodium tetrachlorophenates (coco alkyl)amine tetrachlorophenates Sodium tetrachlorophenoxide Sodium, (tetrachlorophenoxy)- (7CI)

pdb file: 204830.pdb
sdf file: 204830.sdf
directory: 204830


(4-Threonine)oxytocin 1,2-Dithia-5,8,11,14,17-penaazacycloeicosane, cyclic peptide deriv. 26995-91-5 27115-19-1 4-(L-Threonine)oxytocin Oxytocin, 4-L-threonine- Urofollitropin

pdb file: 204910.pdb
sdf file: 204910.sdf
directory: 204910


28631-86-9 Acetophenone, dihydroxy- Dihydroxy 1-phenylethanone Dihydroxyacetophenone Dioxyacetophenone Ethanone, 1-phenyl-, dihydroxy deriv. FEMA No. 3662

pdb file: 204978.pdb
sdf file: 204978.sdf
directory: 204978


1-Propanamine, 3-(1a,10b-dihydro-6H-dibenzo(3,4:6,7)cyclohept(1,2-b)oxiren-6-ylidene)-N,N-dimethyl- 58256-08-9 6H-Dibenzo(3,4:6,7)cyclohept(1,2-b)oxirene, 1-propanamine deriv. BRN 1385138 Cyclobenzaprine epoxide Cyclobenzaprine-10,11-epoxide

pdb file: 205125.pdb
sdf file: 205125.sdf
directory: 205125


2,4-Dithia-1,3,5,7-tetraazaadamantane, 2,2,4,4-tetraoxide (8CI) 2,6-Dithia-1,3,5,7-tetraazaadamantane, 2,2,6,6-tetraoxide 2,6-Dithia-1,3,5,7-tetraazatricyclo(3.3.1.13,7)decane, 2,2,6,6-tetraoxide (9CI) 2,6-Dithia-1,3,5,7-tetrazatricyclo(3.3.1.1(sup 3,7))decane-2,2,6,6-tetraoxide 4-27-00-09647 (Beilstein Handbook Reference) 80-12-6 BRN 0257816 NSC 172824 TETS Tetramethylenedisulfotetramine Tetramethylenedisulphotetramine Tetramine (adamantane derivative)

pdb file: 206190.pdb
sdf file: 206190.sdf
directory: 206190


2-Methyl-6-methyleneoct-7-en-2-ol, dihydro derivative 53219-21-9 7-Octen-2-ol, 2-methyl-6-methylene-, dihydro deriv. EINECS 258-432-2

pdb file: 207420.pdb
sdf file: 207420.sdf
directory: 207420


(E)-7-((1R,2R,3R)-3-Hydroxy-2-((E)-(3S,5S)-3-hydroxy-5-methyl-1-nonenyl)-5-oxocyclopentyl)-2-heptenoic acid 114868-77-8 17S,20-Dimethyl-trans-delta2-PGE1 compd. with alpha-cyclodextrin 2,4,7,9,12,14,17,19,22,24,27,29-Dodecaoxaheptacyclo(26.2.2.23,6.28,11.213,16.218,21.223,26)detetracontane, alpha-cyclodextrin deriv. 2-Heptenoic acd, 7-((1R,2R,3R)-3-hydroxy-2-((1E,3S,5S)-3-hydroxy-5-methyl-1-nonenyl)-5-oxocyclopentyl)-, (2E)-, compd. with alpha-cyclodextrin 88852-12-4 Limaprost OP 1306 - alpha-cyclodextrin Prosta-2,13-dien-1-oic acid, 11,15-dihydroxy-17,20-dimethyl-9-oxo-, (2E,11alpha,13E,15S,17S)-, compd with alpha-cyclodextrin alpha-Cyclodextrin, compd. with (2E)-7-((1R,2R,3R)-3-hydroxy-2-((1E,3S,5S)-3-hydroxy-5-methyl-1-nonenyl)-5-oxocyclopentyl)-2-heptenoic acid alpha-Cyclodextrin, compd. with (2E,11alpha,13E,15S,17S)-11,15-dihydroxy-17,20-dimethyl-9-oxoprosta-2,13-dien-1-oic acid

pdb file: 207695.pdb
sdf file: 207695.sdf
directory: 207695


1,4,5,8-Tetrahydroxyanthraquinone, leuco derivative 1,4,5,8-Tetrahydroxyanthraquinone, leucoderivative 2,3-Dihydro-1,4,5,8-tetrahydroxyanthraquinone 81-59-4 9,10-Anthracenedione, 2,3-dihydro-1,4,5,8-tetrahydroxy- 9,10-Athracenedione, 2,3-dihydro-1,4,5,8-tetrahydroxy- EINECS 201-364-5 NSC 23122

pdb file: 208566.pdb
sdf file: 208566.sdf
directory: 208566


127-57-1 1334-68-5 Benzenesulfonamide, 4-amino-N-2-pyridinyl-, monosodium salt EINECS 204-850-5 N(sup 1)-2-Pyridylsulfanilamide sodium salt Sodium sulfapymonohydrate Sodium sulfapyridine Sodium sulphapyridine Sodium, (N(sup 1)-2-pyridylsulfanilamido)- Soluble sulfapyridine Soludagenan Sulfanilamide, N(sup 1)-2-pyridyl-, N(sup 1)-sodium deriv. Sulfanilamide, N(sup 1)-2-pyridyl-, monosodium salt Sulfapyridine sodium Sulfapyridine sodium salt monohydrate Sulfapyridine, sodium salt

pdb file: 209518.pdb
sdf file: 209518.sdf
directory: 209518


143-82-8 2,4,6(1H,3H,5H)-Pyrimidinetrione, 5-ethyl-5-(1-methylethyl)-, monosodium salt (9CI) 5-Ethyl-5-isopropylbarbituric acid sodium Barbituric acid, 5-ethyl-5-isopropyl-, sodium deriv Barbituric acid, 5-ethyl-5-isopropyl-, sodium salt Ethypropymalum (acid) Ipral sodium Probarbital sodico [INN-Spanish] Probarbital sodique [INN-French] Probarbital sodium Probarbital sodium [INN] Probarbitale sodico [DCIT] Probarbitalum natricum [INN-Latin] Probarbitone sodium Sodium 5-ethyl-5-isopropylbarbiturate Sodium derivative of 5-ethyl-5-isopropylbarbituric acid Sodium probarbital

pdb file: 209524.pdb
sdf file: 209524.sdf
directory: 209524


144-74-1 2-Sulfanilamidothiazole sodium salt 72-14-0 AI3-26815 Benzenesulfonamide, 4-amino-N-2-thiazolyl-, monosodium salt EINECS 205-638-5 Monosodium 2-sulfanilamidothiazole N(sup 1)-2-Thiazolylsulfanilamide sodium salt Sodium 2-sulfanilamidothiazole Sodium norsulfazole Sodium sulfathiazole Sodium sulphathiazole Sodium, (N(sup 1)-2-thiazolylsulfanilamido)- Soluble sulfathiazole Sulfanilamide, N(sup 1)-2-thiazolyl-, N(sup 1)-sodium deriv. Sulfanilamide, N(sup 1)-2-thiazolyl-, monosodium salt Sulfathiazole sodium

pdb file: 209525.pdb
sdf file: 209525.sdf
directory: 209525


1,3,5,7-Tetraazabicyclo(3.3.1)nonane, 3,7-dinitro- 3,7-Dinitro-1,3,5,7-tetraazabicyclo(3.3.1)nonane 3,7-Dinitro-1,3,5,7-tetraazabicylo(3.3.1)nonane 5-26-11-00043 (Beilstein Handbook Reference) 949-56-4 BRN 0264298 DPT (the tetraazabicyclononane derivative) Dinitropentamethylenetetramine EINECS 213-441-0

pdb file: 212551.pdb
sdf file: 212551.sdf
directory: 212551


2'-Amino-2'-deoxykanamycin 29701-07-3 4-18-00-07631 (Beilstein Handbook Reference) 4696-76-8 Aminodeoxykanamycin Antibiotic derived from Streptomyces kanamyceticus BRN 0061646 Becanamicina [INN-Spanish] Bekanamycin Bekanamycin [INN] Bekanamycine [INN-French] Bekanamycinum [INN-Latin] D-Streptamine, O-3-amino-3-deoxy-alpha-D-glucopyranosyl-(1-4)-O-(2,6-diamino-2,6-dideoxy-alpha-D-glucopyranosyl-(1-6))-2-deoxy- EINECS 225-170-5 Kanamycin B NK 1006 Nebramycin V Nebramycin factor 5

pdb file: 213409.pdb
sdf file: 213409.sdf
directory: 213409


1-Sulfanilyl-2-thiourea derivative of alpha-amino-p-toluenesulfonamide 1161-88-2 EINECS 214-600-7 Marbadal Marbaletten Sulfatolamida [INN-Spanish] Sulfatolamide Sulfatolamide [INN:JAN] Sulfatolamidum [INN-Latin]

pdb file: 213879.pdb
sdf file: 213879.sdf
directory: 213879


3-(3-Allyl-S-cupropseudothioureido)benzoic acid sodium salt 5965-40-2 Allocupreide Sodium Allocupreide sodique [INN-French] Allocupreide sodium [DCF:INN] Allocupreidum natricum [INN-Latin] Alocupreido sodico [INN-Spanish] Benzoic acid, 3-(((2-propenylamino)thioxomethyl)amino)-, monocopper(1+), monosodium salt Benzoic acid, m-((N-allyl-1-mercaptoformimidoyl)amino)-, monocopper(1+) monosodium salt Cu 101 Cupralene Cupralyl sodium Cupralylnatrium Cuprelon Cuprion Cuprothiosinamine m-benzoate sodium Ebesal Natrium 3-(3-allyl-2-cuproisothioureido)benzoate Natrium allocupreid Sodium 3-(3-allyl-S-cuproisothioureido)benzoate Sodium 3-(3-allyl-S-cupropseudothioureido)benzoate m-(((Allylamino)mercaptomethyl)amino)benzoic acid S-copper deriv. sodium salt m-((N-Allyl-1-mercaptoformimidoyl)amino)benzoic acid copper deriv. sodium salt

pdb file: 213936.pdb
sdf file: 213936.sdf
directory: 213936


13870-90-1 5'-Deoxyadenosyl vitamin B12 5-Deoxyadenosylcobalamin Adenosylcobalamin BRN 4122932 Calomide Cobalamine coenzyme Cobamamida [INN-Spanish] Cobamamide Cobamamide [INN:JAN] Cobamamidum [INN-Latin] Cobinamide, O-(5'-deoxyadenosine-5') deriv., hydroxide, dihydrogen phosphate (ester), inner salt, 3'-ester with 5,6-dimethyl-1-alpha-D-ribofuranosylbenzimidazole Coenzyme B12 DBC coenzyme Deoxyadenosylcobalamin Desoxy-5'-adenosine-5'alpha-(dimethyl-5,6-benzimidazolyl)cobamide Dibencozide EINECS 237-627-6 Funacomide Inner salt of the Co-(5'-deoxyadenosine-5') derivative of the 3'-ester of cobinamide phosphate with 5,6-dimethyl-1-alpha-D-ribofuranosylbenzimidazole LM 176 Vitamin B12 coenzyme

pdb file: 213947.pdb
sdf file: 213947.sdf
directory: 213947


10-Methoxy-11-desmethoxyreserpine 10-Methoxydeserpidine 3-beta,20-alpha-Yohimban-16-beta-carboxylic acid, 18-beta-hydroxy-10,17-alpha-dimethoxy-, methyl ester, 3,4,5-trimethoxybenzoate (ester) 3beta,20alpha-Yohimban-16beta-carboxylic acid, 18beta-hydroxy-10,17alpha-dimethoxy-, methyl ester, 3,4,5-trimethoxybenzoate (ester) (8CI) 865-04-3 Canescine 10-methoxyderivative Decaserpil Decaserpyl Decaserpyl plus Deserpidine 10-methoxy deriv Deserpidine, 10-methoxy- EINECS 212-733-5 Methoserpidine Methoserpidine [BAN:DCF:INN] Methoserpidinum [INN-Latin] Metoserpidina [INN-Spanish] Minoran NSC 169423 Neoserpin R 694 Resertene Tenserpina Yohimban-16-carboxylic acid, 10,17-dimethoxy-18-((3,4,5-trimethoxybenzoyl)oxy)-, methyl ester, (3beta,16beta,17alpha,18beta,20alpha)- (9CI)

pdb file: 214073.pdb
sdf file: 214073.sdf
directory: 214073


4,5,6,7-Tetrabrom-1,3,2-benzodioxabismol-2-ol 6915-57-7 Bibrocathin Bibrocathol Bibrocathol [DCF:INN] Bibrocatholum Bibrocatholum [INN-Latin] Bibrocatol Bibrokatol Bismucatebrol Bismuth derivative of tetrabromopyrocatechol EINECS 230-023-3 Keraform Noviform Noviforme Posiformin

pdb file: 214122.pdb
sdf file: 214122.sdf
directory: 214122


13422-55-4 13870-88-7 15417-95-5 15550-62-6 19709-17-2 23319-80-4 35-09-6 Algobaz Cobalt-methylcobalamin Cobamet Cobametin Cobinamide, Co-methyl deriv., hydroxide, dihydrogen phosphate (ester), inner salt, 3'-ester with 5,6-dimethyl-1-alpha-D-ribofuranosyl-1H-benzimidazole Cobinamide, Co-methyl derivative, hydroxide, dihydrogen phosphate (ester), inner salt, 3'-ester with 5,6-dimethyl-1-alpha-D-ribofuranosylbenzimidazole Cobinamide, cobalt-methyl derivative, hydroxide, dihydrogen phosphate (ester), inner salt, 3'-ester with 5,6-dimethyl-1-alpha-D-ribofuranosylbenzimidazole EINECS 236-535-3 MBL-A Mecobalamin Mecobalamin [USAN:BAN:INN:JAN] Mecobalamina [INN-Spanish] Mecobalamine [INN-French] Mecobalaminum [INN-Latin] Methycobal Methyl cobalamine Methyl vitamin B12 Methyl-B12 Methylcobalamin Vancomin

pdb file: 215221.pdb
sdf file: 215221.sdf
directory: 215221


1,10-Phenanthroline, 2,9-dimethyl-4,7-diphenyl-, disulfo deriv, disodium salt 2,9-Dimethyl-4,7-diphenyl-1,10-phenanthroline, disulpho derivative, disodium salt 52698-84-7 73348-75-1 Bathocuproine disulfonic acid, disodium salt Bathocuproinedisulfonic acid disodium salt EINECS 258-111-7 NSC 123541

pdb file: 215349.pdb
sdf file: 215349.sdf
directory: 215349


2270-41-9 ANGUIDINE DERIV SCIRPENTRIOL Anguidol (7CI) BL 5731 NSC 269142 Scirpene-3,4,15-triol Scirpentriol Trichothec-9-ene-3,4,15-triol, 12,13-epoxy-, (3alpha,4beta)- Trichothec-9-ene-3-alpha,4-beta,15-triol, 12,13-epoxy-

pdb file: 215737.pdb
sdf file: 215737.sdf
directory: 215737


1-Propylagroclavine hydrogen (2R,3R)-tartrate 1-Propylagroclavine tartrate 8,9-Didehydro-6,8-dimethyl-1-propylergoline tartrate 89930-60-9 CCRIS 2101 Ergoline, 8,9-didehydro-6,8-dimethyl-1-propyl-, (R-(R*,R*))-2,3-dihydroxybutanedioate (1:1) Indolo(4,3-fg)quinoline, ergoline deriv. NSC 332292

pdb file: 215744.pdb
sdf file: 215744.sdf
directory: 215744


1319-80-8 Bicyclo(2.2.1)heptane, 2,2-dimethyl-3-methylene-, octachloro deriv. Norbornane, 2,2-dimethyl-3-methylene-, octachloro deriv. OCTACHLOROCAMPHENE

pdb file: 216216.pdb
sdf file: 216216.sdf
directory: 216216


1887-02-1 18905-34-5 2,3,5,6-Tetrahydroxy-1,4-benzoquinone, disodium salt 2,5-Cyclohexadiene-1,4-dione, 2,3,5,6-tetrahydroxy-, disodium salt EINECS 217-557-2 M 122 NCI 974 NSC 33520 Tetrahydroxyquinone disodium derivative Tetrahydroxyquinone, disodium salt Tetroquinone disodium derivative p-Benzoquinone, 2,3,5,6-tetrahydroxy-, disodium salt p-Benzoquinone, 2,3,5,6-tetrahydroxy-, disodium salt (8CI) p-Benzoquinone, tetrahydroxy-, disodium deriv.

pdb file: 216906.pdb
sdf file: 216906.sdf
directory: 216906


1066-40-6 2004-14-0 Silanol, trimethyl-, lithium derivative Trimethylsilanol lithium deriv.

pdb file: 217048.pdb
sdf file: 217048.sdf
directory: 217048


2067-58-5 3-13-00-00113 (Beilstein Handbook Reference) BRN 1641056 N,N-Bis(2-chloroethyl)-p-phenylenediamine N,N-Di(2-chloroethyl)-p-phenylenediamine N-(p-Amino-phenyl)-2,2'-dichlorodiethylamine N-(p-Amino-phenyl)-nitrogen mustard Phenylenediamine mustard p-Aminophenyl derivative of nitrogen mustard p-Phenylenediamine, N,N-bis(2-chloroethyl)-

pdb file: 217171.pdb
sdf file: 217171.sdf
directory: 217171


5'-Iatr 6'-Iatr 81235-33-8 Iodoacetamidotetramethylrhodamine TMRIA Tetramethylrhodamine iodoacetamide Xanthylium, 9-(2-carboxyphenyl)-3,6-bis(dimethylamino)-, mono((iodoacetyl)amino) deriv., chloride

pdb file: 217223.pdb
sdf file: 217223.sdf
directory: 217223


(Trimethoxysilyl)ethene 119684-24-1 2768-02-7 4-04-00-04256 (Beilstein Handbook Reference) A 171 A 171 (Silane derivative) BRN 1099136 EINECS 220-449-8 Ethenyltrimethoxysilane KBM 1003 SZ 6300 Silane, ethenyltrimethoxy- Silane, trimethoxyvinyl- Trimethoxyvinylsilane V 4917 VTS-M Vinyl trimethoxy silane Vinyltrimethoxysilane Y 4302

pdb file: 218221.pdb
sdf file: 218221.sdf
directory: 218221


(2S,6S,7aS,7R)-2,6-Diphenyl-7-[(4-phenylpiperidyl)methyl]perhydro-3-oxapyrrolizine AIDS-122219 AIDS122219 Isoxazolidine deriv

pdb file: 218614.pdb
sdf file: 218614.sdf
directory: 218614


(2S,6S,7aS,7R)-2,6-Diphenyl-7-{[4-(3-phenylpropyl)piperidyl]methyl}perhydro-3-oxapyrrolizine AIDS-122220 AIDS122220 Isoxazolidine deriv

pdb file: 218615.pdb
sdf file: 218615.sdf
directory: 218615


AIDS-122221 AIDS122221 Isoxazolidine deriv N-{1-[((2S,6S,7aS,1R)-2,6-Diphenylperhydro-5-oxapyrrolizinyl)methyl](4-piperidyl)}-N-ethyl(phenylmethoxy)carboxamide

pdb file: 218616.pdb
sdf file: 218616.sdf
directory: 218616


AIDS-122222 AIDS122222 Isoxazolidine deriv N-{1-[((2S,6S,7aS,1R)-2,6-Diphenylperhydro-5-oxapyrrolizinyl)methyl](4-piperidyl)}[(4-nitrophenyl)methoxy]-N-prop-2-enylcarboxamide

pdb file: 218617.pdb
sdf file: 218617.sdf
directory: 218617


(2S,7S,7aS,6R)-2,7-Diphenyl-6-[(4-phenylpiperidyl)methyl]perhydro-3-oxapyrrolizine AIDS-122223 AIDS122223 Isoxazolidine deriv

pdb file: 218618.pdb
sdf file: 218618.sdf
directory: 218618


(2S,7S,7aS,6R)-2,7-Diphenyl-6-{[4-(3-phenylpropyl)piperidyl]methyl}perhydro-3-oxapyrrolizine AIDS-122224 AIDS122224 Isoxazolidine deriv

pdb file: 218619.pdb
sdf file: 218619.sdf
directory: 218619


AIDS-122225 AIDS122225 Isoxazolidine deriv N-{1-[((1S,6S,7aS,2R)-1,6-Diphenylperhydro-5-oxapyrrolizin-2-yl)methyl](4-piperidyl)}-N-ethyl(phenylmethoxy)carboxamide

pdb file: 218620.pdb
sdf file: 218620.sdf
directory: 218620


AIDS-122226 AIDS122226 Isoxazolidine deriv N-{1-[((1S,6S,7aS,2R)-1,6-Diphenylperhydro-5-oxapyrrolizin-2-yl)methyl](4-piperidyl)}[(4-nitrophenyl)methoxy]-N-prop-2-enylcarboxamide

pdb file: 218621.pdb
sdf file: 218621.sdf
directory: 218621


(12S,7aS,13R)-12-Phenyl-13-[(4-phenylpiperidyl)methyl]spiro[cyclohexane-1,2'-perhydro-3'-oxapyrrolizine] AIDS-122227 AIDS122227 Isoxazolidine deriv

pdb file: 218622.pdb
sdf file: 218622.sdf
directory: 218622


(12S,7aS,13R)-12-Phenyl-13-{[4-(3-phenylpropyl)piperidyl]methyl}spiro[cyclohexane-1,2'-perhydro-3'-oxapyrrolizine] AIDS-122228 AIDS122228 Isoxazolidine deriv

pdb file: 218623.pdb
sdf file: 218623.sdf
directory: 218623


AIDS-122229 AIDS122229 Isoxazolidine deriv N-{1-[((8S,7aS,7R)-8-Phenylspiro[cyclohexane-1,6'-perhydro-5'-oxapyrrolizine]-7-yl)methyl](4-piperidyl)}-N-ethyl(phenylmethoxy)carboxamide

pdb file: 218624.pdb
sdf file: 218624.sdf
directory: 218624


AIDS-122230 AIDS122230 Isoxazolidine deriv N-{1-[((8S,7aS,7R)-8-Phenylspiro[cyclohexane-1,6'-perhydro-5'-oxapyrrolizine]-7-yl)methyl](4-piperidyl)}[(4-nitrophenyl)methoxy]-N-prop-2-enylcarboxamide

pdb file: 218625.pdb
sdf file: 218625.sdf
directory: 218625


(13S,7aS,12R)-13-Phenyl-12-[(4-phenylpiperidyl)methyl]spiro[cyclohexane-1,2'-perhydro-3'-oxapyrrolizine] AIDS-122232 AIDS122232 Isoxazolidine deriv

pdb file: 218627.pdb
sdf file: 218627.sdf
directory: 218627


(13S,7aS,12R)-13-Phenyl-12-{[4-(3-phenylpropyl)piperidyl]methyl}spiro[cyclohexane-1,2'-perhydro-3'-oxapyrrolizine] AIDS-122233 AIDS122233 Isoxazolidine deriv

pdb file: 218628.pdb
sdf file: 218628.sdf
directory: 218628


AIDS-122234 AIDS122234 Isoxazolidine deriv N-{1-[((7S,7aS,8R)-7- Phenylspiro[cyclohexane-1,6'-perhydro-5'-oxapyrrolizine]-8-yl)methyl](4-piperidyl)}-N-ethyl(phenylmethoxy)carboxamide

pdb file: 218629.pdb
sdf file: 218629.sdf
directory: 218629


4-Fluorobenzaldehyde, S-ethylisothiosemicarbazone AIDS-122495 AIDS122495 S-alkylisothiosemicarbazone deriv

pdb file: 218886.pdb
sdf file: 218886.sdf
directory: 218886


4-Trifluoromethylbenzaldehyde, S-ethylisothosemicarbazone AIDS-122496 AIDS122496 S-alkylisothiosemicarbazone deriv

pdb file: 218887.pdb
sdf file: 218887.sdf
directory: 218887


3-Pyridincarboxyaldehyde, S-benzylisothiosemicarbazone AIDS-122505 AIDS122505 S-alkylisothiosemicarbazone deriv

pdb file: 218896.pdb
sdf file: 218896.sdf
directory: 218896


4-Pyridincarboxyaldehyde, S-benzylisothiosemicarbazone AIDS-122506 AIDS122506 S-alkylisothiosemicarbazone deriv

pdb file: 218897.pdb
sdf file: 218897.sdf
directory: 218897


6H-Purin-6-one, 2-amino-1,9-dihydro-9-[[2-[(8-methyl-2-oxido-4H-1,3,2-benzodioxaphosphin-2-yl)oxy]ethoxy]methyl]- AIDS-122710 AIDS122710 cycloSal derivatives of ACV

pdb file: 219098.pdb
sdf file: 219098.sdf
directory: 219098


6H-Purin-6-one, 2-amino-1,9-dihydro-9-[[2-[(6-methyl-2-oxido-4H-1,3,2-benzodioxaphosphin-2-yl)oxy]ethoxy]methyl]- AIDS-122711 AIDS122711 cycloSal derivatives of ACV

pdb file: 219099.pdb
sdf file: 219099.sdf
directory: 219099


9H-Purine-2,6-diamine, N6-cyclopropyl-9-[4-[[(8-methyl-2-oxido-4H-1,3,2-benzodioxaphosphin-2-yl)oxy]methyl]-2-cyclopenten-1-yl]- AIDS-122713 AIDS122713 cycloSal derivatives of ABC

pdb file: 219101.pdb
sdf file: 219101.sdf
directory: 219101


9H-Purine-2,6-diamine, N6-cyclopropyl-9-[4-[[(2-oxido-4H-1,3,2-benzodioxaphosphin-2-yl)oxy]methyl]-2-cyclopenten-1-yl]- AIDS-122714 AIDS122714 cycloSal derivatives of ABC

pdb file: 219102.pdb
sdf file: 219102.sdf
directory: 219102


9H-Purine-2,6-diamine, N6-cyclopropyl-9-[4-[[(6-methoxy-2-oxido-4H-1,3,2-benzodioxaphosphin-2-yl)oxy]methyl]-2-cyclopenten-1-yl]- AIDS-122715 AIDS122715 cycloSal derivatives of ABC

pdb file: 219103.pdb
sdf file: 219103.sdf
directory: 219103


9H-Purine-2,6-diamine, 9-[4-[[(6-chloro-2-oxido-4H-1,3,2-benzodioxaphosphin-2-yl)oxy]methyl]-2-cyclopenten-1-yl]-N6-cyclopropyl- AIDS-122716 AIDS122716 cycloSal derivatives of ABC

pdb file: 219104.pdb
sdf file: 219104.sdf
directory: 219104


6H-Purin-6-one, 2-amino-1,9-dihydro-9-[4-[[(8-methyl-2-oxido-4H-1,3,2-benzodioxaphosphin-2-yl)oxy]methyl]-2-cyclopenten-1-yl]- AIDS-122717 AIDS122717 cycloSal derivatives of CBV

pdb file: 219105.pdb
sdf file: 219105.sdf
directory: 219105


3H-Naphtho[1',8a':5,6]pyrano[2,3-e]isoindol-3-one, 11-(acetyloxy)-1,2,6,6a,7,8,9,9a,10,11,12,13-dodecahydro-5-methoxy-6a,7,10,10-tetramethyl-, (6aR,7S,9aS,11S,13aS)- AIDS-122732 AIDS122732 Stachyflin deriv.

pdb file: 219117.pdb
sdf file: 219117.sdf
directory: 219117


AIDS-122868 AIDS122868 HL18 Lysozyme derived-peptide NH2-Arg-Val-Val-Arg-Asp-Pro-Gln-Gly-Ile-Arg-Ala-Trp-Val-Ala-Trp-Arg-Asn-Arg-COOH RVVRDPQGIRAWVAWRNR

pdb file: 219239.pdb
sdf file: 219239.sdf
directory: 219239


6H-Purin-6-one, 2-amino-1,9-dihydro-9-[4-[[(8-methyl-2-oxido-4H-1,3,2-benzodioxaphosphin-2-yl)oxy]methyl]-2-cyclopenten-1-yl]- AIDS-122922 AIDS122922 cycloSal derivatives of CBV

pdb file: 219290.pdb
sdf file: 219290.sdf
directory: 219290


6H-Purin-6-one, 2-amino-1,9-dihydro-9-[4-[[(8-methyl-2-oxido-4H-1,3,2-benzodioxaphosphin-2-yl)oxy]methyl]-2-cyclopenten-1-yl]- AIDS-122923 AIDS122923 cycloSal derivatives of CBV

pdb file: 219291.pdb
sdf file: 219291.sdf
directory: 219291


22600-28-8 AIDS-127010 AIDS127010 DIBENZOYLFURAN DERIV Furan, 3-piperonyloyl-4-(3,4, 5-trimethoxybenzoyl)- NSC136513

pdb file: 222950.pdb
sdf file: 222950.sdf
directory: 222950


4-(4-Methoxybenzyl)-5-methylbenzo-1,2-quinone AIDS-128374 AIDS128374 NSC269112 OBTUSAQUINONE DERIV JURD 2289

pdb file: 224312.pdb
sdf file: 224312.sdf
directory: 224312


6-(4-Methoxybenzylidene)-1,3-benzodioxol-5(6H)-one 63194-80-9 AIDS-128375 AIDS128375 NSC269129 OBTUSAQUINONE DERIV JURD 2351

pdb file: 224313.pdb
sdf file: 224313.sdf
directory: 224313


2-(3-(Hydroxy(oxido)amino)phenyl)-6-((3-methoxypropyl)amino)-4-oxo-3,4-dihydro-2H-1,3-thiazine-5-carbonitrile 2H-1,3-Thiazine-5-carbonitrile, 3, {4-dihydro-6-[(3-methoxypropyl)amino]-2-(3-nitrophenyl)-4-oxo-} AIDS-128838 AIDS128838 NSC300542 THIAZINE-5CARBONITRILE DERIV

pdb file: 224776.pdb
sdf file: 224776.sdf
directory: 224776


17-Des-O-methyl-17-cyclopropylamino-geldanamycin 19-(Cyclopropylamino)-13-hydroxy-8,14-dimethoxy-4,10,12,16-tetramethyl-3,20,22-trioxo-2-azabicyclo[16.3.1]docosa-1(21),4,6,10,18-pentaen-9-yl carbamate 71952-91-5 AIDS-129022 AIDS129022 GELDANAMYCIN DERIV NSC320876

pdb file: 224960.pdb
sdf file: 224960.sdf
directory: 224960


(6-(4-Hydroxy(methyl)anilino)-8a-methoxy-5-methyl-4,7-dioxo-1,1a,2,4,7,8,8a,8b-octahydroazireno[2',3':3,4]pyrrolo[1,2-a]indol-8-yl)methyl carbamate AIDS-129748 AIDS129748 MITOMYCIN C DERIV NSC364158 {Azirino[2',3':3,4]pyrrolo[1,2-a]indole-4,7-dione,} {8-[[(aminocarbonyl)oxy]methyl]-1,1a,2,8,8a,} {8b-hexahydro-6-[(4-hydroxyphenyl)methylamino]-8a-methoxy-5-methyl-} , {[1aR-(1a.alpha.,8.beta.,8a.alpha.,8b.alpha.)]-} {Azirino[2',3':3,} {4]pyrrolo[1,2-a]indole-4,7-dione,} {8-[[(aminocarbonyl)oxy]methyl]-1,1a,2,8,8a,} {8b-hexahydro-6-[(4-hydroxyphenyl)methylamino]-8a-methoxy-5-methyl,} {[1aR-(1a.alpha.,8.beta.,8a.alpha.,8b.alpha.)]-}

pdb file: 225697.pdb
sdf file: 225697.sdf
directory: 225697


79087-89-1 AIDS-129842 AIDS129842 CINNAMIC ACID, TRANS-INDOLIN-2-ONE-3-YL-ETHYLAMINO DERIV N-(2-(3-Hydroxy-2-oxo-2,3-dihydro-1H-indol-3-yl)ethyl)-3-phenylacrylamide NSC369856

pdb file: 225791.pdb
sdf file: 225791.sdf
directory: 225791


7-Methoxy-2-(4-methoxyphenyl)-3-phenyl-2,3-dihydro-4H-chromen-4-one AIDS-130691 AIDS130691 Chromanone 2 Chromanone derivative NSC609556

pdb file: 226639.pdb
sdf file: 226639.sdf
directory: 226639


(4-(1-Hydroxy-4-methyloctylidene)-3,5-dioxotetrahydro-2-furanyl)acetic acid AIDS-137114 AIDS137114 NSC640740 Tetrahydro derivative of italicinic acid

pdb file: 233062.pdb
sdf file: 233062.sdf
directory: 233062


(3-Hydroxy-4-(4-methyloctyl)-5-oxo-2,5-dihydro-2-furanyl)acetic acid AIDS-137115 AIDS137115 Deoxytetrahydro derivative NSC640741

pdb file: 233063.pdb
sdf file: 233063.sdf
directory: 233063


1,4-Diazabicyclo[2.2.1]heptane, 1,4-diazoniabicyclo[2.2.1]heptane deriv. 1,4-Diazoniabicyclo[2.2.1]heptane, 1,4-bis(2-chloroethyl)-, (Z)-2-butenedioate (1:1) 1,4-Diazoniabicyclo[2.2.1]heptane, 1,4-bis(2-chloroethyl)-,(Z)-2-butenedioate (1:2) 2-Butenedioic acid, (Z)-, ion(1-), 1,4-bis(2-chloroethyl)-1,4-diazoniabicyclo[2.2.1]heptane (2:1) 73387-70-9 DIAZABICYCLOHEPTANE DERIVATIVE NSC262666

pdb file: 300058.pdb
sdf file: 300058.sdf
directory: 300058


2H-1,2,4-Benzothiadiazine-7-sulfonamide, 6-chloro-3-(cyclopentylmethyl)-3,4-dihydro-, 1,1-dioxide 2H-1,2,4-Benzothiadiazine-7-sulfonamide, 6-chloro-3-(cyclopentylmethyl)-3,4-dihydro-,1,1-dioxide 3-Cyclopentylmethyl hydrochlorothiazide deriv 6-Chloro-3-(cyclopentylmethyl)-3,4-dihydro-2H-1,2,4-benzothiadiazine-7-sulfonamide 1,1-dioxide 742-20-1 Benesal Ciba 8341-Su Cyclomethiazide Cyclometiazid Cyclopenthiazide Cyclopentiazid NSC107679 Navidreks Navidrex Navidrix Salimed Salimid Salurilo-C Su 8341 Su-8341 Tsiklometiazid (cyclomethiazide) Ultra-Minzil WLN: T66 BSWM EM DHJ HG ISZW D1- AL5TJ

pdb file: 407404.pdb
sdf file: 407404.sdf
directory: 407404


2-Naphthacenecarboxamide, 4-(dimethylamino)-1,4,4a,5,5a,6,11,12a-octahydro-3,6,10,12,12a-pentahydroxy-6-methyl-1,11-dioxo- 2-Naphthacenecarboxamide, 4-(dimethylamino)-1,4,4a,5,5a,6,11,12a-octahydro-3,6,10,12,12a-pentahydroxy-6-methyl-1,11-dioxo-, [4S-(4.alpha.,4a.alpha.,5a.alpha.,6.beta.,12a.alpha.)]- 6-Methyl-1,11-dioxy-2-naphthacenecarboxamide 60-54-8 Abramycin Achromycin Achromycin, naphthacene derivative Agromicina Ambramicina Ambramycin Biocycline Bristaciclin .alpha. Bristaciclina Bristacycline Cefracycline Centet (base) Ciclibion Copharlan Criseociclina Cyclomycin Deschlorobiomycin Hostacyclin Lemtrex (base) Lexacycline Liquamycin, veterinary Mericycline NSC108579 Neocycline Oletetrin Omegamycin Orlycycline Panmycin Piracaps (base) Polycycline Polycycline, antibiotic Purocyclina Robitet Roviciclina SK-Tetracycline Sanclomycine Sigmamycin Steclin T-125 Tetra-Co Tetrabon Tetracycline Tetracycline I Tetracycline II Tetracyn Tetradecin Tetrafil Tetraverine Tsiklomitsin Veracin Vetacyclinum Vetquamycin-324 (free base) WLN: L E6 C666 BV FV CU GUTTT&J DQ EQ GVZ HQ IN1&1 MQ M1 RQ component of Mysteclin-F component of Talsutin component of Tetrastatin

pdb file: 407983.pdb
sdf file: 407983.sdf
directory: 407983


101-76-8 4,4'-Dichlorodiphenylmethane Benzene, 1,1'-methylenebis[4-chloro- Bis(p-chlorophenyl)methane DBM (the methane derivative) DDM DDM (degradation product) Di(4-chlorophenyl)methane Di(p-chlorophenyl)methane Methane, bis(4-chlorophenyl)- Methane, bis(p-chlorophenyl)- NSC109556 WLN: GR D1R DG p,p'-Dichlorodiphenylmethane

pdb file: 408711.pdb
sdf file: 408711.sdf
directory: 408711


CYTOSINE, 1-B-D-ARABINOFURANOSYL-3-METHYL DERIV NSC112902 U 22169E

pdb file: 410351.pdb
sdf file: 410351.sdf
directory: 410351


BENZODIXANTHENE-2,10-DIONE DERIV NSC118105

pdb file: 413386.pdb
sdf file: 413386.sdf
directory: 413386


7041-61-4 Antibiotic T 9 Azirino[2',3':3,4]pyrrolo[1,2-.alpha.]indole-4,7-dione, 1,1a,2,8,8a,8b-hexahydro-6-hydroxy-8-(hydroxymethyl)-8a-methoxy-5-methyl-, 8-carbamate MITOMYCIN DERIV T-9 Mitomycin C deriv. T-9 Mitomycin deriv. T 9 NSC123105

pdb file: 416668.pdb
sdf file: 416668.sdf
directory: 416668


79026-43-0 Antibiotic T 20 MITOMYCIN DERIV T-20 Mitomycin derivative T 20 NSC123106

pdb file: 416669.pdb
sdf file: 416669.sdf
directory: 416669


Antibiotic T 34 Azirino[2',3':3,4]pyrrolo[1,2-a]indole-4,7-dione, 1,1a,2,8,8a,8b-hexahydro-8-(hydroxymethyl)-8a-methoxy-5-methyl-6-piperidino-, acetate (ester) MITOMYCIN DERIV T-34 Mitomycin derivative T 34 NSC123107

pdb file: 416670.pdb
sdf file: 416670.sdf
directory: 416670


27066-48-4 Azirino[2',3':3,4]pyrrolo[1,2-a]indole-4,7-dione, 8-[[(aminocarbonyl)oxy]methyl]-1,1a,2,8,8a,8b-hexahydro-6-[(2-hydroxyethyl)amino]-8a-methoxy-5-methyl- MITOMYCIN DERIV T-38 Mitomycin derivative T 38 NSC123108 T 38

pdb file: 416671.pdb
sdf file: 416671.sdf
directory: 416671


MITOMYCIN DERIV T-39 Mitomycin derivative T 39 NSC123109 T 39

pdb file: 416672.pdb
sdf file: 416672.sdf
directory: 416672


21448-82-8 MITOMYCIN DERIV T-41 Mitomycin derivative T 41 NSC123110 T 41

pdb file: 416673.pdb
sdf file: 416673.sdf
directory: 416673


Azirino[2',3':3,4]pyrrolo[1,2-a]indole-4,7-dione, 1,1a,2,8b-tetrahydro-8-(hydroxymethyl)-6-methoxy-1,5-dimethyl-, carbamate (ester) MITOMYCIN DERIV T-53 Mitomycin derivative T 53 NSC123111 T 53

pdb file: 416674.pdb
sdf file: 416674.sdf
directory: 416674


MITOMYCIN DERIV T-56 Mitomycin derivative T 56 NSC123112 T 56

pdb file: 416675.pdb
sdf file: 416675.sdf
directory: 416675


MITOMYCIN DERIV T-57 Mitomycin derivative T 57 NSC123113 T 57

pdb file: 416676.pdb
sdf file: 416676.sdf
directory: 416676


MITOMYCIN DERIV T-58 Mitomycin derivative T 58 NSC123114 T 58

pdb file: 416677.pdb
sdf file: 416677.sdf
directory: 416677


16910-79-5 Azirino[2',3':3,4]pyrrolo[1,2-a]indole-4,7-dione, 1,1a,2,8,8a,8b-hexahydro-8-(hydroxymethyl)-8a-methoxy-5-methyl-6-(propylamino)-, carbamate (ester) MITOMYCIN DERIV T-73 Mitomycin derivative T 73 NSC123115 See replacing CAS registry number: 16910-79-5 T 73

pdb file: 416678.pdb
sdf file: 416678.sdf
directory: 416678


MITOMYCIN DERIV T-77 Mitomycin derivative T 77 NSC123116 T 77

pdb file: 416679.pdb
sdf file: 416679.sdf
directory: 416679


MITOMYCIN DERIV T-78 Mitomycin derivative T 78 NSC123117 T 78

pdb file: 416680.pdb
sdf file: 416680.sdf
directory: 416680


NAPHTHOPYRANONE DERIV NSC123386 Naphthopyranone derivative

pdb file: 416865.pdb
sdf file: 416865.sdf
directory: 416865


33069-62-4 7,11-Methano-5H-cyclodeca[3,4]benz[1,2-b]oxete,benzenepropanoic acid deriv. Benzenepropanoic acid, .beta.-(benzoylamino)- .alpha.-hydroxy-, 6,12b-bis(acetyl oxy)-12-(benzoyloxy)- 2a,3,4,4a,5,6,9,10,11,12,12a,12b,- dodecahydro-4,11- dihydroxy-4a,8,13,13-tetramethyl-5-oxo- 7,11-methano- 1H-cyclodeca[3,4]benz[1,2-b]oxet-9-yl ester, [2aR- [2a.alpha.,4.beta.,4a.beta.,6.beta.,9.alpha.(alpha. R*,.beta.S*),11.alpha.,12.alpha.,12a.alpha.,12b.alpha.]]- NSC125973 PACLITAXEL Tax-11-en-9-one, 5.beta.,20-epoxy-1,2.alpha.,4,7.beta., 10.beta.,13.alpha.- hexahydroxy-, 4,10-diacetate 2- benzoate,13-ester with (2R,3S)-N-benzoyl-3-phenylisoserine Taxol.RTM. (Registered Trademark)

pdb file: 418145.pdb
sdf file: 418145.sdf
directory: 418145


31368-48-6 Benzenesulfonyl fluoride, 3-chloro-4-[4-[2-chloro-4-(4,6-diamino-2,2-dimethyl-1,3,5-triazin-1(2H)-yl)phenyl]butyl]-, monoethanesulfonate Dihydrotriazine derivative Ethanesulfonic acid, compd. with 3-chloro-4-[4-[2-chloro-4-(4,6-diamino-2,2-dimethyl-1,3,5-triazin-1(2H)-yl)phenyl]butyl]benzenesulfonyl fluoride (1:1) Ethanesulfonic acid, compd. with 3-chloro-4-[4-[2-chloro-4-(4,6-diamino-2,2-dimethyl-s-triazin-1(2H)-yl)phenyl]butyl]benzenesulfonyl fluoride Ethanesulfonic acid, compd. with 3-chloro-4-[4-[2-chloro-4-(4,6-diamino-2,2-dimethyl-s-triazin-1(2H)-yl)phenyl]butyl]benzenesulfonyl fluoride (1:1) NSC-127755 NSC127755

pdb file: 419326.pdb
sdf file: 419326.sdf
directory: 419326


(+)-Pinitol 10284-63-6 D-(+)-Pinitol D-Pinitol D-chiro-Inositol, 3-O-methyl- Inositol, 3-O-methyl-, D-chiro- Matezit NSC128700 Pinit Pinite (inositol derivative) Pinitol Pinitol, (+)- Sennit Sennitol

pdb file: 419906.pdb
sdf file: 419906.sdf
directory: 419906


2750-76-7 Acetamide, 2-[(1,2-dihydro-5,6,17,19,21-pentahydroxy-23-methoxy-2,4,12,16,18,20,22-heptamethyl-1,11-dioxo-2,7-(epoxypentadeca[1,11,13]trienimino)naphtho[2,1-b]furan-9-yl)oxy]-N,N-diethyl-, 21-acetate Acetamide, 2-[(1,2-dihydro-5,6,17,19,21-pentahydroxy-23-methoxy-2,4,12,16,18,20,22-heptamethyl-1,11-dioxo-2,7-(epoxypentadeca[1,11,13]trienimino)naphtho[2,1-b]furan-9-yl]oxy]-N,N-diethyl-, 21-acetate M 14 M/14 N,N-Diethylrifamycin B amide NCI 143-418 NSC-133099 NSC133099 RF M14 RIFAMIDE Rf m-14 Rifamide(USAN Rifampicin M/14 Rifamycin B N,N-diethylamide Rifamycin B N,N-diethylamide derivative Rifamycin B diethylamide Rifamycin B, N,N-diethylamide Rifamycin M-14 Rifamycin M14 Rifamycin diethylamide Rifamycin, 4-O-[2-(diethylamino)-2-oxoethyl]- Rifomide Rifomycin B diethylamide Rifomycin M14 Stereoisomer of N,N-Diethyl-2-[(1,2-dihydro-5,6,17,19,21-pentahydroxy-23-methoxy-2,4,12,16,18,20,22-heptamethyl-1,11-dioxo-2,7-(epoxypentadeca[1,11,13]trienimino)naphtho[2,1-b]furan-9-yl)oxy]acetamide 21-acetate WLN: O1 A&1 WLN: T-24-5 B6 C6 A D E 2BC G& AV GMV WO B&O IU KU UU A&HT&&&J DO1VN2&2 I1 M1 NQ O1 PQ Q1 ROV1 S1 T

pdb file: 422309.pdb
sdf file: 422309.sdf
directory: 422309


Carbamic acid, (2-hydroxyethyl)-, (6-amino-1,1a,2,4,7,8,8a,8b-octahydro-8a-methoxy-5-methyl-4,7-dioxoazirino[2',3':3,4]pyrrolo[1,2-a]indol-8-yl)methyl ester, [1aR-(1a.alpha.,8.beta.,8a.alpha.,8b.alpha.)]- Carbamic acid, (2-hydroxyethyl)-, ester with 6-amino-1,1a,2,8,8a,8b-hexahydro-8-(hydroxymethyl)-8a-methoxy-5-methylazirino[2',3':3,4]-pyrrolo[1,2-a]indole-4,7-dione K 35 K-35 MITOMYCIN C Mitomycin C, K-35 deriv. NSC134727

pdb file: 423375.pdb
sdf file: 423375.sdf
directory: 423375


53526-62-8 Marine steroid PtAmC NSC135051 PtAmC RLS-2-35-1 SECOPREGNENONE DERIV ATAMC

pdb file: 423588.pdb
sdf file: 423588.sdf
directory: 423588


22600-28-8 DIBENZOYLFURAN DERIV Furan, 3-piperonyloyl-4-(3,4,5-trimethoxybenzoyl)- NSC136513

pdb file: 424386.pdb
sdf file: 424386.sdf
directory: 424386


1301-01-5 Bentrofene Diaminodiphenylsulfone-N-acetic acid morpholine salt Glycine, N-[(phenylsulfonyl)phenyl]-, amino deriv., compd. with morpholine (1:1) Glycine, N-[(phenylsulfonyl)phenyl]-, monoamino deriv., compd. with morpholine (1:1) Glycine, N-[[(aminophenyl)sulfonyl]phenyl]-, compd. with morpholine (1:1) Morpholine, compd. with N-[(phenylsulfonyl)phenyl]glycine amino deriv. (1:1) Morpholinium acediasulfone NSC141249

pdb file: 426964.pdb
sdf file: 426964.sdf
directory: 426964


70857-52-2 NSC145150 PENTALENOPYRAN-5-CARBOXYLIC ACID DERIV Pentaleno[1,6a-c]pyran-5-carboxylic acid, 1,2,4,4a,6a,7-hexahydro-7,8-dimethyl-1-methylene-2-oxo- U 36699

pdb file: 428898.pdb
sdf file: 428898.sdf
directory: 428898


2H-3,11c-(Epoxymethano)phenanthro[10,1-bc]pyran, picras-3-en-21-oic acid deriv. 41451-75-6 BRUCEANTIN NSC 165563 NSC165563 Picras-3-en-21-oic acid, 15-[(3,4-dimethyl-1-oxo-2-pentenyl)oxy]-13,20-epoxy-3,11,12-trihydroxy-2,16-dioxo-, methyl ester [11.beta.,12.alpha.,15.beta.(E]- Picras-3-en-21-oic acid, 15-[(3,4-dimethyl-1-oxo-2-pentenyl)oxy]-13,20-epoxy-3,11,12-trihydroxy-2,16-dioxo-, methyl ester, (11.beta.,12.alpha.,15.beta.(E))- Picras-3-en-21-oic acid, 15-[(3,4-dimethyl-1-oxo-2-pentenyl)oxy]-13,20-epoxy-3,11,12-trihydroxy-2,16-dioxo-, methyl ester, [11.beta.,12.alpha.,15.beta.(E)]-

pdb file: 439752.pdb
sdf file: 439752.sdf
directory: 439752


2H,4H-Indolo[7a,1-a](2)benzazepine, 8,9,12-trimethoxy-, C-homoerythrinan deriv 38750-53-7 C-Homoerythrinan, 1,6-didehyhro-3,15,16-trimethoxy-,(3-alpha)- NSC166068

pdb file: 440107.pdb
sdf file: 440107.sdf
directory: 440107


(-)-10-Methoxydeserpidine 10-MD 10-Methoxy-11-desmethoxyreserpine 10-Methoxydeserpidine 3.beta.,20.alpha.-Yohimban-16.beta.-carboxylic acid, 18.beta.-hydroxy-10,17.alpha.-dimethoxy-, methyl ester, 3,4,5-trimethoxybenzoate (ester) 3.beta.,20.alpha.-Yohimban-16.beta.-carboxylic acid, 18.beta.-hydroxy-10,17.alpha.-dimethoxy-,methyl ester, 3,4,5-trimethoxybenzoate (ester) 865-04-3 Canescine 10-methoxyderivative Deaserpyl Decaserpil Decaserpin Decaserpine Decaserpyl Decoserpyl Deserpidine, 10-methoxy- Methoserpedine Methoserpidine Minoran NSC169423 Neoserpin Resertene Tenserpina WLN: T F6 D5 C666 EM ON&&TTTJ JO1 SOVR CO1 DO1 EO1& TO1 UVO1 Yohimban-16-carboxylic acid, 10,17-dimethoxy-18-[(3,4,5-trimethoxybenzoyl)oxy]-, methyl ester, (3.beta.,16.beta.,17.alpha.,18.beta.,20.alpha.)-

pdb file: 442221.pdb
sdf file: 442221.sdf
directory: 442221


2,4-Dithia-1,3,5,7-tetraazaadamantane, 2,2,4,4-tetraoxide 2,6-Dithia-1,3,5,7-tetraazaadamantane, 2,2,6,6-tetraoxide 2,6-Dithia-1,3,5,7-tetraazatricyclo[3.3.1.13,7]decane, 2,2,6,6-tetraoxide 2,6-Dithia-1,3,5,7-tetrazatricyclo[3.3.1.1(sup 3,7)]decane-2,2,6,6-tetroxide 80-12-6 NSC172824 TETS Tetramethylenedisulfotetramine Tetramethylenedisulphotetramine Tetramine Tetramine (adamantane derivative) WLN: T66 B6 A B- C 1B I ASWN DNSWN HNTJ

pdb file: 444285.pdb
sdf file: 444285.sdf
directory: 444285


64862-96-0 9,10-Anthracenedione, 1,4-bis[[2-[(2-hydroxyethyl)amino]ethyl]amino]- Ametantrone Anthracenedione deriv. NSC 287513 NSC196473

pdb file: 450256.pdb
sdf file: 450256.sdf
directory: 450256


1,3-Propanediamine, N,N-diethyl-N'-(6-methyl-5H-pyrido[3',4':4,5]pyrrolo[2,3-g]isoquinolin-10-yl)- 5H-Pyrido[3',4':4,5]pyrrolo[2,3-g]isoquinoline, 1,3-propanediamine deriv. 65222-35-7 ELLIPTICINE DERIV, PASTEUR NSC303565

pdb file: 453280.pdb
sdf file: 453280.sdf
directory: 453280


LUTEOLIN DERIV NSC304427

pdb file: 453486.pdb
sdf file: 453486.sdf
directory: 453486


2269-44-5 ANGUIDINE, 3 KETO BL-5846 NSC305217 Spiro(2,5-methano-1-benzoxepin-10,2'-oxirane), trichothec-9-en-3-one deriv. Trichothec-9-en-3-one, 4,15-bis(acetyloxy)-12,13-epoxy-, (4.beta.)-

pdb file: 453687.pdb
sdf file: 453687.sdf
directory: 453687


77620-45-2 ANGUIDINE DER.(4,15-DI(CHLOROACETOXY)SCIRPENE-3-OL) BL-5867 NSC305218 Spiro(2,5-methano-1-benzoxepin-10,2'-oxirane), trichothec-9-ene-3,4,15-triolderiv. Trichothec-9-ene-3,4,15-triol, 12,13-epoxy-, 4,15-bis(chloroacetate), (3.alpha.,4.beta.)-

pdb file: 453688.pdb
sdf file: 453688.sdf
directory: 453688


FURANOTERPENE DERIV FN30 (COLL) NSC305228

pdb file: 453695.pdb
sdf file: 453695.sdf
directory: 453695


DECALIN, 1-METHYLENE-5-ME-8-(1-OH-2,6-DIMEHEX DITERPENE DERIV FN45 (COLL) NSC305229

pdb file: 453696.pdb
sdf file: 453696.sdf
directory: 453696


FURANOTERPENE DERIV C6 (COLL) NSC305230

pdb file: 453697.pdb
sdf file: 453697.sdf
directory: 453697


CEMBRANOLIDE DERIV DPI-6 (COLL) Cembranolide NSC305231

pdb file: 453698.pdb
sdf file: 453698.sdf
directory: 453698


CEMBRANOLIDE DERIV I6 DIOL (COLL) NSC305234

pdb file: 453701.pdb
sdf file: 453701.sdf
directory: 453701


74636-01-4 NAPHTHALENECARBOXALDEHYDE DERIV NSC305501

pdb file: 453808.pdb
sdf file: 453808.sdf
directory: 453808


77620-55-4 NSC310656 Spiro(2,5-methano-1-benzoxepin-10,2'-oxirane), trichothec-9-ene-3,8-dione deriv. Trichothec-9-ene-3,8-dione, 4,15-bis(acetyloxy)-12,13-epoxy- Trichothec-9-ene-3,8-dione, 4,15-bis(acetyloxy)-12,13-epoxy-, (4.beta.)-

pdb file: 455248.pdb
sdf file: 455248.sdf
directory: 455248


63139-16-2 Ergosta-2,24-dien-26-oic acid, 5,6,14,17,20,22-hexahydroxy-1-oxo-, .delta.-lactone, (5.alpha.,6.beta.,17.alpha.,22R)- NSC312620 WITHAFERIN DERIV B665685K000

pdb file: 455523.pdb
sdf file: 455523.sdf
directory: 455523


67010-96-2 MGS-1-A01 NSC315503 NUCLEOSIDE DERIV-

pdb file: 456104.pdb
sdf file: 456104.sdf
directory: 456104


56159-42-3 MGS-1-A02 NSC315504 NUCLEOSIDE DERIV

pdb file: 456105.pdb
sdf file: 456105.sdf
directory: 456105


MGS-1-A03 NSC315505 NUCLEOSIDE DERIV-

pdb file: 456106.pdb
sdf file: 456106.sdf
directory: 456106


59384-58-6 MGS-1-A04 NSC315506 NUCLEOSIDE DERIV

pdb file: 456107.pdb
sdf file: 456107.sdf
directory: 456107


MGS-1-A05 NSC315507 NUCLEOSIDE DERIV

pdb file: 456108.pdb
sdf file: 456108.sdf
directory: 456108


18031-41-9 MGS-1-A06 NSC315508 NUCLEOSIDE DERIV

pdb file: 456109.pdb
sdf file: 456109.sdf
directory: 456109


MGS-1-A07 NSC315509 NUCLEOSIDE DERIV

pdb file: 456110.pdb
sdf file: 456110.sdf
directory: 456110


MGS-1-A08 NSC315510 NUCLEOSIDE DERIV

pdb file: 456111.pdb
sdf file: 456111.sdf
directory: 456111


MGS-1-A09 NSC315511 NUCLEOSIDE DERIV

pdb file: 456112.pdb
sdf file: 456112.sdf
directory: 456112


MGS-1-C02 NSC315512 THIAZOLPYRIMIDINE, PENTYL DERIV

pdb file: 456113.pdb
sdf file: 456113.sdf
directory: 456113


MGS-1-C-03 NSC315513 THIAZOLOPYRIMIDINE, FURFURYL DERIV

pdb file: 456114.pdb
sdf file: 456114.sdf
directory: 456114


MGS-1-C04 NSC315514 THIAZOLOPYRIMIDINE, BENZYL DERIV

pdb file: 456115.pdb
sdf file: 456115.sdf
directory: 456115


40769-89-9 MGS-1-B01 NSC315515 THIAZOLOPYRIMIDINE DERIV

pdb file: 456116.pdb
sdf file: 456116.sdf
directory: 456116


18917-31-2 MGS-1-B02 NSC315516 THIAZOLOPYRIMIDINE DERIV

pdb file: 456117.pdb
sdf file: 456117.sdf
directory: 456117


MGS-1-B03 NSC315517 THIAZOLOPYRIMIDINE DERIV Thiazolo[5,4-d]pyrimidine, 7-[(phenylmethyl)thio]-

pdb file: 456118.pdb
sdf file: 456118.sdf
directory: 456118


NSC317321 VINCALEUKOBLASTINE DERIV Vincaleukoblastine, 18'-(acetyloxy)-O(4)-deacetyl-3',4'-didehydro-3,18'-dide(methoxycarbonyl)-4'-deoxy-3-[[[2-(ethylthio)ethyl]amino]carbonyl]-, sulfate (1:2) (salt) Vincaleukoblastine, 18'-(acetyloxy)-O4-deacetyl-3',4'-didehydro-3,18'-dide(methoxycarbonyl)-4'-deoxy-3-[[[2-(ethylthio)ethyl]amino]carbonyl]-, sulfate (1:2) (salt)

pdb file: 456370.pdb
sdf file: 456370.sdf
directory: 456370


NSC317322 VINCALEUKOBLASTINE DERIV Vincaleukoblastine, 18'-(acetyloxy)-O4-deacetyl-3',4'-didehydro-3,18'-dide(methoxycarbonyl)-4'-deoxy-3-[[[2-(phenylthio)ethyl]amino]carbonyl]-, sulfate (1:2) (salt)

pdb file: 456371.pdb
sdf file: 456371.sdf
directory: 456371


2-Naphthacenecarboxamide, N-[[bis(2-chloroethyl)amino][(3-hydroxypropyl)amino]phosphinyl]-4-(dimethylamino)-1,4,4a,5,5a,6,11,12a-octahydro-3,6,10,12,12a-pentahydroxy-6-methyl-1,11-dioxo- ENDOMICIN (NAPHTHACENECARBOXAMIDE DERIV) Endomicin NSC317872

pdb file: 456479.pdb
sdf file: 456479.sdf
directory: 456479


76129-16-3 Acetamide, 2,2,2-trifluoro-N-[5,6,7,9-tetrahydro-1,2,3-trimethoxy-10-(methylthio)-9-oxobenzo[a]heptalen-7-yl]-, (S)- COLCHICHINE DERIV. COLCHICINE DERIV NSC320301

pdb file: 457078.pdb
sdf file: 457078.sdf
directory: 457078


80162-12-5 EREMANTHIN, METHOXY DERIV NSC321216

pdb file: 457343.pdb
sdf file: 457343.sdf
directory: 457343


80162-13-6 EREMANTHIN, DIMETHYLAMINO DERIV NSC321218

pdb file: 457345.pdb
sdf file: 457345.sdf
directory: 457345


EREMANTHIN, PHENYLPIPERAZINYL DERIV NSC321219

pdb file: 457346.pdb
sdf file: 457346.sdf
directory: 457346


Disnogarol NOGAMYCIN DERIV, DISNOGAROL NSC321246 U-59950

pdb file: 457358.pdb
sdf file: 457358.sdf
directory: 457358


NSC323252 SESQUITERPENE LACTONE DERIV

pdb file: 457692.pdb
sdf file: 457692.sdf
directory: 457692


70866-50-1 BERBERINE DERIV JCI 2222 NSC326128

pdb file: 458007.pdb
sdf file: 458007.sdf
directory: 458007


81548-58-5 BERBERINE DERIV JCI 2223 NSC326129

pdb file: 458008.pdb
sdf file: 458008.sdf
directory: 458008


81548-64-3 BERBERINE DERIV JCI 2224 NSC326130

pdb file: 458009.pdb
sdf file: 458009.sdf
directory: 458009


NSC326220 URSANE DERIV

pdb file: 458067.pdb
sdf file: 458067.sdf
directory: 458067


78142-93-5 Azirino[2',3':3,4]pyrrolo[1,2-a]indole-4,7-dione, 8-[[(aminocarbonyl)oxy]methyl]-6-[(2-furanylmethyl)amino]-1,1a,2,8,8a,8b-hexahydro-8a-methoxy-1,5-dimethyl-, [1aR-(1a.alpha.,8.beta.,8a.alpha.,8b.alpha.)]- MITOMYCIN C DERIV NSC327985

pdb file: 458493.pdb
sdf file: 458493.sdf
directory: 458493


78327-30-7 Azirino[2',3':3,4]pyrrolo[1,2-a]indole-4,7-dione, 8-[[(aminocarbonyl)oxy]methyl]-1,1a,2,8,8a,8b-hexahydro-8a-methoxy-5-methyl-6-[[(tetrahydro-2-furanyl)methyl]amino]- MITOMYCIN C DERIV NSC327986

pdb file: 458494.pdb
sdf file: 458494.sdf
directory: 458494


53965-06-3 LIGNAN DERIV NSC329490

pdb file: 458975.pdb
sdf file: 458975.sdf
directory: 458975


529-49-7 NSC329491 XANTHONE DERIV

pdb file: 458976.pdb
sdf file: 458976.sdf
directory: 458976


52886-06-3 LYCORINE ALKALOID DERIV NSC329494

pdb file: 458978.pdb
sdf file: 458978.sdf
directory: 458978


1H-1,2,3-Triazole, acetamide deriv. 77976-40-0 Acetamide, 2-[[4-cyano-1-(phenylmethyl)-1H-1,2,3-triazol-5-yl]amino]-2-oxo- NSC336365

pdb file: 460266.pdb
sdf file: 460266.sdf
directory: 460266


1H-1,2,3-Triazole, acetic acid deriv. 50486-80-1 Acetic acid, [[[5-amino-1-(phenylmethyl)-1H-1,2,3-triazol-4-yl]methyl]amino]oxo-, ethyl ester NSC336366

pdb file: 460267.pdb
sdf file: 460267.sdf
directory: 460267


1H-1,2,3-Triazole, acetic acid deriv. 77976-45-5 Acetic acid, [[(4-amino-1-methyl-1H-1,2,3-triazol-5-yl)methyl]amino]oxo-, ethyl ester NSC336367

pdb file: 460268.pdb
sdf file: 460268.sdf
directory: 460268


1H-1,2,3-Triazole, acetamide deriv. 77976-42-2 Acetamide, 2-[[(5-amino-1-phenylmethyl)-1H-1,2,3-triazol-4-yl]methyl]amino)-2-oxo- NSC336368

pdb file: 460269.pdb
sdf file: 460269.sdf
directory: 460269


1H-1,2,3-Triazole, carbamodithioic acid deriv. 76055-35-1 Carbamodithioic acid, [[5-amino-1-(phenylmethyl)-1H-1,2,3-triazol-4-yl]methyl]-, methyl ester NSC336371

pdb file: 460272.pdb
sdf file: 460272.sdf
directory: 460272


80557-13-7 CRISTATIC ACID -1 (PERMETHYL DERIV ) Cristatic acid NSC338268

pdb file: 460720.pdb
sdf file: 460720.sdf
directory: 460720


80557-11-5 CRISTATIC ACID -2 (PERMETHYL DERIV ) NSC338269 Permethyl deriv. of cristatic acid

pdb file: 460721.pdb
sdf file: 460721.sdf
directory: 460721


NSC339160 QUADRONE DERIV

pdb file: 461039.pdb
sdf file: 461039.sdf
directory: 461039


94392-49-1 FLAVONE DERIV NSC339192

pdb file: 461056.pdb
sdf file: 461056.sdf
directory: 461056


71595-42-1 FURANDIONE DERIV , (5346) NSC341627

pdb file: 461541.pdb
sdf file: 461541.sdf
directory: 461541


62722-99-0 FURANDIONE DERIV , (5347) NSC341628

pdb file: 461542.pdb
sdf file: 461542.sdf
directory: 461542


62722-98-9 FURANDIONE DERIV , (5417) NSC341629

pdb file: 461543.pdb
sdf file: 461543.sdf
directory: 461543


71595-41-0 FURANDIONE DERIV , (5617) NSC341630

pdb file: 461544.pdb
sdf file: 461544.sdf
directory: 461544


93859-68-8 NITIDINE DERIV NSC342675

pdb file: 461746.pdb
sdf file: 461746.sdf
directory: 461746


80360-10-7 L-Glutamic acid, N-[4-[[(2,4-diaminopyrido[2,3-d]pyrimidin-6-yl)methyl]methylamino]benzoyl]- NSC344280 Pyrido[2,3-d]pyrimidine, L-glutamic acid deriv.

pdb file: 462185.pdb
sdf file: 462185.sdf
directory: 462185


80360-08-3 L-Glutamic acid, N-[4-[[(2,4-diaminopyrido[2,3-d]pyrimidin-6-yl)methyl]amino]benzoyl]-, diethyl ester NSC346890 Pyrido[2,3-d]pyrimidine, L-glutamic acid deriv.

pdb file: 462632.pdb
sdf file: 462632.sdf
directory: 462632


88854-60-8 MITOMYCIN DERIV NSC347783

pdb file: 462729.pdb
sdf file: 462729.sdf
directory: 462729


NSC348717 PHORBOL DERIV II

pdb file: 462830.pdb
sdf file: 462830.sdf
directory: 462830


MITOMYCIN DERIV NSC349951 RR-220

pdb file: 463183.pdb
sdf file: 463183.sdf
directory: 463183


84782-35-4 DIMETHOXYCHROMONE DERIV (I) NSC350180

pdb file: 463293.pdb
sdf file: 463293.sdf
directory: 463293


NSC351323 TRICHOTHECENE DERIV

pdb file: 463505.pdb
sdf file: 463505.sdf
directory: 463505


22738-70-1 Azuleno[4,5-b]furan-2(3H)-one, decahydro-3,8-dihydroxy-3-(hydroxymethyl)-6,9-bis(methylene)-, [3R-(3.alpha.,3a.alpha.,6a.alpha.,8.beta.,9a.alpha.,9b.beta.)]- Guaia-4(15),10(14)-dien-12-oic acid, 3.beta.,6.alpha.,11,13-tetrahydroxy-, .gamma.-lactone, (11R)- NSC352264 SOLSTITIALIN DERIV 4700 Solstitialin

pdb file: 463778.pdb
sdf file: 463778.sdf
directory: 463778


HARMINE DERIV HEJ-1 NSC356214

pdb file: 464651.pdb
sdf file: 464651.sdf
directory: 464651


HARMINE DERIV HEJ-3 NSC356216

pdb file: 464652.pdb
sdf file: 464652.sdf
directory: 464652


85645-19-8 HARMINE DERIV HEJ-5 NSC356218

pdb file: 464653.pdb
sdf file: 464653.sdf
directory: 464653


85645-28-9 HARMINE DERIV HEJ-6 NSC356219

pdb file: 464654.pdb
sdf file: 464654.sdf
directory: 464654


HEJ-7 NSC356220 RESERPINE DERIV

pdb file: 464655.pdb
sdf file: 464655.sdf
directory: 464655


51559-33-2 COUMARIN DERIV NSC356887

pdb file: 464853.pdb
sdf file: 464853.sdf
directory: 464853


88854-47-1 Azirino[2',3':3,4]pyrrolo[1,2-a]indole-4,7-dione, 8-[[(aminocarbonyl)oxy]methyl]-6-[(3,4-dimethoxyphenyl)amino]-1,1a,2,8,8a,8b-hexahydro-8a-methoxy-5-methyl-, [1aR-(1a.alpha.,8.beta.,8a.alpha.,8b.alpha.)]- MITOMYCIN DERIV NSC357283

pdb file: 464888.pdb
sdf file: 464888.sdf
directory: 464888


77282-67-8 BIANTHRONE DERIV (ASPERGILLUS WENTII) NSC357286

pdb file: 464889.pdb
sdf file: 464889.sdf
directory: 464889


Epipodophyllotoxin derivitive Furo[3',4':6,7]naphtho[2,3-d]-1,3-dioxol-6(5aH)-one, 9-[(4,6-O-ethylidene-.beta.-D-glucopyranosyl)oxy]- 5,8,8a,9-tetrahydro-5-(3,4,5-trimethoxyphenyl)- NSC363606

pdb file: 466091.pdb
sdf file: 466091.sdf
directory: 466091


35317-31-8 EPIPODOPHYLLOTOXIN DERIV Furo[3',4':6,7]naphtho[2,3-d]-1,3-dioxol-6(5aH)-one, 5,8,8a,9-tetrahydro-9-[[4,6-O-(2-thienylmethylene)-.beta.-D-glucopyranosyl]oxy]-5-(3,4,5-trimethoxyphenyl)- NSC363607

pdb file: 466092.pdb
sdf file: 466092.sdf
directory: 466092


22154-65-0 EPIPODOPHYLLOTOXIN DERIV NSC363611

pdb file: 466093.pdb
sdf file: 466093.sdf
directory: 466093


19013-03-7 CHROMENE DERIV (HERZ) NSC363789

pdb file: 466140.pdb
sdf file: 466140.sdf
directory: 466140


35817-13-1 BENZOFURAN DERIV (HERZ) NSC363790

pdb file: 466141.pdb
sdf file: 466141.sdf
directory: 466141


69306-85-0 FLAVONE,3,5-DIHYDROXY-7,4'DIMETHOXY-8-BUTYRLYOXY NA-1(FLAVONE,3,5-DIHYDROXY,7,4'-DIMETHOXY DERIV) NSC363989

pdb file: 466268.pdb
sdf file: 466268.sdf
directory: 466268


75491-89-3 Azirino[2',3':3,4]pyrrolo[1,2-a]indole-4,7-dione, 8-[[(aminocarbonyl)oxy]methyl]-1,1a,2,8,8a,8b-hexahydro-6-[(3-hydroxyphenyl)amino]-8a-methoxy-5-methyl,[1aR-(1a.alpha.,8.beta.,8a.alpha.,8b.alpha.)]- Azirino[2',3':3,4]pyrrolo[1,2-a]indole-4,7-dione, 8-[[(aminocarbonyl)oxy]methyl]-1,1a,2,8,8a,8b-hexahydro-6[(3-hydroxyphenyl)amino]-8a-methoxy-5-methyl, [1aR-(1a.alpha.,8.beta.,8a.alpha.,8b.alpha.)]- MITOMYCIN C DERIV NSC364156

pdb file: 466344.pdb
sdf file: 466344.sdf
directory: 466344


83586-86-1 Azirino[2',3':3,4]pyrrolo[1,2-a]indole-4,7-dione, 8-[[(aminocarbonyl)oxy]methyl]-6-[(2-aminoethyl)amino]-1,1a,2,8,8a,8b-hexahydro-8a-methoxy-5-methyl-, [1aR-(1a.alpha.,8.beta.,8a.alpha.,8b.alpha.)]- MITOMYCIN C DERIV NSC364157

pdb file: 466345.pdb
sdf file: 466345.sdf
directory: 466345


Azirino[2',3':3,4]pyrrolo[1,2-a]indole-4,7-dione, 8-[[(aminocarbonyl)oxy]methyl]-1,1a,2,8,8a,8b-hexahydro-6-[(4-hydroxyphenyl)methylamino]-8a-methoxy-5-methyl, [1aR-(1a.alpha.,8.beta.,8a.alpha.,8b.alpha.)]- Azirino[2',3':3,4]pyrrolo[1,2-a]indole-4,7-dione, 8-[[(aminocarbonyl)oxy]methyl]-1,1a,2,8,8a,8b-hexahydro-6-[(4-hydroxyphenyl)methylamino]-8a-methoxy-5-methyl-, [1aR-(1a.alpha.,8.beta.,8a.alpha.,8b.alpha.)]- MITOMYCIN C DERIV NSC364158

pdb file: 466346.pdb
sdf file: 466346.sdf
directory: 466346


20939-77-9 ACETAMIDE, N (HYDROXYMETHYL PHENYL)-DERIV NSC365355 TU 2353E

pdb file: 466519.pdb
sdf file: 466519.sdf
directory: 466519


NSC366225 QUADRONE DERIV

pdb file: 466727.pdb
sdf file: 466727.sdf
directory: 466727


70287-40-0 INDICINE-N-OXIDE DERIV (+) NSC366363 Oxazolidine, 3,4-dimethyl-5-phenyl-, cis-

pdb file: 466743.pdb
sdf file: 466743.sdf
directory: 466743


79087-89-1 CINNAMIC ACID, TRANS-INDOLIN-2-ONE-3-YL-ETHYLAMINO DERIV NSC369856

pdb file: 467432.pdb
sdf file: 467432.sdf
directory: 467432


CINNAMIC ACID, TRANS-TRANS-3-METHYL-SULFONYL-ALLYL ESTER DITERPENE DERIV 329 NSC369860

pdb file: 467435.pdb
sdf file: 467435.sdf
directory: 467435


DITERPENE DERIV 330 NSC369861

pdb file: 467436.pdb
sdf file: 467436.sdf
directory: 467436


NSC370351 SESBANIMIDE DERIV K484

pdb file: 467538.pdb
sdf file: 467538.sdf
directory: 467538


CPP3-91-1 NSC370995 PURINE-ALPHA-METHYLENE-GAMMA LACTONE DERIV

pdb file: 467753.pdb
sdf file: 467753.sdf
directory: 467753


CUS1-125-1 NSC370996 PURINE-ALPHA-METHYLENE-GAMMA LACTONE DERIV

pdb file: 467754.pdb
sdf file: 467754.sdf
directory: 467754


CSM2-92-1 NSC370999 PURINE-ALPHA-METHYLENE-GAMMA-LACTONE DERIV

pdb file: 467757.pdb
sdf file: 467757.sdf
directory: 467757


CPP3-95-7 NSC371000 PYRIMIDINE-ALPHA-METHYLENE-GAMMA-LACTONE DERIV

pdb file: 467758.pdb
sdf file: 467758.sdf
directory: 467758


116409-25-7 6H-1,3-Dioxolo[4,5-g][1]benzopyran, 7,8-dihydro-6-methyl- 6-(1-pyrrolidinyl)-8-(3,4,5-trimethoxyphenyl)- NSC371002 Podophyllotoxin deriv. (jurd) Pyrrolidine, 1-[7,8-dihydro-6-methyl-8-(3,4,5- trimethoxyphenyl)-6H-1,3-dioxolo[4,5-g][1]benzopyran- 6-yl]-

pdb file: 467760.pdb
sdf file: 467760.sdf
directory: 467760


DN 61A PHENAZINE DERIV NSC373235 PD 116152

pdb file: 468685.pdb
sdf file: 468685.sdf
directory: 468685


COSTUNOLIDE DERIV Costunolide derivative NSC375091

pdb file: 469191.pdb
sdf file: 469191.sdf
directory: 469191


71939-66-7 FURANOHELIANGOLIDE DERIV Furanohelianolide NSC375092

pdb file: 469192.pdb
sdf file: 469192.sdf
directory: 469192


NSC375730 PODOPHYLLOTOXIN DERIV E-5 (BUSAM)

pdb file: 469280.pdb
sdf file: 469280.sdf
directory: 469280


ELLIPTICINE DERIV DMK-I-287A NSC376451

pdb file: 469410.pdb
sdf file: 469410.sdf
directory: 469410


66789-58-0 ELLIPTICINE DERIV GLF-I-79-6B NSC376452

pdb file: 469411.pdb
sdf file: 469411.sdf
directory: 469411


ELLIPTICINE DERIV NSC376453

pdb file: 469412.pdb
sdf file: 469412.sdf
directory: 469412


ELLIPTICINE DERIV NSC376454

pdb file: 469413.pdb
sdf file: 469413.sdf
directory: 469413


DRACORHODIN PARENT DERIV (II) NSC378590

pdb file: 469808.pdb
sdf file: 469808.sdf
directory: 469808


DEPSIDE DERIV (KUNMING) NSC379668

pdb file: 470166.pdb
sdf file: 470166.sdf
directory: 470166


88899-55-2 BAFILOMYCIN A1 BAFILOMYCIN DERIV BAFILOMYCIN DERIV. NSC381866

pdb file: 470677.pdb
sdf file: 470677.sdf
directory: 470677


BAFILOMYCIN DERIV NSC381868

pdb file: 470679.pdb
sdf file: 470679.sdf
directory: 470679


7595-55-3 IMINOETHANOPENANTHREN-3(4H)-ONE DERIV NSC404365

pdb file: 474563.pdb
sdf file: 474563.sdf
directory: 474563


2-Propenoic acid, 3-(4-hydroxy-5-benzofuranyl)-, .delta.-lactone 2H-Furo[2,3-h]-1-benzopyran-2-one 523-50-2 Angecin Angelicin Angelicin (coumarin derivative) Furo[5',4':7,8]coumarin Isopsoralen NSC404563

pdb file: 474744.pdb
sdf file: 474744.sdf
directory: 474744


NITRILOJERVINONE DERIV NSC406358

pdb file: 476272.pdb
sdf file: 476272.sdf
directory: 476272


NITRILOJERV-5-EN-11-ONE DERIV NSC406359

pdb file: 476273.pdb
sdf file: 476273.sdf
directory: 476273


101-76-8 4,4'-Dichlorodiphenylmethane Benzene, 1,1'-methylenebis[4-chloro- Bis(p-chlorophenyl)methane DBM (the methane derivative) DDM DDM (degradation product) Di(4-chlorophenyl)methane Di(p-chlorophenyl)methane Methane, bis(4-chlorophenyl)- Methane, bis(p-chlorophenyl)- NSC406594 WLN: GR D1R DG p,p'-Dichlorodiphenylmethane

pdb file: 476495.pdb
sdf file: 476495.sdf
directory: 476495


NSC600691 Pregnane derivative from Stizophyllum Riparium

pdb file: 483228.pdb
sdf file: 483228.sdf
directory: 483228


Epoxyketone derived from shikoccin, a diterpenoid isolated from Rabdosia shikokiana var. occidentalis NSC604581

pdb file: 484121.pdb
sdf file: 484121.sdf
directory: 484121


Aminocyclitol derivative (scyllo configuration) NSC604984 Streptidine sulfate

pdb file: 484176.pdb
sdf file: 484176.sdf
directory: 484176


NSC604985 Streptamine sulfate Aminocyclitol derivative (scyllo configuration)

pdb file: 484177.pdb
sdf file: 484177.sdf
directory: 484177


10-Isovaleryloxy-8,9-epoxythymol-3-isovalerate NSC604987 Thymol derivative from Inula crithmoides

pdb file: 484179.pdb
sdf file: 484179.sdf
directory: 484179


Amphotericin B derivative NSC605118

pdb file: 484210.pdb
sdf file: 484210.sdf
directory: 484210


B723341K004 Bufadienolide derivative from Bufo Bufo Gargarizans NSC605219

pdb file: 484234.pdb
sdf file: 484234.sdf
directory: 484234


B723341K005 Bufadienolide derivative from Bufo Bufo Gargarizans NSC605220

pdb file: 484235.pdb
sdf file: 484235.sdf
directory: 484235


B723341K006 Bufadienolide derivative from Bufo Bufo Gargarizans NSC605221

pdb file: 484236.pdb
sdf file: 484236.sdf
directory: 484236


B723341K007 Bufadienolide derivative from Bufo Bufo Gargarizans NSC605222

pdb file: 484237.pdb
sdf file: 484237.sdf
directory: 484237


B723341K008 Bufadienolide derivative from Bufo Bufo Gargarizans NSC605223

pdb file: 484238.pdb
sdf file: 484238.sdf
directory: 484238


B723341K011 Bufadienolide derivative from Bufo Bufo Gargarizans NSC605224

pdb file: 484239.pdb
sdf file: 484239.sdf
directory: 484239


B723341K012 Bufadienolide derivative from Bufo Bufo Gargarizans NSC605225

pdb file: 484240.pdb
sdf file: 484240.sdf
directory: 484240


B723341K013 Bufadienolide derivative from Bufo Bufo Gargarizans NSC605226

pdb file: 484241.pdb
sdf file: 484241.sdf
directory: 484241


B723341K014 Bufadienolide derivative from Bufo Bufo Gargarizans NSC605227

pdb file: 484242.pdb
sdf file: 484242.sdf
directory: 484242


B723341K019 Resibufotoxin Bufotoxin derivative from Bufo Bufo Gargarizans NSC605228

pdb file: 484243.pdb
sdf file: 484243.sdf
directory: 484243


Isoflavone -2- carboxylic acid derivative NSC606401

pdb file: 484453.pdb
sdf file: 484453.sdf
directory: 484453


68370-46-7 Aguerin A Azuleno[4,5-b]furan, propanoic acid deriv. NSC606744 Propanoic acid, 2-methyl-, dodecahydro-8-hydroxy-3,6,9-tris(methylene)-2-oxoazuleno- [4,5-b]furan-4-yl ester,

pdb file: 484588.pdb
sdf file: 484588.sdf
directory: 484588


2115-91-5 7,5-(Epoxymethano)-1H-cyclopent[cd]indole, dendroban-12-one derivative Dendrobine From Dendrobium nobile NSC607862

pdb file: 485003.pdb
sdf file: 485003.sdf
directory: 485003


Araadenosine-5'-O-dimethylphosphate NSC607995 Vidarabine derivative

pdb file: 485048.pdb
sdf file: 485048.sdf
directory: 485048


Enamine daunorubicin deriv. NSC608744

pdb file: 485344.pdb
sdf file: 485344.sdf
directory: 485344


Enamine daunorubicin deriv. NSC608745

pdb file: 485345.pdb
sdf file: 485345.sdf
directory: 485345


Enamine daunorubicin deriv. NSC608746

pdb file: 485346.pdb
sdf file: 485346.sdf
directory: 485346


2-Butenedioic acid, 3-[[1-[(3-acetyl-1,2,3,4-tetrahydro- 3,5,12-trihydroxy-10-methoxy-6,11-dioxo-1- naphthacenyl)oxy]-2,3,6-trideoxy-.alpha.-L-lyxo- hexopyranos-3-yl]amino]-, dimethyl ester Daunorubicin, enamine derivative NSC608747

pdb file: 485347.pdb
sdf file: 485347.sdf
directory: 485347


2-Butenoic acid, 3-[[1-[(3-acetyl-1,2,3,4-tetrahydro-3,5,12- trihydroxy-10-methoxy-6,11-dioxo-1-naphthacenyl)oxy]- 2,3,6-trideoxy-3-.alpha.-L-lyxo-hexopyranosyl]amino]-, methyl ester Daunorubicin, N-(methyl-2-butenoate) deriv. Enamine daunorubicin deriv. NSC608748

pdb file: 485348.pdb
sdf file: 485348.sdf
directory: 485348


NSC609258 Schisandrin derivative

pdb file: 485491.pdb
sdf file: 485491.sdf
directory: 485491


Chromanone derivative NSC609555

pdb file: 485600.pdb
sdf file: 485600.sdf
directory: 485600


Chromanone 2 Chromanone derivative NSC609556

pdb file: 485601.pdb
sdf file: 485601.sdf
directory: 485601


Chromanone derivative NSC609557

pdb file: 485602.pdb
sdf file: 485602.sdf
directory: 485602


Chromanone 4 Chromanone derivative NSC609558

pdb file: 485603.pdb
sdf file: 485603.sdf
directory: 485603


NSC609822 Paragracine derivative

pdb file: 485706.pdb
sdf file: 485706.sdf
directory: 485706


NSC609823 Paragracine derivative

pdb file: 485707.pdb
sdf file: 485707.sdf
directory: 485707


.beta.-D-threo-D-glycero-3-Hexulofuranosonic acid, 2-C-[(2,3-dibromo-4,5-dihydroxyphenyl)methyl],.gamma.-lactone 100676-10-6 Furo[3,2-b]furan, .beta.-D-threo-d-glycero-3-hexulo furanosonic acid deriv. (9CI) (+)-Rhodomelol NSC615490 Rhodomelol, from the red alga Polysiphonia lanosa

pdb file: 487456.pdb
sdf file: 487456.sdf
directory: 487456


2-Styrylchromone Derivative NSC616977

pdb file: 487718.pdb
sdf file: 487718.sdf
directory: 487718


3-Styrylchromone Derivative NSC616978

pdb file: 487719.pdb
sdf file: 487719.sdf
directory: 487719


1H-Pyrrole-1-dodecanoic acid, 2,5-dihydro-2,5-dioxo-, vincaleukoblastine deriv. NSC618380 Vincaleukoblastine, O(4)-deacetyl-, 4-ester with 2,5-dihydro-2,5-dioxo-1H-pyrrole-1-dodecanoic acid

pdb file: 488574.pdb
sdf file: 488574.sdf
directory: 488574


Dodecanoic acid, 12-amino-, vincaleukoblastine deriv. NSC618381 Vincaleukoblastine, 3-[[(11-carboxyundecyl)amino]carbonyl]- O(4)-deacetyl-3-de(methoxycarbonyl)-

pdb file: 488575.pdb
sdf file: 488575.sdf
directory: 488575


Coumarin derivative from Micromellum zeylanicum Microzelanicum NSC620857

pdb file: 489941.pdb
sdf file: 489941.sdf
directory: 489941


NSC622238 Uridylate derivative of 2,7-diaminomitosene formulated as uridylic acid salt

pdb file: 490563.pdb
sdf file: 490563.sdf
directory: 490563


(E)-(1S,4S,10S,21R)-7-[(Z)-Ethylidene]-4,21-diisopropyl-2- oxa-12,13-dithia-5,8,20,23-tetraazabicyclo[8.7.6]tricos-16-ene-3,6,9,19,22-pentone 128517-07-7 Antibiotic FR 901228 Depsipeptide L-Valine, N-(3-hydroxy-7-mercapto-1-oxo-4-heptenyl)valyl- cysteinyl-2,3-didehydro-2-aminobutanoyl-,.xi.-lactone, cyclic (1.fwdarw.2)-disulfide NSC630176 OXA-12,13-DITHIA-5,8,20,23-TETRAZABICYCLO[8.7.6]TRICOSANE, CYCLIC PEPTIDE DERIV.

pdb file: 494874.pdb
sdf file: 494874.sdf
directory: 494874


L-Glutamic acid, N-[4-[2-(2-amino-1,4,5,6,7,8-hexahydro-4-oxopyrido[2,3-d]pyrimidin-6-yl)ethyl]benzoyl]-, (R)- Lometrexol NSC660025 Pyrido[2,3-d]pyrimidine, L-glutamic acid deriv.

pdb file: 509312.pdb
sdf file: 509312.sdf
directory: 509312


2-Azabicyclo[16.3.1]docasa-4,6,10,18,21-pentaene- 3,20,23-trione, 13-(3-aminopropionyloxy)-9,13-dihydroxy- 8,14,19-trimethoxy-4,10,12,16-tetramethyl-, 9-carbamate,monohydrochloride 2-Azabicyclo[16.3.1]docosane, geldanamycin deriv. Geldanamycin, 12-(3-aminopropionate)-monohydrochloride NSC661581

pdb file: 509764.pdb
sdf file: 509764.sdf
directory: 509764


1,7-Dioxaspiro[5.5]undecane, acanthifolicin deriv. 78111-17-8 NSC677083 Okadaic acid Spiro[furan-2(3H),2'(3'H)-pyrano[3,2-b]pyran], acanthifolicin deriv,

pdb file: 516878.pdb
sdf file: 516878.sdf
directory: 516878


156368-64-8 7H-Napth[2,1-h]oxacyclohexadecin, acetamide deriv. Acetamide, N-[3-[17-[(aminocarbonyl)oxy]-9,10,14a,16a, 17,18,19,20,20a,20b-decahydro-19-methoxy-3,10,13,13,20b- tetramethyl-7-oxo-7H-naphth[2,1-h]oxacyclohexadecin-9-yl]- 2-hydroxy-1-methylbutyl]-, [9R-[1E,3Z,5E,9R*(1R*,2S*,3R*),10R*,11E,13E,14aR*,16aR*,17S*,19S*,20aR*,20bR*]]- NSC680074 Superstolide A

pdb file: 518225.pdb
sdf file: 518225.sdf
directory: 518225


1H-Pyrano[3',4':6,7]indolizino[1,2-b]quinoline,serine deriv. NSC681633 Serine, [(4-ethyl-3,4,12,14-tetrahydro-4-hydroxy- 3,14-dioxo-1H-pyrano[3,4:6,7]indolizino[1,2-b]quinolin-11-yl)methylene]hydrazide, monohydrochloride

pdb file: 518923.pdb
sdf file: 518923.sdf
directory: 518923


1H-Pyrano[3',4':6,7]indolizino[1,2-b]quinoline,leucine deriv. Leucine, [(4-ethyl-3,4,12,14-tetrahydro-4-hydroxy- 3,14-dioxo-1H-pyrano[3',4':6,7]indolizino[1,2-b]quinolin-11-yl)methylene]hydrazide, monohydrochloride NSC681634

pdb file: 518924.pdb
sdf file: 518924.sdf
directory: 518924


1H-Pyrano[3',4':6,7]indolizino[1,2-b]quinoline,methionine deriv. Methionine, [(4-ethyl-3,4,12,14-tetrahydro-4-hydroxy- 3,14-dioxo-1H-pyrano[3',4':6,7]indolizino[1,2-b]quinolin-11-yl)methylene]hydrazide, monohydrochloride NSC681635

pdb file: 518925.pdb
sdf file: 518925.sdf
directory: 518925


1H-Pyrano[3',4':6,7]indolizino[1,2-b]quinoline,alanine deriv. Alanine, [(4-ethyl-3,4,12,14-tetrahydro-4-hydroxy- 3,14-dioxo-1H-pyrano[3',4':6,7]indolizino[1,2-b]quinolin-11-yl)methylene]hydrazide, monohydrochloride NSC681636

pdb file: 518926.pdb
sdf file: 518926.sdf
directory: 518926


1H-Pyrano[3',4':6,7]indolizino[1,2-b]quinoline,glycine deriv Glycine, [(4-ethyl-3,4,12,14-tetrahydro-4-hydroxy- 3,14-dioxo-1H-pyrano[3',4':6,7]indolizino[1,2-b]quinolin-11-yl)methylene]hydrazide, monohydrochloride NSC681637

pdb file: 518927.pdb
sdf file: 518927.sdf
directory: 518927


1H-Pyrano[3',4':6,7]indolizino[1,2-b]quinoline,proline deriv NSC681638 Proline, [(4-ethyl-3,4,12,14-tetrahydro-4-hydroxy- 3,14-dioxo-1H-pyrano[3',4':6,7]indolizino[1,2-b]quinolin-11-yl)methylene]hydrazide, monohydrochloride

pdb file: 518928.pdb
sdf file: 518928.sdf
directory: 518928


1H-Pyrano[3',4':6,7]indolizino[1,2-b]quinoline,histidine deriv. Histidine, [(4-ethyl-3,4,12,14-tetrahydro-4-hydroxy- 3,14-dioxo-1H-pyrano[3',4':6,7]indolizino[1,2-b]quinolin-11-yl)methylene]hydrazide, dihydrochloride NSC681639

pdb file: 518929.pdb
sdf file: 518929.sdf
directory: 518929


1H-Pyrano[3',4':6,7]indolizino[1,2-b]quinoline,tryptophan deriv. NSC681640 Tryptophan, [(4-ethyl-3,4,12,14-tetrahydro-4-hydroxy- 3,14-dioxo-1H-pyrano[3',4':6,7]indolizino[1,2-b]quinolin-11-yl)methylene]hydrazide, monohydrochloride

pdb file: 518930.pdb
sdf file: 518930.sdf
directory: 518930


Benzoic acid, 4-amino-, [(4-ethyl-3,4,12,14-tetrahydro- 4-hydroxy-3,14-dioxo-1H-pyrano[3',4':6,7]indolizino [1,2-b]quinolin-11-yl)methylene]hydrazide,monohydrochloride NSC681641 iH-Pyrano[3',4':6,7]indolizino[1,2-b]quinoline,4-aminobenzoic acid deriv.

pdb file: 518931.pdb
sdf file: 518931.sdf
directory: 518931


1H-Pyrano[3',4':6,7]indolizino[1,2-b]quinoline,cysteine deriv. Cysteine, [(4-ethyl-3,4,12,14-tetrahydro-4-hydroxy- 3,14-dioxo-1H-pyrano[3',4':6,7]indolizino[1,2-b]quinolin-11-yl)methylene]hydrazide, monohydrochloride NSC681642

pdb file: 518932.pdb
sdf file: 518932.sdf
directory: 518932


1H-Pyrano[3',4':6,7]indolizino[1,2-b]quinoline,isoleucine deriv. Isoleucine, [(4-ethyl-3,4,12,14-tetrahydro-4-hydroxy- 3,14-dioxo-1H-pyrano[3',4':6,7]indolizino[1,2-b]quinolin-11-yl)methylene]hydrazide, monohydrochloride NSC681643

pdb file: 518933.pdb
sdf file: 518933.sdf
directory: 518933


1H-Pyrano[3',4':6,7]indolizino[1,2-b]quinoline,glycine deriv. Ethanaminium, 2-[[(4-ethyl-3,4,12,14-tetrahydro- 4-hydroxy-3,14-dioxo-1H-pyrano[3',4':6,7]indolizino [1,2-b]quinolin-11-yl)methylene]hydrazino]-N,N,N-trimethyl-2-oxo-, chloride Glycine hydrazide, 1H-pyrano[3',4':6,7]indolizino[1,2-b]quinolin-11-yl deriv. NSC681644

pdb file: 518934.pdb
sdf file: 518934.sdf
directory: 518934


15H-Pyrrolo[2,1-f][1,15,4,7,10,20]dioxatetraaza cyclotricosine, cyclic peptide deriv Leucine, N-[1-[N-[4-[[3-hydroxy-4-[[N-[N-[1-(2-hydroxy- 1-oxopropyl)prolyl]-N-methylleucyl]threonyl]amino]- 5-methyl-1-oxooctyl]oxy]-2,5-dimethyl-1,3-dioxohexyl]leucyl]prolyl]-N-methyl-, .phi.-lactone, stereoisomer NSC685703

pdb file: 520773.pdb
sdf file: 520773.sdf
directory: 520773


NSC698102 Val-9-Val, Proteinase 3-derived peptide PR1, sequence-VLQELNVTV

pdb file: 525850.pdb
sdf file: 525850.sdf
directory: 525850


.beta.-D-Glucopyranoside, (3.beta.,22.alpha.,25R)- 26-(.beta.-D-glucopyranosyloxy)-22-methoxyfurost- 5-en-3-yl O-6-deoxy-.alpha.-L-mannopyranosyl- (1.fwdarw.2)-O-[.beta.-D-glucopyranosyl- (1.fwdarw.3)]- 1H-Naphth[2',1':4,5]indeno[2,1-b]furan,.beta.-D-glucopyranoside derivative Furostan, .beta.-D-glucopyranoside derivative Kikubasaponin Methyl protogracillin NSC698792

pdb file: 526142.pdb
sdf file: 526142.sdf
directory: 526142


1,7,13-Trioxa-4,10,16-triazacyclooctadecane, cyclic peptide deriv. Beauvericin Cyclo(D-.alpha.-hydroxyisovaleryl-N-methyl-L-phenylalanyl-D~ -.alpha.-hydroxyisovaleryl-N-methyl-L-phenylalanyl-D-.alpha.-hydroxyisovaleryl-N-methyl-L-phenylalanyl) NSC708472

pdb file: 529840.pdb
sdf file: 529840.sdf
directory: 529840


L-alanyl derivative of 2-(4-amino-3-methylphenyl)-5-fluorobenzothiazole (HCl salt) NSC711669

pdb file: 531399.pdb
sdf file: 531399.sdf
directory: 531399


1,5-DIPHENYL-4-PENTENE-1,3-DIONE, COPPER (II) DERIV. 6290-84-2 NSC78

pdb file: 538180.pdb
sdf file: 538180.sdf
directory: 538180


1476-53-5 7-[4-(Carbamoyloxy)-tetrahydro-3-hydroxy-5-methoxy-6,6-dimethylpyran-2-yl]-4-hydroxy-3-[4-hydroxy-3-(3-methyl-2-butenyl)benzamido]-8-methyl-, sodium salt Albadry Albamycin Albamycin sodium Albamycin, capsule Albycin sodium Antibiotic from Streptomyces spheroides Benzamide, N-[7-[[3-O-(aminocarbonyl)-6-deoxy-5-C-methyl-4-O-methyl-.alpha.-L-lyxo-hexopyranosyl]oxy]-4-hydroxy-8-methyl-2-oxo-2H-1-benzopyran-3-yl]-4-hydroxy-3-(3-methyl-2-butenyl)-, monosodium salt Benzamide, N-[7-[[3-O-(aminocarbonyl)-6-deoxy-5-C-methyl-4-O-methyl-.beta.-L-lyxo-hexopyranosyl]oxy]-4-hydroxy-8-methyl-2-oxo-2H-1-benzopyran-3-yl]-4-hydroxy-3-(3-methyl-2-butenyl)-, monosodium salt Cardelmycin sodium salt Cathomycin sodium Cathomycin sodium lyovac Coumarin, 7-[(5,5-di-C-methyl-4-O-methyl-.beta.-L-lyxopyranosyl)oxy]-4-hydroxy-3-[4-hydroxy-3-(3-methyl-2-butenyl)benzamido]-8-methyl-, carbamate, sodium deriv. Drygard/Biodry Inamycin Monosodium novobiocin NOVOBIOCIN NSC2382 Novobiocin monosodium Novobiocin monosodium salt Novobiocin sodium Novobiocin sodium salt Novobiocin, monosodium salt Novobiocin, sodium deriv. PA 93 Na salt Robiocina Sodium albamycin Sodium novobiocin Spheromycin Streptonivicin sodium salt U 6591 U-6591 Vulcamycin WLN: T66 BOVJ DMVR DQ C2UY1&1& EQ IO- FT6OTJ B1 B1 CO1 DVZ EQ FO1 &-NA- component of Albamycin Capsules

pdb file: 538454.pdb
sdf file: 538454.sdf
directory: 538454


Ammonium, (6-diethylamino-3H-xanthen-3-ylidene)diethyl-, chloride, iron(III) chloride deriv. Ammonium, [6-(diethylamino)-3H-xanthen-3-ylidene]diethyl-, tetrachloroferrate (1-)- Crude pyronine B Ethanaminium, N-[6-(diethylamino)-3H-xanthen-3-ylidene]-N-ethyl-, (T-4)-tetrachloroferrate(1-) NSC3093 Pyronine B, crude

pdb file: 538594.pdb
sdf file: 538594.sdf
directory: 538594


2,4-Pentanedione, nickel(II)deriv. 3264-82-2 Acetylacetonato nickel Bis(2,4-pentanedionato)nickel Bis(acetylacetonate)nickel Bis(acetylacetonato)nickel Bis(acetylacetone)nickel Bis-2,4-pentanedionatonickel(II) NSC4657 Ni(II) Acetylacetone complex (1:2) Nickel acetonylacetonate Nickel acetylacetonate Nickel bis(2,4-pentanedionate) Nickel bis(acetylacetonate) Nickel(2+) acetylacetonate Nickel(II) acetylacetonate Nickel, bis(2,4-pentanedionato)- Nickel, bis(2,4-pentanedionato-O,O')-, (SP-4-1)- Nickelous acetylacetonate WLN: 1V1V1 &-NI-

pdb file: 538874.pdb
sdf file: 538874.sdf
directory: 538874


2,4,6(1H,3H,5H)-Pyrimidinetrione, 5-(1-methylbutyl)-5-(2-propenyl)-, monosodium salt 309-43-3 5-Allyl-5(1-methylbutyl)barbituric acid sodium derivative 5-Allyl-5-(1-methylbutyl)barbituric acid, sodium salt 5-Allyl-5-(1-methylbutyl)malonylurea sodium salt Barbituric acid, 5-allyl-5-(1-methylbutyl)-, sodium salt Barbosec Bipanal Bipinal sodium Evronal Sodium Evrronal Hypotrol Imesonal Immenoctal Meballymal sodium NSC10818 Pramil Quinalbarbitone sodium Quinalspan SECOBARBITAL SODIUM Sebar Seco 8 Secobarbitone Seconal sodium Sedutain Seotal Sodium 5-allyl-5-(1-methylbutyl)barbiturate Sodium Seconal Sodium quinalbarbitone Sodium secobarbital Synate Trisomnin WLN: T6VMVMV FHJ FY3 & 1 F2U1 &-NA- [(Propylmethylcarbinyl)allyl] barbituric acid sodium salt

pdb file: 539975.pdb
sdf file: 539975.sdf
directory: 539975


NSC13193 TANNIC ACID, IRON (III) DERIV

pdb file: 540469.pdb
sdf file: 540469.sdf
directory: 540469


21H,23H-Porphine, 2,18-dipropanoic acid deriv., ferrous complex Ferrate(2-), chloro[7,12-diacetyl-3,8,13,17-tetramethyl- 21H,23H-porphine-2,18-dipropanoato(4-)-N(21),N(22),N(23), N(24)]-, dihydrogen, (SP-5-13) NSC19664

pdb file: 541578.pdb
sdf file: 541578.sdf
directory: 541578


(3-Cyanoguanidino)methylmercury (Cyanoguanidino)methylmercury 502-39-6 Agrosol Cyano(methylmercuri)guanidine Guanidine, cyano(methylmercurio)- Guanidine, cyano-, methylmercury deriv. MMD Mercury, (3-cyanoguanidino)methyl- Mercury, (cyanoguanidinato)methyl- Mercury, (cyanoguanidinato-N')methyl- Mercury, [cyanoguanidinato(1-)]methyl- Methyl mercuric dicyandiamide Methylmercuric cyanoguanidine Methylmercuric dicyanamide Methylmercuric dicyandiamide Methylmercury dicyandiamide Methylmercury dicyanodiamide Morsodren Morton EP-227 Morton Soil Drench Morton Soil-Drench-C N-Cyano-N'-(methylmercury)guanidine NSC20000 Pandrinox Pano-drench Pano-drench 4 Panodrin A-13 Panogen Panogen (old) Panogen 15 Panogen 43 Panogen 8 Panogen PX Panogen turf spray Panospray 30 R 8 R 8 (fungicide) WLN: NCMYUM&M-HG-1

pdb file: 541693.pdb
sdf file: 541693.sdf
directory: 541693


(3-Acetylpyridine)AD .beta.-DPN acetylpyridine analog 3-Acetyl NAD 3-Acetylpyridine NAD 3-Acetylpyridine adenine dinucleotide 3-Acetylpyridine analog ofDPN 3-Acetylpyridine diphosphopyridine nucleotide 3-Acetylpyridine-DPN 3-Acetylpyridine-adenine dinucleotide 3-Acetylpyridineadenine dinucleotide 86-08-8 AcPyAD Acetyl-3-pyridine adenine dinucleotide Acetylpyridine adenine dinucleotide Acetylpyridine-adenine dinucleotide Adenosine 5'-(trihydrogen diphosphate), 5'.fwdarw.5'-ester with 3-acetyl-1-.beta.-D-ribofuranosylpyridinium hydroxide, inner salt DPN 3-Acetylpyridine analog DPN, analogueol, 3-acetyl pyridine derivative Diphosphopyridine nucleotide, 1-(3-pyridinyl)ethanone analog Diphosphopyridine nucleotide, 3-acetylpyridine analog NSC20275 Nicotinamide acetylpyridine dinucleotide Nicotinamide-adenine dinucleotide, 3-acetyl analog Nicotinamide-hypoxanthine dinucleotide, 3-acetyl analog Pyridine, 3-acetyl-, derivative of DPN analogue Pyridinium, 3-acetyl-1-.beta.-D-ribofuranosyl-, hydroxide, 5'.fwdarw.5'-ester with adenosine 5'-(trihydrogen pyrophosphate), inner salt

pdb file: 541751.pdb
sdf file: 541751.sdf
directory: 541751


1887-02-1 2,5-Cyclohexadiene-1,4-dione, 2,3,5,6-tetrahydroxy-, disodium salt HPEK 1 Kelox M 122 NCI 974 NSC33520 THQ Tetrahydroxyquinone disodium derivative Tetrahydroxyquinone, disodium salt Tetroquinone disodium derivative p-Benzoquinone, 2,3,5,6-tetrahydroxy-, disodium salt p-Benzoquinone, tetrahydroxy-, disodium deriv.

pdb file: 543974.pdb
sdf file: 543974.sdf
directory: 543974


(Acetato)phenylmercury (Acetato-O)phenylmercury (Acetoxymercuri)benzene 62-38-4 Acetate phenylmercurique Acetic acid, phenylmercury deriv. Acetic acid, phenylmercury(II) salt Acetoxyphenylmercury Agrosan GN 5 Algimycin Algimycin 200 Anticon Antimucin WBR Antimucin WDR Benzene, (acetoxymercuri)- Benzene, (acetoxymercurio)- Bufen Bufen 30 C.I. Pigment Green 2 Ceresan Ceresan universal Contra Creme Dyanacide FMA Femma Fenylmercuriacetat Fungicide R Fungitox OR Gallotox Hexasan Hexasan, fungicide Hl-331 Hong nien Hostaquick Hostaquik Kwiksan Leytosan Liquiphene Meracen Mercuriphenyl acetate Mercuron Mercury(II) acetate, phenyl- Mercury, (acetato)phenyl- Mercury, (acetato-O)phenyl- Mercury, acetoxyphenyl- Mersolite Mersolite 8 Mersolite D Metasol 30 NSC35670 Neantina Norforms Nylmerate Octan fenylrtutnaty PMA PMAC PMAL PMAS Panomatic Phenmad Phenomercuric acetate Phenylmercuriacetate Phenylmercuric acetate

pdb file: 544724.pdb
sdf file: 544724.sdf
directory: 544724


.beta.-D-Ribofuranoside, methyl 5-[(2-chloroethyl)ethylamino]-5-deoxy-2,3-O-(1-methylethylidene)-, hydrochloride 6331-01-7 Furo[3,4-d]-1,3-dioxole, .beta.-D-ribofuranoside deriv. NSC45632 Ribofuranoside, methyl 5-[(2-chloroethyl)ethylamino]-5-deoxy-2,3-O-isopropylidene-, hydrochloride, .beta.-D-

pdb file: 546753.pdb
sdf file: 546753.sdf
directory: 546753


.beta.-D-Ribofuranoside, methyl-5-[(2-chloroethyl)amino]-5-deoxy-2,3-O-(1-methylethyldene)-, dihydrochloride 54946-35-9 Furo[3,4-d]-1,3-oxole, .beta.-D-ribofuranoside deriv. MP 697 NSC50741 Riboside Mustard

pdb file: 547383.pdb
sdf file: 547383.sdf
directory: 547383


14282-56-5 2,5-Thiophenedicarboxylic acid, 3,4-dihydroxy-, diethyl ester, disodium deriv. Dicetol disodium derivative NSC54007

pdb file: 547876.pdb
sdf file: 547876.sdf
directory: 547876


15635-23-1 6H-Purine-6-thione, 1,7-dihydro-, cobalt complex Cobalt, bis(1,7-dihydro-6H-pruine-6-thionato-N7,S6)- Cobalt, bis(1,9-dihydro-6H-purine-6-thionato-N7,S6)- NSC55478 Purine-6-thiol, cobalt(II) deriv.

pdb file: 548091.pdb
sdf file: 548091.sdf
directory: 548091


(Acetato)phenylmercury (Acetato-O)phenylmercury (Acetoxymercuri)benzene 62-38-4 Acetate phenylmercurique Acetic acid, phenylmercury deriv. Acetic acid, phenylmercury(II) salt Acetoxyphenylmercury Agrosan GN 5 Algimycin Algimycin 200 Anticon Antimucin WBR Antimucin WDR Benzene, (acetoxymercuri)- Benzene, (acetoxymercurio)- Bufen Bufen 30 C.I. Pigment Green 2 Ceresan Ceresan universal Contra Creme Dyanacide FMA Femma Fenylmercuriacetat Fungicide R Fungitox OR Gallotox Hexasan Hexasan, fungicide Hl-331 Hong nien Hostaquick Hostaquik Kwiksan Leytosan Liquiphene Meracen Mercuriphenyl acetate Mercuron Mercury(II) acetate, phenyl- Mercury, (acetato)phenyl- Mercury, (acetato-O)phenyl- Mercury, acetoxyphenyl- Mersolite Mersolite 8 Mersolite D Metasol 30 NSC61321 Neantina Norforms Nylmerate Octan fenylrtutnaty PMA PMAC PMAL PMAS Panomatic Phenmad Phenomercuric acetate Phenylmercuriacetate Phenylmercuric acetate

pdb file: 548798.pdb
sdf file: 548798.sdf
directory: 548798


15375-94-7 Hematoporphyrin mercury (II) Hematoporphyrin, mercury(II) deriv., disodium salt Hematoporphyrinmercury disodium salt Hg-hematoporphyrin-na M. h. Mercurate(2-), [7,12-bis(1-hydroxyethyl)-3,8,13,17-tetramethyl-21H,23H-porphine-2,18-dipropanoato(4-)-N21,N22,N23,N24]-, disodium, (SP-4-2)- Mercuri-hematoporphyrin disodium salt Mercury, [7,12-bis(1-hydroxyethyl)-3,8,13,17-tetramethyl-21H,23H-porphine-2,18-dipropanoato(2-)-N21,N22,N23,N24]-, disodium salt Mercury, [dihydrogen 7,12-bis(1-hydroxyethyl)-3,8,13,17-tetramethyl-2,18-porphinedipropionate(1-)]-, disodium salt Mercury, [dihydrogen 7,12-bis(1-hydroxyethyl)-3,8,13,17-tetramethyl-2,18-porphinedipropionate(2-)]-, disodium salt Merphyrin NSC66393

pdb file: 549450.pdb
sdf file: 549450.sdf
directory: 549450


NSC71321 Purine-6-thiol, ruthenium(III)dichloride deriv.

pdb file: 550137.pdb
sdf file: 550137.sdf
directory: 550137


17795-21-0 1H-Pyrazolo[3,4-d]pyrimidin-4-ol, monosodium salt 4H-Pyrazolo[3,4-d]pyrimidin-4-one, 1,5-dihydro-, monosodium salt Allopurinol sodium salt Allopurinol, sodium deriv. NSC108836 Sodium allopurinol

pdb file: 554630.pdb
sdf file: 554630.sdf
directory: 554630


2-Sulfanilamidopyrimidine sodium salt 547-32-0 Benzenesulfonamide, 4-amino-N-2-pyrimidinyl-, monosodium salt Monosodium 2-sulfanilamidopyrimidine NSC117870 Sodium sulfadiazine Sodium sulfapyrimidine Sodium, [N(sup 1)-2-pyrimidinylsulfanilamido]- Soluble sulfadiazine Soludiazine Sulfadiazine sodium Sulfanilamide, N(sup 1)-2-pyrimidinyl-, N(sup 1)-sodium deriv Sulfanilamide, N(sup 1)-2-pyrimidinyl-, monosodium salt Sulfanilamide, N1-2-pyrimidinyl-, monosodium salt Suthogen WLN: T6N CNJ BMSWR DZ &-NA-

pdb file: 555757.pdb
sdf file: 555757.sdf
directory: 555757


125-88-2 2,4,6(1H,3H,5H)-Pyrimidinetrione, 5-(1-methylethyl)-5-(2-propenyl)-, monosodium salt 5-Allyl-5-isopropylbarbituric acid sodium salt Alubarb Alurate Sodium Aprobarbital sodium Aprotal Arbatal Barbituric acid, 5-allyl-5-isopropyl-, sodium deriv Barbituric acid, 5-allyl-5-isopropyl-, sodium salt Barital Butalbital sodium Isopral NSC120767 Sodium 5-allyl-5-isopropylbarbiturate Sodium aprobarbital Somnipron WLN: T6MV DVN CHJ CY C2U1 FO &-NA-

pdb file: 556210.pdb
sdf file: 556210.sdf
directory: 556210


1,3-Dioxolo[4,5-g]isoquinoline, 5,6,7,8-tetrahydro-6-methyl-, hydrobromide 5985-05-7 DIOXOLOISOQUINOLINE DERIV Hydrohydrastine hydrobromide Hydrohydrastinine, hydrobromide NSC121859

pdb file: 556507.pdb
sdf file: 556507.sdf
directory: 556507


1,10-Phenanthroline, 2,9-dimethyl-4,7-diphenyl-, disulfo deriv., disodium salt 52698-84-7 Bathocuproine disulfonic acid, disodium salt NSC123541

pdb file: 556820.pdb
sdf file: 556820.sdf
directory: 556820


15105-92-7 2,7-(Epoxypentadeca[1,11,13]trienimino)naphtho[2,1-b]furan, rifamycin deriv. 2,7-(Epoxypentadeca[1,11,13]trienimino)naphtho[2,1-b]furan-1,11(2H)-dione, 5,6,9,17,19,21-hexahydroxy-23-methoxy-2,4,12,16,18,20,22-heptamethyl-, 21-acetate, monosodium salt Monosodium rifamycin SV NSC133100 RIFAMYCIN SV Rifamycin Rifamycin sodium salt Rifamycin, monosodium salt Rifocin

pdb file: 558026.pdb
sdf file: 558026.sdf
directory: 558026


62345-81-7 Aurelic acid magnesium deriv. Aureolic acid magnesium salt Aureolic acid, magnesium salt Mithramycin Mg salt Mithramycin magnesium salt Mithramycin, magnesium salt NSC143020 SK 26598

pdb file: 559313.pdb
sdf file: 559313.sdf
directory: 559313


1,1'-Ferrocenedicarboxylic acid, dimethyl ester 1273-95-6 Cyclopentadienecarboxylic acid, iron deriv., dimethyl ester Dimethyl 1,1'-ferrocenedicarboxylate Ferrocene, 1,1'-bis(methoxycarbonyl)- Iron, bis(carboxycyclopentadienyl)-, dimethyl ester NSC156886

pdb file: 561183.pdb
sdf file: 561183.sdf
directory: 561183


Benzene, 2-methyl-1,3,5-trinitro-, monobromo deriv. NSC159222

pdb file: 561462.pdb
sdf file: 561462.sdf
directory: 561462


.beta.-D-Ribofuranoside, methyl 5-[(2-bromoethyl)amino]-5-deoxy-2,3-O-(1-methylethylidene)-, hydrobromide 54946-44-0 Furo[3,4-d]-1,3-dioxole, .beta.-D-ribofuranoside deriv. NSC169557

pdb file: 562804.pdb
sdf file: 562804.sdf
directory: 562804


DL-Alanine, N-[[(2-chloroethyl)amino]carbonyl]-, mononitroso deriv. NSC171564

pdb file: 563282.pdb
sdf file: 563282.sdf
directory: 563282


15306-18-0 2,4-Pentanedione, 1,1,1,5,5,5-hexafluoro-, Al deriv Aluminum, tris(1,1,1,5,5,5-hexafluoro-2,4-pentanedionato)- Aluminum, tris(1,1,1,5,5,5-hexafluoro-2,4-pentanedionato-O,O')-, (OC-6-11)- Aluminum, tris(1,1,1,5,5,5-hexafluoroacetylacetonato)- NSC174888 Tris(1,1,1,5,5,5-hexafluoro-2,4-pentanedionato)aluminum

pdb file: 563727.pdb
sdf file: 563727.sdf
directory: 563727


(Hydroxymethyl)ferrocene 1273-86-5 Cyclopentadienemethanol, cyclopentadienyliron deriv. Ferrocene, (hydroxymethyl)- Ferrocenemethanol Ferrocenylcarbinol Ferrocenylmethanol NSC176246

pdb file: 564080.pdb
sdf file: 564080.sdf
directory: 564080


1,2,3,4-Oxatriazolium, 5-(methylamino)-3-phenyl-, chloride Methanamine, N-(3-phenyl-1,2,3,4-oxatriazolidin-5-ylidine)-, monohydrochloride, meso-ionic didehydro deriv. NSC176330

pdb file: 564105.pdb
sdf file: 564105.sdf
directory: 564105


56476-51-8 BL 3849A NSC178827 PYRAZOLOAMINE DERIV

pdb file: 564408.pdb
sdf file: 564408.sdf
directory: 564408


79883-03-7 DAUNOMYCINONE DERIV DAUNOMYCINONE, 8-(FORMYLHYDRAZONE), MONOHYDROCHLORIDE Hydrazinecarboxaldehyde, 2-[1-[4-[(3-amino-2,3,6-trideoxy-.alpha.-L-lyxo-hexopyranosyl)oxy]-1,2,3,4,6,11-hexahydro-2,5,12-trihydroxy-7-methoxy-6,11-dioxo-2-naphthacenyl]ethylidene]-, monohydrochloride, (2S-cis)- NSC180511

pdb file: 564527.pdb
sdf file: 564527.sdf
directory: 564527


77096-41-4 Benzo[a]heptalene, L-lysine deriv. COLKHISIN Colchizin L-Lysine, N6-[7-(acetylamino)-5,6,7,9-tetrahydro-1,2,3-trimethoxy-9-oxobenzo[a]heptalen-10-yl]- methyl ester, (S)- NSC183738

pdb file: 564718.pdb
sdf file: 564718.sdf
directory: 564718


2(3H)-Benzothiazolethione, sodium salt 2-Benzothiazolethiol, sodium deriv. 2-Benzothiazolethiol, sodium salt 2-Mercaptobenzothiazole sodium salt 2-Mercaptobenzothiazole, sodium 2-Mercaptobenzothiazole, sodium deriv. 2-Mercaptobenzothiazole, sodium salt 2492-26-4 Benzothiazolethiol, sodium salt Duodex Mercaptobenzothiazole sodium salt Mercaptobenzothiazole, sodium salt NSC191935 Nacap Sodium 2-benzothiazolethioate Sodium 2-benzothiazolethiolate Sodium 2-mercaptobenzothiazolate Sodium 2-mercaptobenzothiazole Sodium benzothiazolethiolate Sodium mercaptobenzothiazolate Sodium mercaptobenzothiazole Sodium, (2-benzothiazolylthio)- Vancide 51 WLN: T56 BN DSJ CSH &-NA-

pdb file: 565061.pdb
sdf file: 565061.sdf
directory: 565061


2,4,6-Trinitrophenol, sodium salt 3324-58-1 NSC221282 Phenol, 2,4,6-trinitro-, sodium salt Picric acid sodium salt Picric acid, sodium derivative Picric acid, sodium salt Sodium 2,4,6-trinitrophenolate Sodium picrate Sodium trinitrophenolate Sodium, (picryloxy)-

pdb file: 566958.pdb
sdf file: 566958.sdf
directory: 566958


NORFORMYCIN DERIV NSC226657 WIN 35281 WIN-35281

pdb file: 567185.pdb
sdf file: 567185.sdf
directory: 567185


NORFORMYCIN DERIV NSC226658 WIN 35624

pdb file: 567186.pdb
sdf file: 567186.sdf
directory: 567186


1,3,5-Triazine-2,4,6(1H,3H,5H)-trione, 1,3-dichloro-, potassium salt 1,3-Dichloro-s-triazine-2,4,6(1H,3H,5H)trione, potassium salt 2244-21-5 ACL-59 Dichlor-s-triazin-2,4,6(1H,3H,5H)trione potassium Dichloro-s-triazine-2,4,6(1H,3H,5H)-trione potassium Dichloro-s-triazine-2,4,6(1H,3H,5H)trione potassium deriv Dichloroisocyanuric acid, potassium salt Isocyanuric acid, dichloro-, potassium salt NSC251767 Potassium dichloro isocyanurate Potassium dichloro-s-triazinetrione Potassium dichloro-s-triazinetrione, dry Potassium dichlorocyanurate Potassium dichloroisocyanurate Potassium troclosene Troclosene potassium WLN: T6MVNVNVJ CG EG &-KA- s-Triazine-2,4,6(1H,3H,5H)-trione, 1,3-dichloro-, potassium salt s-Triazine-2,4,6(1H,3H,5H)-trione, dichloro-, potassium deriv

pdb file: 569012.pdb
sdf file: 569012.sdf
directory: 569012


Acetamide, N-(3,4-dihydroxyphenyl)-, monoacetate (ester) Acetamide, N-(3,4-dihydroxyphenyl)-, monoacetyl deriv. NSC252963

pdb file: 569093.pdb
sdf file: 569093.sdf
directory: 569093


1,5-Dimethyl-5-cyclohexenyl-1'-barbituric acid, sodium salt 2,4,6(1H,3H,5H)-Pyrimidinetrione, 5-(1-cyclohexen-1-yl)-1,5-dimethyl-, monosodium salt 2,4,6(1H,3H,5H)-Pyrimidinetrione, 5-(1-cyclohexen-1-yl)-1,5-dimethyl-, sodium salt 5-(1-Cyclohexen-1-yl)-1,5-dimethylbarbituric acid sodium salt 50-09-9 Barbituric acid, 5-(1-cyclohexen-1-yl)-1,5-dimethyl-, sodium salt Cyclohexenylmethyl-N-methyl barbituric acid sodium salt Cyclonal sodium Dorico Soluble Enhexymal Enhexymal NFN Evipal sodium Evipan sodium Hexanastab Hexobarbital Hexobarbital Na Hexobarbital sodium Hexobarbital soluble Hexobarbital, sodium deriv. Hexobarbitone Na Hexobarbitone sodium Methexenyl sodium NSC255103 Narcosan soluble Noctivane sodium Privenal Sodium 5-(1-cyclohexen-1-yl)-1,5-dimethylbarbiturate Sodium 5-(1-cyclohexenyl)-1,5-dimethylbarbiturate Sodium Evipal Sodium Evipan Sodium N-methyl cyclohexenylmethybarbiturate Sodium hexabarbital Sodium hexobarbital Sodium hexobarbitone Sodium methylhexabital Sodium methylhexabitol WLN: T6VMVNV FHJ D1 F1 F- AL6UTJ &-NA-

pdb file: 569253.pdb
sdf file: 569253.sdf
directory: 569253


(S)-Cyclic(D-alanyl-L-alanyl-N,O-dimethyl-L-tyrosyl-L-alanyl-.beta.-hydroxy-N-methyl-L-tyrosyl-3-hydroxy-N-methyl-L-tyrosyl) cyclic (54.fwdarw.63)-ether 22-Oxa-3,6,9,12,15,29-hexaazatetracyclo[14.12.2.218,2-1.123,27]tritriacontane, cyclic peptide deriv. 64755-14-2 BOUVARDIN Cyclic(D-alanyl-L-alanyl-N,O-dimethyl-L-tyrosyl-L-alanyl-.beta.-hydroxy-N-methyl-L-tyrosyl-3-hydroxy-N-methyl-L-tyrosyl), cyclic(54.fwdarw.63)-ether, (S)- From fraction F049 of Bouvardia ternifolia NSC 259968 NSC259968

pdb file: 569465.pdb
sdf file: 569465.sdf
directory: 569465


22-Oxa-3,6,9,12,15,29-hexaazatetracyclo[14.12.2.218,21.123,27]tritriacontane, cyclic peptide deriv. 64725-24-2 Bouvardin, 5-(N-methyl-L-tyrosine)- DEOXYBOUVARDIN NSC259969

pdb file: 569466.pdb
sdf file: 569466.sdf
directory: 569466


14287-82-2 ANGUIDINE DERIV 4B,15-DIACETOXY-3A,7A-DIHYDROXY-12,13-EPOXYTRICHOTHEC-9-EN-8-ONE NSC267034 Trichothec-9-en-8-one, 4,15-bis(acetyloxy)-12,13-epoxy-3,7-dihydroxy-, (3.alpha.,4.beta.,7.alpha.)-

pdb file: 569959.pdb
sdf file: 569959.sdf
directory: 569959


14287-83-3 3a,4b,7a,15-Tetracetoxy-12,13-epoxy-trichothec-9-en-8-one ANGUIDINE DERIV 3A,4B,7A,15-TETRAACETOXY-12,13-EPOXYTRICHOTHEC-9-EN-8-ONE NSC267035

pdb file: 569960.pdb
sdf file: 569960.sdf
directory: 569960


3-ACETYLDEOXYNIVALENOL 50722-38-8 ANGUIDINE DERIV 3A,ACETOXY-7A,15- DIHYDROXY-12,13-EPOXYTRICHOTEC-9-EN-8-ONE NSC267036 Trichothec-9-en-8-one, 3-(acetyloxy)-7,15-dihydroxy-, (3.alpha.,7.alpha.)- WLN: T C665 A AX EV IO FUTJ B1 C1Q DQ F1 KOV1 LOV1U2 A-& BT3OX CHJ

pdb file: 569961.pdb
sdf file: 569961.sdf
directory: 569961


76675-87-1 BUFADIENOLIDE DERIV Bufa-20,22-dienolide, 3-(acetyloxy)-14,15-epoxy-16-(formyloxy)-, (3.beta.,5.beta.,15.beta.,16.beta.)- NSC267899

pdb file: 570092.pdb
sdf file: 570092.sdf
directory: 570092


BUFADIENOLIDE DERIV NSC267907

pdb file: 570093.pdb
sdf file: 570093.sdf
directory: 570093


51550-28-8 NSC269145 VOMITOXIN, TRIACETOXY DERIV Vomitoxin, triacetoxy deriv.

pdb file: 570250.pdb
sdf file: 570250.sdf
directory: 570250


1,4-Diazabicyclo[2.2.1]heptane, 1,4-diazoniabicyclo[2.2.1]- heptane deriv. 1,4-Diazoniabicyclo[2.2.1]heptane, 1,4-bis(2-chloroethyl)-, salt with 2-hydroxybenzoic acid (1:2) 76577-91-8 Benzoic acid, 2-hydroxy-, ion(1-), 1,4-bis(2-chloroethyl)-1,4-diazoniabicyclo[2.2.1]heptane (2:1) NSC271882

pdb file: 570514.pdb
sdf file: 570514.sdf
directory: 570514


1-Naphthacenecarboxylic acid, 2-ethyl-1,2,3,4,6,11-hexahydro-2,5,7,10-tetrahydroxy-6,11-dioxo-4-[[2,3,6-trideoxy-3-(dimethylamino)-.alpha.-L-lyxo-hexopyranosyl]oxy]-, methyl ester, hydrochloride, [1R-(1.alpha.,2.beta.,4.beta.)]- NSC272352 PYRROMYCIN DERIV Pyrromycin Hydrochloride

pdb file: 570540.pdb
sdf file: 570540.sdf
directory: 570540


70074-23-6 Adriamycin deriv. Butanedioic acid, bis[[1-[4-[(3-amino-2,3,6-trideoxy-.alpha.-L-lyxo-hexopyranosyl)oxy]-1,2,3,4,6,11-hexahydro-2,5,12-trihydroxy-7-methoxy-6,11-dioxo-2-naphthacenyl]-2-hydroxyethylidene]hydrazide], dihydrochloride, (2S-(2.alpha.(2R*,4R*),4.alpha.))- Butanedioic acid, bis[[1-[4-[(3-amino-2,3,6-trideoxy-.alpha.-L-lyxo-hexopyranosyl)oxy]-1,2,3,4,6,11-hexahydro-2,5,12-trihydroxy-7-methoxy-6,11-dioxo-2-naphthacenyl]-2-hydroxyethylidene]hydrazide], dihydrochloride, (2S-(2.alpha.,2(2R*,4R*))) Butanedioic acid, bis[[1-[4-[(3-amino-2,3,6-trideoxy-.alpha.-L-lyxo-hexopyranosyl)oxy]-1,2,3,4,6,11-hexahydro-2,5,12-trihydroxy-7-methoxy-6,11-dioxo-2-naphthacenyl]-2-hydroxyethylidene]hydrazide], dihydrochloride, [2S-[2.alpha.,2(2R*,4R*),4.alpha.]]- NSC273433

pdb file: 570588.pdb
sdf file: 570588.sdf
directory: 570588


NSC273756 WITHAFERIN DERIV JPR WA UPM, IOWA U. COMPOUND

pdb file: 570596.pdb
sdf file: 570596.sdf
directory: 570596


2H,4H-Oxazolo[5,4,3-ij]pyrido[3,2-g]quinoline-4,10(11H)-dione, 8-[(dimethylamino)methyl]-6,11-dimethyl-, monohydrochloride NSC275428 NYBOMYCIN DERIV Nybomycin deriv. hydrochloride

pdb file: 570692.pdb
sdf file: 570692.sdf
directory: 570692


NSC277096 VINCALEUKOBLASTINE DERIV VINCALEUKOBLASTINE DERIV. Vincaleukoblastine, 3,3''-[dithiobis(2,1-ethanediyliminocarbonyl)]bis(O(4)-deacetyl-3-de(methoxycarbonyl)-, sulfate (1:2) (salt) Vincaleukoblastine, 3,3''-[dithiobis(2,1-ethanediyliminocarbonyl)]bis[O(4)-deacetyl-3-de(methoxycarbonyl)-, sulfate (1:2) (salt) Vincaleukoblastine, 3,3''-[dithiobis(2,1-ethanediyliminocarbonyl)]bis[O4-deacetyl-3-de(methoxycarbonyl)-, sulfate (1:2) (salt)

pdb file: 570772.pdb
sdf file: 570772.sdf
directory: 570772


58569-78-1 6H-Furo[2',3':4,5]oxazolo[3,2-a]pyrimidine, undecanoic acid deriv. NSC281722 Undecanoic acid, [2,3,3a,9a-tetrahydro-6-imino-3-[(1-oxoundecyl)oxy]-6H-furo[2',3':4,5]oxazolo[3,2-a]pyrimidin-2-yl]methyl ester, monohydrochloride, (2R-(2a,3.beta.,3a.beta.,9a.beta.))-

pdb file: 571085.pdb
sdf file: 571085.sdf
directory: 571085


59859-99-3 EN 589 KAURANE DERIV Kaur-16-en-15-one, 11-(acetyloxy)-18,20-epoxy-7,14,20-trihydroxy-, (4.alpha.,7.alpha.,11.beta.,14R,20R)- NSC282159

pdb file: 571177.pdb
sdf file: 571177.sdf
directory: 571177


2H-1,11c-(Epoxymethano)phenanthro[10,1-bc]pyran, picras-3-ene-2,16-dione deriv. 6-.alpha.-Senecioyloxychaparrinone 6.ALPHA.-SENECIOYLOXYCHAPARRINONE 68499-52-5 CHAPARRINONE, 6A-SENECIOYLOXY NSC290494 Picras-3-ene-2,16-dione, 11,20-epoxy-1,11,12-trihydroxy-6-[(3-methyl-1-oxo-2-butenyl)oxy]- Picras-3-ene-2,16-dione, 11,20-epoxy-1,11,12-trihydroxy-6-[(3-methyl-1-oxo-2-butenyl)oxy]-, (1.beta.,6.alpha.,11.beta.,12.alpha.)-

pdb file: 571843.pdb
sdf file: 571843.sdf
directory: 571843


4,24-Dioxa-9,22-diazatetracyclo[19.3.1.110,14.03,5]hexacosane, maytansine deriv. 66584-72-3 Ansamitocin P 3 Ansamitocin P-3 MAYTANSINE DERIV Maytansine, 2'-de(acetylmethylamino)-2'-methyl- Maytansinol isobutyrate NSC292222 TAM-330 Tam 330

pdb file: 571989.pdb
sdf file: 571989.sdf
directory: 571989


4,24-Dioxa-9,22-diazatetracyclo[19.3.1.110,14.03,5]hexacosane, maytansine deriv. 66547-10-2 Ansamitocin P 4 MAYTANSINE DERIV Maytansine, 3-de(2-(acetylmethylamino)-1-oxopropoxy)-3-(3-methyl-1-oxobutoxy)- Maytansine, 3-de[2-(acetylmethylamino)-1-oxopropoxy]-3-(3-methyl-1-oxobutoxy)- Maytansine, O3-de[2-(acetylmethylamino)-1-oxopropyl]-O3-(3-methyl-1-oxobutyl)- Maytansinol isovalerate NSC292223 TAM-340 Tam 340

pdb file: 571990.pdb
sdf file: 571990.sdf
directory: 571990


2841-82-9 Monoacetyl verrucarin A epoxide NSC292463 Spiro(3,5-methano-14H,20H,21H-oxireno[h][1,6,12]trioxacyclooctadecino[3,4-d][1]benzopyran-4(3H),2'-oxirane), verrucarin A deriv. VERRUCARIN A EPOXIDE, MONOACETYL Verrucarin A, 2'-O-acetyl-9,10-epoxy-9,10-dihydro-, (9.alpha.,10.alpha.)- Verrucarin A, O2'-acetyl-9,10-epoxy-9,10-dihydro-

pdb file: 572040.pdb
sdf file: 572040.sdf
directory: 572040


55686-31-2 ANSAMYCIN: RIFAMYCIN DERIV LM097 NSC295109

pdb file: 572335.pdb
sdf file: 572335.sdf
directory: 572335


79855-04-2 ANSAMYCIN: RIFAMYCIN DERIV LM112 NSC295110

pdb file: 572336.pdb
sdf file: 572336.sdf
directory: 572336


62295-71-0 ANSAMYCIN: RIFAMYCIN DERIV LM118 NSC295111

pdb file: 572337.pdb
sdf file: 572337.sdf
directory: 572337


62295-74-3 ANSAMYCIN: RIFAMYCIN DERIV LM165 NSC295113 Rifamycin XIV, 1',4-didehydro-1-deoxy-1,4-dihydro-1-oxo-5'-(phenylmethyl)- Spiro[9,4-(epoxypentadeca[1,11,13]trienimino)- 2H-furo[2',3':7,8]naphth[1,2-d]imidazole-2,4'-piperidine], rifamycin XIV deriv.

pdb file: 572338.pdb
sdf file: 572338.sdf
directory: 572338


62796-37-6 ANSAMYCIN: RIFAMYCIN DERIV LM329 NSC295116

pdb file: 572339.pdb
sdf file: 572339.sdf
directory: 572339


66892-00-0 ANSAMYCIN: RIFAMYCIN DERIV NSC295119 R-112

pdb file: 572341.pdb
sdf file: 572341.sdf
directory: 572341


66781-08-6 ANSAMYCIN: RIFAMYCIN DERIV NSC295120 R-120

pdb file: 572342.pdb
sdf file: 572342.sdf
directory: 572342


66891-97-2 ANSAMYCIN: RIFAMYCIN DERIV NSC295122 R-175

pdb file: 572343.pdb
sdf file: 572343.sdf
directory: 572343


66892-06-6 ANSAMYCIN: RIFAMYCIN DERIV NSC295123 R-198

pdb file: 572344.pdb
sdf file: 572344.sdf
directory: 572344


(3.alpha.,4.beta.)-3-Acetoxyscirpene-4,15-diol ANGUIDINE DERIV (3-ACETOXYSCIRPENE-4,15-DIOL) NSC298222 Trichotech-9-ene-3,4,15-triol, 12,13-epoxy-, 3-acetate, (3.alpha.,4.beta.)-

pdb file: 572618.pdb
sdf file: 572618.sdf
directory: 572618


1H-Imidazo[4,5-f]quinoline, acetamide deriv. 55435-65-9 ACODAZOLE HCL Acetamide, N-methyl-N-[4-[(7-methyl-1H-imidazo[4,5-f]quinolin-9-yl)amino]phenyl]-, monohydrochloride Acodazole NSC305884

pdb file: 573290.pdb
sdf file: 573290.sdf
directory: 573290


DAUNOMYCIN DERIV NSC310827

pdb file: 573678.pdb
sdf file: 573678.sdf
directory: 573678


4,24-Dioxa-9,22-diazatetracyclo[19.3.1.110,14.03,5]hexacosane, maytansine deriv. 72902-38-6 ANSAMITOCIN DERIV Maytansine, 2'-de(acetylmethylamino)-O(20)-demethyl-2'-methyl- Maytansine, 2'-de(acetylmethylamino)-O20-demethyl-2'-methyl- NSC314018 TN-006

pdb file: 573858.pdb
sdf file: 573858.sdf
directory: 573858


77620-52-1 NSC314632 Spiro(2,5-methano-1-benzoxepin-10,2'-oxirane), trichothec-9-ene-3,4,15-triolderiv. TRICHOTHECANE DERIV Trichothec-9-ene-3,4,15-triol, 12,13-epoxy-, 4-(chloroacetate) 15-(2-methyl-2-propenoate), (3.alpha.,4.beta.)-

pdb file: 573930.pdb
sdf file: 573930.sdf
directory: 573930


5,12-Naphthacenedione, 8-acetyl-10-[(3-amino-2,3,6-trideoxy-.alpha.-L-lyxo-hexopyranosyl)oxy]-7,8,9,10-tetrahydro-6,8,11-trihydroxy-1-methoxy-, N,N'-1,5-pentanediylidene deriv., dihydrochloride, [8S-[8.alpha.,10.alpha.(8'R*,10'R*)]]- NSC317924

pdb file: 574079.pdb
sdf file: 574079.sdf
directory: 574079


74516-67-9 NSC319081 RORIDIN A B-9,10-EPOXIDE Spiro(3,5-methano-14H,20H,21H-oxireno[h][1,6,12]trioxacyclooctadecino[3,4-d][1]benzopyran-4(3H),2'-oxirane), verrucarin A deriv. Verrucarin A, 7'-deoxo-9,10-epoxy-9,10-dihydro-7'-(1-hydroxyethyl)-, (9.beta.,10.beta.)- Verrucarin A, 7'-deoxo-9,10-epoxy-9,10-dihydro-7'-(1-hydroxyethyl)-, (9R,10S)-

pdb file: 574109.pdb
sdf file: 574109.sdf
directory: 574109


79320-85-7 NSC320016 Spiro(2,5-methano-1-benzoxepin-10,2'-oxirane), trichothec-9-en-3-one deriv. Trichothec-9-en-3-one, 12,13-epoxy-4,15-bis[(2-methyl-1-oxo-2-propenyl)oxy]-, (4.beta.)-

pdb file: 574157.pdb
sdf file: 574157.sdf
directory: 574157


17-Des-O-methyl-17-cyclopropylamino-geldanamycin 71952-91-5 GELDANAMYCIN DERIV NSC320876

pdb file: 574213.pdb
sdf file: 574213.sdf
directory: 574213


71952-92-6 GELDANAMYCIN DERIV Geldanamycin, 17-[(2-chloroethyl)amino]-17-demethoxy- NSC320877

pdb file: 574214.pdb
sdf file: 574214.sdf
directory: 574214


1,4-Diazabicyclo[2.2.1]heptane, 1,4-diazoniabicyclo[2.2.1] heptane deriv. 1,4-Diazoniabicyclo[2.2.1]heptane, 1,4-bis(2-chloroethyl)-, dinitrate 77628-01-4 NSC320937

pdb file: 574216.pdb
sdf file: 574216.sdf
directory: 574216


22-Oxa-3,6,9,12,15,29-hexaazatetracyclo[14.12.2.218,21.123, 27]tritriacontane, cyclic peptide deriv 88360-88-7 BOUVARDIN, O-DESMETHYL Bouvardin, 3-(N-methyl-L-tyrosine)- DESMETHYLBOUVARDIN NSC324579 O-Desmethylbouvardin

pdb file: 574443.pdb
sdf file: 574443.sdf
directory: 574443


Brassinolide CHOLESTAN-6-ONE DERIV NSC325306

pdb file: 574489.pdb
sdf file: 574489.sdf
directory: 574489


93860-61-8 CHOLESTAN-6-ONE DERIV NSC325611

pdb file: 574496.pdb
sdf file: 574496.sdf
directory: 574496


77620-58-7 NSC325629 Spiro(2,5-methano-1-benzoxepin-10,2'-oxirane), trichothec-9-ene-3,8-dione deriv. Trichothec-9-ene-3,8-dione, 15-(acetyloxy)-12,13-epoxy-4-[(2-methyl-1-oxo-2-propenyl)oxy]-, (4.beta.)-

pdb file: 574502.pdb
sdf file: 574502.sdf
directory: 574502


77620-59-8 NSC325632 Spiro(2,5-methano-1-benzoxepin-10,2'-oxirane), trichothec-9-ene-3,8-dione deriv. Trichothec-9-ene-3,8-dione, 12,13-epoxy-4,15-bis[(2-methyl-1-oxo-2-propenyl)oxy]-, (4.beta.)-

pdb file: 574505.pdb
sdf file: 574505.sdf
directory: 574505


62595-72-6 BERBERINE DERIV JCI 2218 NSC326124

pdb file: 574524.pdb
sdf file: 574524.sdf
directory: 574524


61138-60-1 BERBERINE DERIV JCI 2219 NSC326125

pdb file: 574525.pdb
sdf file: 574525.sdf
directory: 574525


BERBERINE DERIV JCI 2220 NSC326126

pdb file: 574526.pdb
sdf file: 574526.sdf
directory: 574526


70866-40-9 BERBERINE DERIV JCI 2221 NSC326127

pdb file: 574527.pdb
sdf file: 574527.sdf
directory: 574527


81776-98-9 BICYCLO-OCTANE CARBOXYLIC ACID DERIV NSC326237

pdb file: 574552.pdb
sdf file: 574552.sdf
directory: 574552


61102-55-4 KAURANONE DERIV NSC326238

pdb file: 574553.pdb
sdf file: 574553.sdf
directory: 574553


NSC327446 PIPERIDINOACETIC ACID DERIV Piperidinoacetic acid derivative

pdb file: 574610.pdb
sdf file: 574610.sdf
directory: 574610


2-Azabicyclo[16.3.1]docosane, geldanamycin deriv. 73341-72-7 Geldanamycin, 6,17-didemethoxy-15-methoxy-6-methyl-11-O-methyl-, (6S,15R)- MACBECIN I NSC330499

pdb file: 574815.pdb
sdf file: 574815.sdf
directory: 574815


2-Azabicyclo[16.3.1]docosane, geldanamycin deriv. 73341-73-8 Geldanamycin, 18,21-didehydro-6,17-didemethoxy-18,21-dideoxo-18,21-dihydroxy-15-methoxy-6-methyl-11-O-methyl- Geldanamycin, 18,21-didehydro-6,17-didemethoxy-18,21-dideoxo-18,21-dihydroxy-15-methoxy-6-methyl-11-O-methyl-, (6S,15R)- MACBECIN II NSC330500

pdb file: 574816.pdb
sdf file: 574816.sdf
directory: 574816


17-AAG 2-Azabicyclo[16.3.1]docosane, geldanamycin deriv. 75747-14-7 CP 127374 GLD-36 Geldanamycin, 17-allylamino-17-demethoxy- Geldanamycin, 17-demethoxy-17-(2-propenylamino)- Geldanamycin, des-O-methyl-17-allylamino- NSC330507

pdb file: 574817.pdb
sdf file: 574817.sdf
directory: 574817


76236-33-4 NSC332052 PODOPHYLLOTOXIN, DEGRADED DITHIANE DERIV

pdb file: 574894.pdb
sdf file: 574894.sdf
directory: 574894


1-Propylagroclavine tartrate 89930-60-9 Ergoline, 8,9-didehydro-6,8-dimethyl-1-propyl-, [R-(R*,R*)]-, 2,3-dihydroxybutanedioate (1:1) Indolo[4,3-fg]quinoline, ergoline deriv. NSC332292

pdb file: 574908.pdb
sdf file: 574908.sdf
directory: 574908


1,4-Diazabicyclo[2.2.1]heptane, 1,4-diazoniabicyclo[2.2.1] heptane deriv. 1,4-Diazoniabicyclo[2.2.1]heptane, 1,4-bis(2-chloroethyl)-, salt with phosphonoacetic acid (1:2) 79235-03-3 Acetic acid, phosphono-, ion(1-), compd. with 1,4-bis(2-chloroethyl)-1,4-diazoniabicyclo[2.2.1]heptane (2:1) NSC332989

pdb file: 574968.pdb
sdf file: 574968.sdf
directory: 574968


MITOMYCIN DERIV NSC333053

pdb file: 574976.pdb
sdf file: 574976.sdf
directory: 574976


FLAVONE DERIV NSC339191

pdb file: 575340.pdb
sdf file: 575340.sdf
directory: 575340


1H-Pyrrolo[2,1-i][1,4,7,10,13]oxatetraazacyclohexadecine, cyclic peptide deriv. 2H,6H-1,4-Oxazino[3,2-b]phenoxazine, L-valine deriv. 70789-47-8 ACTINOMYCIN D 3-(FLUOROMETHYL) OXAZINONE L-Valine, L-threonyl-D-valyl-L-prolyl-N-methylglycyl-N-methyl-, .xi.-lactone, 1,1'-diamide with 3-(fluoromethyl)-10,12-dimethyl-2-oxo-2H,6H-1,4-oxazino[3,2-b]phenoxazine-5,7-dicarboxylic acid NSC339280

pdb file: 575344.pdb
sdf file: 575344.sdf
directory: 575344


.alpha.-5,6-Epoxide of chorismic acid 61414-76-4 CHORISMIC ACID, 5,6-EPOXIDE DERIV NSC340286

pdb file: 575476.pdb
sdf file: 575476.sdf
directory: 575476


NSC344008 VERRUCARIN A DERIV CL S14-G Verrucarin A, 2',3'-didehydro-2'-deoxy-13'-hydroxy-

pdb file: 575678.pdb
sdf file: 575678.sdf
directory: 575678


NSC346199 WITHAFERIN DERIV GG-AM-1

pdb file: 575769.pdb
sdf file: 575769.sdf
directory: 575769


NSC346200 WITHAFERIN DERIV GG-AM-2

pdb file: 575770.pdb
sdf file: 575770.sdf
directory: 575770


NSC346201 WITHAFERIN DERIV GG-AM-3

pdb file: 575771.pdb
sdf file: 575771.sdf
directory: 575771


NSC346202 WITHAFERIN DERIV GG-AM-4

pdb file: 575772.pdb
sdf file: 575772.sdf
directory: 575772


NSC346203 WITHAFERIN DERIV GG-AM-5

pdb file: 575773.pdb
sdf file: 575773.sdf
directory: 575773


NSC346204 WITHAFERIN DERIV GG-AM-6

pdb file: 575774.pdb
sdf file: 575774.sdf
directory: 575774


NSC346205 WITHAFERIN DERIV GG-AZ-2-AC

pdb file: 575775.pdb
sdf file: 575775.sdf
directory: 575775


84397-24-0 MITOMYCIN DERIV NSC347782

pdb file: 575839.pdb
sdf file: 575839.sdf
directory: 575839


NSC348696 PHORBOL DERIV I

pdb file: 575866.pdb
sdf file: 575866.sdf
directory: 575866


NSC348697 PHORBOL DERIV III

pdb file: 575867.pdb
sdf file: 575867.sdf
directory: 575867


4,24-Dioxa-9,22-diazatetracyclo(19.3.1.1(10,14).0(3,5))hexacosane, maytansine deriv. 78987-28-7 B820915K135 DEMETHYLTREWIASINE B820915K135 Demethyltrewasine Demethyltrewiasine Maytansine, N(2')-deacetyl-N(2')-demethyl-15-methoxy-N(2')-(2-methyl-1-oxopropyl)- Maytansine, N2'-deacetyl-N2'-demethyl-15-methoxy-N2'-(2-methyl-1-oxopropyl)- N'-Demethyltrewiasine NSC348700

pdb file: 575869.pdb
sdf file: 575869.sdf
directory: 575869


DAUNORUBICIN DERIV DR-2 Derivatives of Daunorubicin NSC351130

pdb file: 576012.pdb
sdf file: 576012.sdf
directory: 576012


DAUNORUBICIN DERIV DR-5 Derivatives of Daunorubicin NSC351131

pdb file: 576013.pdb
sdf file: 576013.sdf
directory: 576013


DAUNORUBICIN DERIV DR-8 Derivatives of Daunorubicin NSC351132

pdb file: 576014.pdb
sdf file: 576014.sdf
directory: 576014


DAUNORUBICIN DERIV DR-9 NSC351133

pdb file: 576015.pdb
sdf file: 576015.sdf
directory: 576015


DAUNORUBICIN DERIV Derivatives of Daunorubicin NSC351134

pdb file: 576016.pdb
sdf file: 576016.sdf
directory: 576016


DAUNORUBICIN DERIV NSC351135

pdb file: 576017.pdb
sdf file: 576017.sdf
directory: 576017


DAUNORUBICIN DERIV Derivatives of Daunorubicin NSC351136

pdb file: 576018.pdb
sdf file: 576018.sdf
directory: 576018


DAUNORUBICIN DERIV NSC351137

pdb file: 576019.pdb
sdf file: 576019.sdf
directory: 576019


24470-33-5 NSC352265 SOLSTITIALIN DERIV 4704

pdb file: 576145.pdb
sdf file: 576145.sdf
directory: 576145


NSC352266 SOLSTITIALIN DERIV 4702

pdb file: 576146.pdb
sdf file: 576146.sdf
directory: 576146


NSC352267 SOLSTITIALIN DERIV 4701

pdb file: 576147.pdb
sdf file: 576147.sdf
directory: 576147


15-Methoxymaysine 4,24-Dioxa-9,22-diazatetracyclo(19.3.1.1(10,14).0(3,5))hexacosane, maytansine deriv. 78987-29-8 B820915K136 Maytansine, 3-de[2-(acetylmethylamino)-1-oxopropoxy]-2,3-didehydro-15-methoxy-, (2E)- NSC354641 TWEWSINE (B820915K136) Trewsine

pdb file: 576304.pdb
sdf file: 576304.sdf
directory: 576304


3,7,30-Trioxa-9,22,27-triazapentacyclo(20.8.2.1(6,10).1(17,21).0(2,4))tetratriacontane, treflorine deriv. 82400-19-9 B820915K182 N-Methyltrenudone NSC354643 TRENUDONE, N-METHYL (B820915K182) Treflorine, 3'-methyl-6'-oxo Treflorine, 3'-methyl-6'-oxo-

pdb file: 576306.pdb
sdf file: 576306.sdf
directory: 576306


4,24-Dioxa-9,22-diazatetracyclo(19.3.1.1(10,14).0(3,5))hexacosane, maytansine deriv. 88147-94-8 B820915K186 Maytansine, N(2')-deacetyl-22-demethyl-15-methoxy-N(2')-(2-methyl-1-oxopropyl)- Maytansine, N2'-deacetyl-22-demethyl-15-methoxy-N2'-(2-methyl-1-oxopropyl)- NSC354645 Nortrewiasine TREWIASINE, NOR (B820915K186)

pdb file: 576308.pdb
sdf file: 576308.sdf
directory: 576308


HARMINE DERIV HEJ-2 NSC356215

pdb file: 576402.pdb
sdf file: 576402.sdf
directory: 576402


85645-30-3 HARMINE DERIV HEJ-4 NSC356217

pdb file: 576403.pdb
sdf file: 576403.sdf
directory: 576403


HEJ-8 NSC356221 RESERPINE DERIV

pdb file: 576404.pdb
sdf file: 576404.sdf
directory: 576404


6H-Pyrido[4,3-b]carbazolium, 2-[2-(diethylamino)ethyl]-5,11-dimethyl-, acetate ELLIPTICINE DERIV SRI-NB-B233-55-29 NSC359449

pdb file: 576558.pdb
sdf file: 576558.sdf
directory: 576558


DAUNORUBICIN DERIV - DR-1 NSC359653

pdb file: 576571.pdb
sdf file: 576571.sdf
directory: 576571


DAUNORUBICIN DERIV - DR-7 NSC359654

pdb file: 576572.pdb
sdf file: 576572.sdf
directory: 576572


DAUNORUBICIN DERIV - NSC359656

pdb file: 576573.pdb
sdf file: 576573.sdf
directory: 576573


KAUROIC ACID, DERIV, METHYL-ESTER NSC360861

pdb file: 576637.pdb
sdf file: 576637.sdf
directory: 576637


ANTIBIOTIC 382B KIJANIMICIN DERIV Kijanimicin, 3(B)-O-de(2,6-dideoxy-.alpha.-L-ribo-hexopyranosyl)- NSC363182 U-64815

pdb file: 576756.pdb
sdf file: 576756.sdf
directory: 576756


NSC363609 STEGANOSIDE DERIV

pdb file: 576770.pdb
sdf file: 576770.sdf
directory: 576770


ALLAMANDIN DERIV JMB-BS-1 NSC364160

pdb file: 576862.pdb
sdf file: 576862.sdf
directory: 576862


ALLAMANDIN DERIV JMB-BS-2 NSC364172

pdb file: 576866.pdb
sdf file: 576866.sdf
directory: 576866


ALLAMANDIN DERIV JMB-BS-3 NSC364173

pdb file: 576867.pdb
sdf file: 576867.sdf
directory: 576867


ALLAMANDIN DERIV JMB-BS-4 NSC364174

pdb file: 576868.pdb
sdf file: 576868.sdf
directory: 576868


ALLAMANDIN DERIV JMB-BS-5 NSC364175

pdb file: 576869.pdb
sdf file: 576869.sdf
directory: 576869


ALLAMANDIN DERIV JMB-BS-7 NSC364176

pdb file: 576870.pdb
sdf file: 576870.sdf
directory: 576870


ACTINOMYCIN D, N-METHYLALANINE DERIV NSC367092

pdb file: 577055.pdb
sdf file: 577055.sdf
directory: 577055


ACTINOMYCIN D, N-METHOXYCARBONYLETHYLGLYCINE DERIV NSC367093

pdb file: 577056.pdb
sdf file: 577056.sdf
directory: 577056


BLEOMYCIN DERIV-DR. PANDIT NSC367921

pdb file: 577108.pdb
sdf file: 577108.sdf
directory: 577108


DAUNORUBICIN ADRIAMYCIN DER. AM10 Daunorubicin/Adriamycin derivitive NSC369037

pdb file: 577163.pdb
sdf file: 577163.sdf
directory: 577163


KAURANE DERIV NSC369409

pdb file: 577190.pdb
sdf file: 577190.sdf
directory: 577190


Daunorubicin deriv. NSC372108

pdb file: 577371.pdb
sdf file: 577371.sdf
directory: 577371


79411-09-9 GERANYLGERANIOL DERIV Geranylgeraniol deriv. NSC372932

pdb file: 577465.pdb
sdf file: 577465.sdf
directory: 577465


NIDOHOTTIN DERIV NSC372933 Nidohottin deriv.

pdb file: 577466.pdb
sdf file: 577466.sdf
directory: 577466


KOANOPHYLLIC ACID DERIV (3) Koanophyllic acid deriv. NSC372934

pdb file: 577467.pdb
sdf file: 577467.sdf
directory: 577467


KOANOPHYLLIC ACID DERIV (4) Koanophyllic acid deriv. NSC372935

pdb file: 577468.pdb
sdf file: 577468.sdf
directory: 577468


KOANOPHYLLIC ACID DERIV (5) Koanophyllic acid deriv. NSC372936

pdb file: 577469.pdb
sdf file: 577469.sdf
directory: 577469


5,12-Naphthacenedione, 10-[[3(5),4-anhydro-3-(3-cyano-5-hydroxy-4-morpholinyl)-2,3,6-trideoxy-.alpha.-L-lyxo-hexopyranosyl]oxy]-7,8,9,10-tetrahydro-6,8,11-trihydroxy-8-(hydroxyacetyl)-1-methoxy- Doxorubicin deriv. NSC373232

pdb file: 577480.pdb
sdf file: 577480.sdf
directory: 577480


IRIDOID DERIV (N.A.1) NSC373358

pdb file: 577491.pdb
sdf file: 577491.sdf
directory: 577491


ADRIAMYCIN DERIV Adriamycin derivative NSC376680

pdb file: 577726.pdb
sdf file: 577726.sdf
directory: 577726


JUNCUSOL DERIV (COMPOUND 1) NSC378135

pdb file: 577823.pdb
sdf file: 577823.sdf
directory: 577823


5,12-Naphthacenedione, 10-[[3-[(cyanomethyl)amino]-2,3,6-trideoxy-.alpha.-L-lyxo-hexopyranosyl]oxy]-7,8,9,10-tetrahydro-6,8,11-trihydroxy-8-(hydroxyacetyl)-1-methoxy-, (8S-cis)- Daunorubicin derivative NSC381425

pdb file: 578028.pdb
sdf file: 578028.sdf
directory: 578028


1,6-Naphthoquinone, 2-hydroxy-, silver deriv. 36417-25-1 NSC401106

pdb file: 578419.pdb
sdf file: 578419.sdf
directory: 578419


1331-84-6 Carvacrol, chloro- MCIT Monochloroisothymol NSC406498 Phenol, 2-methyl-5-(1-methylethyl)-, monochloro deriv.

pdb file: 579264.pdb
sdf file: 579264.sdf
directory: 579264


10163-13-0 NSC408168 Rutin, cadmium deriv.

pdb file: 579403.pdb
sdf file: 579403.sdf
directory: 579403


CHLORINE, TRIMETHYL ESTER, COPPER (II) DERIV NSC409903

pdb file: 579546.pdb
sdf file: 579546.sdf
directory: 579546


1013-59-8 2H-Pyrrol-2-one, 3-acetyl-1,5-dihydro-4-hydroxy-5-(1-methylpropyl)-, monosodium salt, [S-(R*,R*)]- 3-Acetyl-1,5-dihydro-4-hydroxy-5-(1-methylpropyl)-2H-pyrrol-2-one, sodium salt 3-Acetyl-5-sec-butyl-4-hydroxy-3-pyrolin-2-one, monosodium salt 3-Acetyl-5-sec-butyl-4-hydroxy-3-pyrrolin-2-one, sodium salt 3-Acetyltetramic acid, sodium salt 3-Pyrrolin-2-one, 3-acetyl-5-sec-butyl-4-hydroxy-, monosodium salt 3-Pyrrolin-2-one, 3-acetyl-L-5-sec-butyl-4-hydroxy-, sodium deriv. NSC525816 SK 25816 Sodium tenuazonate Tenuazonic acid sodium salt Tenuazonic acid, sodium salt WLN: T5MV EHJ CV1 DO EY2&1 &-NA-

pdb file: 580202.pdb
sdf file: 580202.sdf
directory: 580202


62345-81-7 AUREOLIC ACID, MAGNESIUM DERIV Aurelic acid magnesium deriv. Aureolic acid magnesium salt Aureolic acid, magnesium deriv. Mithramycin Mg salt Mithramycin magnesium salt NSC526598 SK 26598

pdb file: 580252.pdb
sdf file: 580252.sdf
directory: 580252


Hematoporphyrin derivative NSC603062 Photofrin II

pdb file: 580519.pdb
sdf file: 580519.sdf
directory: 580519


Daunorubicin Deriv. DR-34 NSC605335

pdb file: 580547.pdb
sdf file: 580547.sdf
directory: 580547


Daunorubicin Deriv. DR-35 NSC605336

pdb file: 580548.pdb
sdf file: 580548.sdf
directory: 580548


14,39-Dioxabicyclo[33.3.1]nonatriacontane, amphotericin B deriv. 36148-89-7 AIDS-000095 AIDS000095 AM AMB AME Amphotericin B monomethyl ester Amphotericin B, methyl ester

pdb file: 594800.pdb
sdf file: 594800.sdf
directory: 594800


24011-04-9 7-Methoxy-5,8-dihydroisoquinoline-5,8-dione AIDS-000106 AIDS000106 Isoquinolinedione derivative

pdb file: 594811.pdb
sdf file: 594811.sdf
directory: 594811


1-Cyano-7-methoxy-5,8-dihydroisoquinoline-5,8-dione 5,8-Dihydro-7-methoxy-5,8-dioxo-1-isoquinolinecarbonitrile AIDS-000107 AIDS000107 Isoquinolinedione derivative

pdb file: 594812.pdb
sdf file: 594812.sdf
directory: 594812


7-Methoxy-5,8-dihydroisoquinoline-5,8-dione 76177-29-2 AIDS-000108 AIDS000108 Isoquinolinedione derivative

pdb file: 594813.pdb
sdf file: 594813.sdf
directory: 594813


1-Cyano-7-methoxy-6-methyl-5,8-dihydroisoquinoline-5,8-dione 5,8-Dihydro-7-methoxy-6-methyl-5,8-dioxo-1-isoquinolinecarbonitrile 86433-72-9 AIDS-000109 AIDS000109 Isoquinolinedione derivative

pdb file: 594814.pdb
sdf file: 594814.sdf
directory: 594814


7-Methoxy-1,6-dimethyl-5,8-dihydroisoquinoline-5,8-dione 79664-58-7 AIDS-000110 AIDS000110 Isoquinolinedione derivative

pdb file: 594815.pdb
sdf file: 594815.sdf
directory: 594815


1-Cyano-7-ethoxy-5,8-dihydroisoquinoline-5,8-dione 113361-37-8 AIDS-000149 AIDS000149 Isoquinolinedione derivative

pdb file: 594853.pdb
sdf file: 594853.sdf
directory: 594853


113387-45-4 7-Butyloxy-1-cyano-5,8-dihydroisoquinoline-5,8-dione AIDS-000150 AIDS000150 Isoquinolinedione derivative

pdb file: 594854.pdb
sdf file: 594854.sdf
directory: 594854


113361-38-9 7-methoxy-6-methyl-2-((4-methylphenyl)sulfonyl)-1,2,3,4-tetrahydroisoquinoline-5,8-dione AIDS-000151 AIDS000151 Hexahydroquinolinedione deriv.

pdb file: 594855.pdb
sdf file: 594855.sdf
directory: 594855


1-5-Isoquinolinesulphonyl-2-methylpiperazine 108930-17-2 (DIHYDROCHLORIDE) 84477-87-2 AIDS-000181 AIDS000181 H-7 H7 Isoquinoline deriv. Piperazine, 1-(5-isoquinolinylsulfonyl)-2-methyl-

pdb file: 594885.pdb
sdf file: 594885.sdf
directory: 594885


117051-71-5 1H-Pyrrolo[2,3-f]quinoline-2,7,9-tricarboxylic acid, 4,5-dihydroxy-, ethyl dimethyl ester AIDS-000258 AIDS000258 Pyrroloquinoline tricarboxylic acid derivative

pdb file: 594941.pdb
sdf file: 594941.sdf
directory: 594941


102408-71-9 1H-Pyrrolo[2,3-f]quinoline-2,7,9-tricarboxylic acid, 4,5-dihydroxy-, trimethyl ester AIDS-000259 AIDS000259 Pyrroloquinoline tricarboxylic acid derivative

pdb file: 594942.pdb
sdf file: 594942.sdf
directory: 594942


116897-96-2 3,9-Dioxabicyclo[3.3.1]nonane, D-glycero-b-D-galacto-2-nonulopyranosidonic acid deriv. AIDS-000260 AIDS000260 Sialic acid 1,7-lactone derivative Sialic acid lactone b-Neuraminic acid, N-acetyl-2-O-methyl-, 1,7-lactone, 4,8,9-triacetate

pdb file: 594943.pdb
sdf file: 594943.sdf
directory: 594943


120126-88-7 AIDS-000291 AIDS000291 Benzo[a]naphthacene, D-alanine deriv. D-Alanine, N-[[5-[[4,6-dideoxy-4-(methylamino)-3-O-b-D-xylopyranosyl-b-D-galactopyranosyl]oxy]-5,6,8,13-tetrahydro-1,6,9,14-tetrahydroxy-13-imino-11-methoxy-3-methyl-8-oxobenz[a]naphthacen-2-yl]carbonyl]-, (5S-trans)- Pradimicin A, 13-imino-

pdb file: 594972.pdb
sdf file: 594972.sdf
directory: 594972


51572-92-0 (HCL) AIDS-000335 AIDS000335 O-(2-Nitrobenzyl)hydroxylamine Oxyamine deriv.

pdb file: 595011.pdb
sdf file: 595011.sdf
directory: 595011


117269-54-2 2,2'-[(4,6-pyrimidinediyl)bis(4,1-phenylenethio)]bis[N,N-dimethyl] ethanamine 4,6-Bis[4'-[[2''-(dimethylamino)ethyl]thio]phenyl]pyrimidine - unfused tricyclic pyrimidine derivative AIDS-000343 AIDS000343 Ethanamine, 2,2'-[4,6-pyrimidinediylbis(4,1-phenylenethio)]bis[N,N-dimethyl-

pdb file: 595019.pdb
sdf file: 595019.sdf
directory: 595019


121104-90-3 AIDS-000393 AIDS000393 Benzoic acid, 3-methyl-, octahydro-1,7,8-trihydroxy-6-indolizinyl ester, [1S-(1a,6b,7a,8b,8ab)]- Castanospermine, 6-O- deriv Castanospermine, 6-O-(3-methylbenzoyl)- MDL 29,435

pdb file: 595056.pdb
sdf file: 595056.sdf
directory: 595056


121104-87-8 AIDS-000402 AIDS000402 Benzoic acid, 4-methyl-, (1S,6S,7S,8R,8aR)-octahydro-1,7,8-trihydroxy-6-indolizinyl ester Castanospermine, 6-O- deriv Castanospermine, 6-O-(4-methylbenzoyl)- MDL 29,204 MDL 29204

pdb file: 595065.pdb
sdf file: 595065.sdf
directory: 595065


121104-83-4 AIDS-000403 AIDS000403 Benzoic acid, 4-bromo-, octahydro-1,7,8-trihydroxy-6-indolizinyl ester, [1S-(1a,6b,7a,8b,8ab)]- Castanospermine, 6-O- deriv Castanospermine, 6-O-(4-bromobenzoyl)- MDL 44,370 MDL 44370

pdb file: 595066.pdb
sdf file: 595066.sdf
directory: 595066


121104-88-9 7-O-deriv, Castanospermine AIDS-000404 AIDS000404 Benzoic acid, 4-methyl-, octahydro-1,6,8-trihydroxy-7-indolizinyl ester, [1S-(1.alpha., 6.beta., 7.alpha., 8.beta., 8a .beta.)]- Castanospermine, 7-O-(4-methylbenzoyl)- MDL 29,270 MDL 29270

pdb file: 595067.pdb
sdf file: 595067.sdf
directory: 595067


132915-95-8 AIDS-000439 AIDS000439 Benzo[a]naphthacene, D-alanine deriv. D-Alanine, N-[[5-[[4-(acetylamino)-4,6-dideoxy-3-O-b-D-xylopyranosyl-b-D-galactopyranosyl]oxy]-5,6,8,13-tetrahydro-1,6,9,14-tetrahydroxy-11-methoxy-3-methyl-8,13-dioxobenzo[a]naphthacen-2-yl]carbonyl]-, (5S-trans)- N-Acetylbenanomicin B

pdb file: 595084.pdb
sdf file: 595084.sdf
directory: 595084


135692-96-5 2H-Naphtho[1,8-bc]furan, bimol. deriv. AIDS-000458 AIDS000458 Gossylic lactone Gossypol deriv. Gossypol lactone [8,8'-Bi-2H-naphtho[1,8-bc]furan]-2,2'-dione, 3,3',4,4'-tetrahydroxy-7,7'-dimethyl-5,5'-bis(1-methylethyl)-

pdb file: 595103.pdb
sdf file: 595103.sdf
directory: 595103


120503-28-8 2-Furanmethanol, tetrahydro-5-[6-(1-piperidinyl)-9H-purin-9-yl]-, (2S-cis)- 6-N-Piperidinopurine-9-.beta.-D-2', 3'-dideoxyribofuranoside AIDS-000463 AIDS000463 Purine deriv.

pdb file: 595108.pdb
sdf file: 595108.sdf
directory: 595108


120503-31-3 6-Cyclopropylamino-9-.beta.-D-2', 3'-dideoxyribofuranoside AIDS-000464 AIDS000464 Adenosine, N-cyclopropyl-2',3'-dideoxy- Purine deriv.

pdb file: 595109.pdb
sdf file: 595109.sdf
directory: 595109


126333-28-6 5-(Ala-Ala) Val-Val-OMe deriv. 5-(L-Alanyl-L-alanylamino)-4-hydroxy-6-phenylhexanoic acid, methyl valyl-valyl amide AIDS-000504 AIDS000504 Ala-Ala-Phe.psi.[CH(OH)CH2]Gly-Val-Val-OCH3 Hydroxyethylene isostere analog(AA-II-VV-OMe) L-Valine, L-alanyl-L-alanyl-(.gamma.S, .delta.S)-.delta.-amino-.gamma.-hydroxybenzenehexanoyl-L-valyl-, methyl ester SKF 107457

pdb file: 595145.pdb
sdf file: 595145.sdf
directory: 595145


(+/-)-4,5,6,7-Tetrahydro-5-methyl-6-(3-methyl-2-butenyl)-imidazo-[4,5,1-jk][1,4]-benzodiazepin-2(1H)-one 126233-96-3 AIDS-000542 AIDS000542 R 79882 R79882 TIBO deriv.

pdb file: 595183.pdb
sdf file: 595183.sdf
directory: 595183


126347-69-1 9-Cl-TIBO AIDS-000544 AIDS000544 NSC637653 R 82913 R-82913 R82913 S-(+)-4,5,6,7-Tetrahydro-9-chloro-5-methyl-6-(3-methyl-2-butenyl)-imidazo[4,5,1-jk][1,4]-benzodiazepine-2(1H)-thione TIBO R82913 TIBO deriv.

pdb file: 595185.pdb
sdf file: 595185.sdf
directory: 595185


126333-36-6 AIDS-000570 AIDS000570 Boc-SAA-13-VV-OMe Boc-Ser-Ala-Ala-(4S)-4-amino-2,2-difluoro-3-oxo-5-phenylpentanoyl-Val-Val-O-methyl ester Difluorostatone analog(Boc-SAA-XIII-VV-OMe) Difluorostatone deriv. L-Valine, N-[N-[4-[[N-[N-[N-[(1,1-dimethylethoxy)carbonyl]-L-seryl]-L-alanyl]-L-alanyl]amino]-2,2-difluoro-1,3-dioxo-5-phenylpentyl]-L-valyl]-, methyl ester, (S)-

pdb file: 595209.pdb
sdf file: 595209.sdf
directory: 595209


51330-27-9 AIDS-000571 AIDS000571 Oleanane, b-D-glucopyranosiduronic acid deriv. SCM 3B Soyasaponin Bb Soyasaponin I Soybean saponin fraction B1 b-D-Glucopyranosiduronic acid, (3b,4b,22b)-22,23-dihydroxyolean-12-en-3-yl O-6-deoxy-.alpha.-L-mannopyranosyl-(1.2)-O-.beta.-D-galactopyranosyl-(1.2)-

pdb file: 595210.pdb
sdf file: 595210.sdf
directory: 595210


6-Mercaptopurine deriv. 6-Mercaptopurine derivatives(General Formula) 6MP AIDS-000605 AIDS000605

pdb file: 595241.pdb
sdf file: 595241.sdf
directory: 595241


123113-03-1 AIDS-000610 AIDS000610 Amphotericin B, sulfo deriv. SAB Sulfated amphotericin B

pdb file: 595246.pdb
sdf file: 595246.sdf
directory: 595246


(-)-Epigallocatechin gallate 989-51-5 AIDS-000674 AIDS000674 Benzoic acid, 3,4,5-trihydroxy-, (2R,3R)-3,4-dihydro-5,7-dihydroxy-2-(3,4,5-trihydroxyphenyl)-2H-1-benzopyran-3-yl ester Catechin deriv. EGCg

pdb file: 595282.pdb
sdf file: 595282.sdf
directory: 595282


123742-98-3 (DELETED) 2-Cyano-1-(4-chloro-benzoyl)-1,2-dihydroquinoline 2-Quinolinecarbonitrile, 1-(4-chlorobenzoyl)-1,2-dihydro- 94540-23-5 AIDS-000677 AIDS000677 Quinoline deriv. U-78036

pdb file: 595285.pdb
sdf file: 595285.sdf
directory: 595285


AIDS-000696 AIDS000696 Carbonodithioic acid, O-(octahydro-4,7-methano-1H-inden-5-yl) ester, potassium salt D609 Xanthate derivatives Tricyclodecan-9-yl xanthogenate & Mono-carbonic acid(C10-C14)

pdb file: 595303.pdb
sdf file: 595303.sdf
directory: 595303


127749-91-1 AIDS-000699 AIDS000699 Hydroxyethylamine deriv. L-Proline, 1-[(2R,3S)-3-[[(2S)-4-amino-1,4-dioxo-2-[[(phenylmethoxy)carbonyl]amino]butyl]amino]-2-hydroxy-4-phenylbutyl]-, 1,1-dimethylethyl ester Z-Asn-Phe-psi [CH(OH)CH2N]Pro-OtBu tert-Butyl (2S)-1-(3-{(2S)-3-carbamoyl-2-[(phenylmethoxy)carbonylamino]propanoylamino}(3S,2R)-2-hydroxy-4-phenylbutyl)pyrrolidine-2-carboxylate

pdb file: 595306.pdb
sdf file: 595306.sdf
directory: 595306


141018-21-5 AIDS-000720 AIDS000720 Cytidine, N-[[bis(1-methylethyl)amino]methylene]-2',3'-dideoxy- Fluorocytidine deriv. N4(diiPrAm)CH-3'FddC N4-[Diisopropylamino)methylene]-3'-fluoro-2',3'-dideoxycytidine

pdb file: 595327.pdb
sdf file: 595327.sdf
directory: 595327


64931-09-5 (COMBINATION) AIDS-000780 AIDS000780 Acetic acid, phosphono-, trisodium salt & Amphotericin B Foscarnet & Amphotericin B deriv. PFA & AME B deriv. PFA & Fungizone Phosphonoformate & Amphotericin B deriv.

pdb file: 595380.pdb
sdf file: 595380.sdf
directory: 595380


AIDS-000833 AIDS000833 CD4 76-94 deriv. LKIEDSDTYIC(bzl)EVEDQKEE LKIEDSDTYIEEVEDQKEE Leu-Lys-Ile-Glu-Asp-Ser-Asp-Thr-Tyr-Ile-Cys-Glu-Val-Glu-Asp-Gln-Lys-Glu-Glu (CD4 76-94 derivative)

pdb file: 595402.pdb
sdf file: 595402.sdf
directory: 595402


AIDS-000834 AIDS000834 CD4 83-94 deriv. CD4(83-94) S-benzylated S-benzyl-CD4(83-94) TYIC(bzl)EVEDQKEE Thr-Tyr-Ile-Cys-Glu-Val-Glu-Asp-Gln-Lys-Glu-Glu (CD4 83-94 derivative)

pdb file: 595403.pdb
sdf file: 595403.sdf
directory: 595403


174483-77-3 2-Pyridinesulfonamide, N-[3-[cyclopropyl[4-hydroxy-2-oxo-6-[1-(phenylmethyl)propyl]-2H-pyran-3-yl]methyl]phenyl]-, [R-(R*,R*)]- 3(Pyridine-SO2NHBz)-4OH-2Pyranone deriv. AIDS-000904 AIDS000904 N-(3-R)-[Cyclopropyl-[6-[1-(R)-ethylphenethyl)-4-hydroxy-2-oxo-2H-pyran-3-yl)methyl]phenyl)-2-pyridinesulfonamide

pdb file: 595463.pdb
sdf file: 595463.sdf
directory: 595463


10-Oxa-2,6,12-triazatetradecanoic acid, 4,8-dihydroxy-13,13-dimethyl-11-oxo-3,9-bis(phenylmethyl)-, 1,1-dimethylethyl ester, [3S-(3R*,4S*,8S*,9R*)]- 176496-59-6 AIDS-000947 AIDS000947 Aminodiol deriv. [1S-[1R*,2S*(2S*,3R*)]]-[3-[[3-[[[(1,1-Dimethylethyl)amino]carbonyl]oxy]-2-hydroxy-1-(phenylmethyl)-propyl]carbamic acid, 1,1-dimethylethyl ester

pdb file: 595505.pdb
sdf file: 595505.sdf
directory: 595505


2',3'-EpoxyA 2',3'-Epoxyadenosine 3,6-Dioxabicyclo[3.1.0]hexane, 9H-purin-6-amine deriv. 40110-98-3 9-(2,3-Anhydro-.beta.-D-lyxofuranosyl)adenine 9H-Purin-6-amine, 9-(2,3-anhydro-.beta.-D-lyxofuranosyl)- AIDS-000982 AIDS000982

pdb file: 595537.pdb
sdf file: 595537.sdf
directory: 595537


1,3-oxathiolane deriv. 1-(2-Hydroxymethyl-3-oxo-1,3-oxathiolan-5-yl)-cytosine 131086-23-2 160552-54-5 (2R,3R,5S) 160552-55-6 (2R,3S,5S) 2(1H)-Pyrimidinone, 4-amino-1-[2-(hydroxymethyl)-3-oxido-1,3-oxathiolan-5-yl]-, (2a,5a)- AIDS-001151 AIDS001151

pdb file: 595701.pdb
sdf file: 595701.sdf
directory: 595701


AIDS-001168 AIDS001168 CD4 76-93 deriv. LKIEDSDTYIC(bzl)EVEDQKE LKIEDSDTYICEVEDQKE Leu-Lys-Ile-Glu-Asp-Ser-Asp-Thr-Tyr-Ile-Cys-Glu-Val-Glu-Asp-Gln-Lys-Glu (CD4 76-93 derivative)

pdb file: 595718.pdb
sdf file: 595718.sdf
directory: 595718


4-Thiazolecarboxamide, 2-[5-(hydroxymethyl)-2-furanyl]- 60084-14-2 AIDS-001178 AIDS001178 NSC347464 Tiazofurin deriv.

pdb file: 595724.pdb
sdf file: 595724.sdf
directory: 595724


1-[2,5-Bis-O-(t-butyldimethylsilyl)-3-C-cyano-3-deoxy-B-D-xylopentofuranosyl]uracil 121055-64-9 2,4(1H,3H)-Pyrimidinedione, 1-[3-cyano-3-deoxy-2,5-bis-O-[(1,1-dimethylethyl)dimethylsilyl]-.beta.-D-xylofuranosyl]- AIDS-001179 AIDS001179 Uracil deriv.

pdb file: 595725.pdb
sdf file: 595725.sdf
directory: 595725


121055-65-0 AIDS-001180 AIDS001180 Acetamide, N-[1-[3-cyano-3-deoxy-2,5-bis-O-[(1,1-dimethylethyl)dimethylsilyl]-.beta.-D-xylofuranosyl]-1,2-dihydro-2-oxo-4-pyrimidinyl]- Cytosine deriv. N4-Acetyl-1-[2,5-bis-O-(t-butyldimethylsilyl)-3-C-cyano-3-deoxy-.beta.-D-xylopentofuranosyl]cytosine

pdb file: 595726.pdb
sdf file: 595726.sdf
directory: 595726


121055-66-1 2,4(1H,3H)-Pyrimidinedione, 1-[3-cyano-3-deoxy-2,5-bis-O-[(1,1-dimethylethyl)dimethylsilyl]-.beta.-D-xylofuranosyl]- 9-[2,5-Bis-O-(t-butyldimethylsilyl)-3-C-cyano-3-deoxy-.beta.-D-xylopentofuranosyl]adenine AIDS-001181 AIDS001181 Adenine deriv.

pdb file: 595727.pdb
sdf file: 595727.sdf
directory: 595727


1-(3-C-Cyano-3-deoxy-B-D-xylo-pentofuranosyl)thymine 117174-35-3 2,4(1H,3H)-Pyrimidinedione, 1-(3-cyano-3-deoxy-b-D-xylofuranosyl)-5-methyl-1-(3-C-Cyano-3-deoxy-B-D-xylo-pentofuranosyl)thymine AIDS-001185 AIDS001185 Thymine deriv.

pdb file: 595731.pdb
sdf file: 595731.sdf
directory: 595731


1-(3-C-Cyano-3-deoxy-B-D-xylo-pentofuranosyl)uracil 121123-89-5 2,4(1H,3H)-Pyrimidinedione, 1-(3-cyano-3-deoxy-b-D-xylofuranosyl)- AIDS-001186 AIDS001186 Uracil deriv.

pdb file: 595732.pdb
sdf file: 595732.sdf
directory: 595732


121153-18-2 9-(3-C-cyano-3-deoxy-.beta.-D-xylopentofuranosyl)adenine 9H-Purin-6-amine, 9-(3-cyano-3-deoxy-.beta.-D-xylofuranosyl)- AIDS-001187 AIDS001187 Adenine deriv.

pdb file: 595733.pdb
sdf file: 595733.sdf
directory: 595733


1-[(2-Hydroxyethoxy)methyl]-6-(phenylthio)thymine-triphosphate 125400-24-0 AIDS-001210 AIDS001210 HEPT deriv. HEPT-TP Triphosphoric acid, P-[2-[[3,4-dihydro-5-methyl-2,4-dioxo-6-(phenylthio)-1(2H)-pyrimidinyl]methoxy]ethyl] ester

pdb file: 595756.pdb
sdf file: 595756.sdf
directory: 595756


174483-83-1 3(Imid-SO2NHBz)-4OH-2Pyranone deriv. AIDS-001220 AIDS001220 N-(3-[Cyclopropyl[4-hydroxy-2-oxo-6-[1(R)-phenylmethyl)propyl]-2H-pyran-3-yl)methyl]phenyl)-1H-imidazole-2-sulfonamide

pdb file: 595766.pdb
sdf file: 595766.sdf
directory: 595766


AIDS-001221 AIDS001221 CD4 77-94 deriv. KIEDSDTYIC(bzl)EVEDQKEE KIEDSDTYICEVEDQKEE Lys-Ile-Glu-Asp-Ser-Asp-Thr-Tyr-Ile-Cys-Glu-Val-Glu-Asp-Gln-Lys-Glu-Glu (CD4 77-94 derivative)

pdb file: 595767.pdb
sdf file: 595767.sdf
directory: 595767


AIDS-001508 AIDS001508 CD4 81-94 deriv. SDTYIC(bzl)EVEDQKEE Ser-Asp-Thr-Tyr-Ile-Cys(bzl)-Glu-Val-Glu-Asp-Gln-Lys-Glu-Glu (CD4 79-94 derivative)

pdb file: 596022.pdb
sdf file: 596022.sdf
directory: 596022


107021-11-4 197640-86-1 (1S-[1R*,3R*,5Z,7S*,8E,11S*,13E,15R*,17S*(R*),21S*,23S*,25R*]) AIDS-001550 AIDS001550 Bryostatin 13 Butanoic acid, (1S,3S,5Z,7R,8E,11R,13E,15S,17R,21R,23R,25S)-1,11,21-trihydroxy-17-[(1R)-1-hydroxyethyl]-5,13-bis(2-methoxy-2-oxoethylidene)-10,10,26,26-tetramethyl-19-oxo-18,27,28,29-tetraoxatetracyclo[21.3.1.13,7.111,15]nonacos-8-en-25-yl ester Butanoic acid, 1,11,21-trihydroxy-17-(1-hydroxyethyl)-5,13-bis(2-methoxy-2-oxoethylidene)-10,10,26,26-tetramethyl-19-oxo-18,27,28,29-tetraoxatetracyclo[21.3.1.13,7.111,15]nonacos-8-en-25-yl ester, [1S-[1R*,3R*,5Z,7S*,8E,11S*,13E,15R*,17S*(R*),21S*,23S*,25R*]]- bryostatin 1 deriv.

pdb file: 596057.pdb
sdf file: 596057.sdf
directory: 596057


3-Aza-A-homoandrost-4a-en-4-one, 17-[4-[4-[bis(2-chloroethyl)amino]phenyl]-1-oxobutoxy]-, (17b)- 99876-94-5 AIDS-001697 AIDS001697 Cyclopenta[5,6]naphth[1,2-d]azepine, 3-aza-A-homoandrost-4a-en-4-one deriv. DAL 16 NSC622556

pdb file: 596201.pdb
sdf file: 596201.sdf
directory: 596201


126830-78-2 2[((N,N-Diethylamino)thiocarbonylthio)acetamido]-4,5,6,7-tetrahydro-1,3-benzothiazole AIDS-001700 AIDS001700 Carbamodithioic acid, diethyl-, 2-oxo-2-[(4,5,6,7-tetrahydro-2-benzothiazolyl)amino]ethyl ester NSC650842 Tetrahydrobenzothiazole deriv.

pdb file: 596204.pdb
sdf file: 596204.sdf
directory: 596204


1-Pyrrolidinecarbodithioic acid, 2-oxo-2-[(4,5,6,7-tetrahydro-2-benzothiazolyl)amino]ethyl ester 126830-79-3 2[(Pyrrolidinothiocarbonylthio)acetamido]-4,5,6,7-tetrahydro-1,3-benzothiazole AIDS-001701 AIDS001701 Tetrahydrobenzothiazole deriv.

pdb file: 596205.pdb
sdf file: 596205.sdf
directory: 596205


1-Piperidinecarbodithioic acid, 2-oxo-2-[(4,5,6,7-tetrahydro-2-benzothiazolyl)amino]ethyl ester 126830-80-6 2[(Piperidinothiocarbonylthio)acetamido]-4,5,6,7-tetrahydro-1,3-benzothiazole AIDS-001702 AIDS001702 NSC650843 Tetrahydrobenzothiazole deriv.

pdb file: 596206.pdb
sdf file: 596206.sdf
directory: 596206


126830-81-7 2-[(Morpholinothiocarbonylthio)acetamido]-4,5,6,7-tetrahydro-1,3-benzothiazole 4-Morpholinecarbodithioic acid, 2-oxo-2-[(4,5,6,7-tetrahydro-2-benzothiazolyl)amino]ethyl ester AIDS-001703 AIDS001703 NSC650844 Tetrahydrobenzothiazole deriv.

pdb file: 596207.pdb
sdf file: 596207.sdf
directory: 596207


1,4-Bis [N-(4,5,6,7-Tetrahydrobenzothiazol-2-yl)acetamido)thio thiocarbonyl]piperazine 1,4-Piperazinedicarbodithioic acid, bis[2-oxo-2-[(4,5,6,7-tetrahydro-2-benzothiazolyl)amino]ethyl] ester 126830-82-8 AIDS-001704 AIDS001704 Tetrahydrobenzothiazole deriv.

pdb file: 596208.pdb
sdf file: 596208.sdf
directory: 596208


.alpha.-Rubromycin 1H-2-Benzopyran-3-carboxylic acid, 6-[2-(4,9-dihydro-8-hydroxy-5,7-dimethoxy-4,9-dioxonaphtho[2,3-b]furan-2-yl)ethyl]-7,8-dihydroxy-1-oxo-, methyl ester 27267-69-2 6-[2-(4,9-Dihydro-8-hydroxy-5,7-dimethoxy-4,9-dioxonaphtho[2,3-b]furan-2-yl) AIDS-001776 AIDS001776 Collinomycin Naphtho[2,3-b]furan, 1H-2-benzopyran-3-carboxylic acid deriv.

pdb file: 596279.pdb
sdf file: 596279.sdf
directory: 596279


174483-32-0 (MIXTURE) 174484-53-8 ([R-[R*,R*]]) 174484-54-9 (S-[R*,R*]) 174590-30-8 (S-[R*,S*]) 174590-31-9 (R-[R*,S*]) 1H-Imidazole-4-sulfonamide, N-[3-[1-[5,6-dihydro-4-hydroxy-2-oxo-6-(2-phenylethyl)-6-propyl-2H-pyran-3-yl]propyl]phenyl]-1-methyl- 4-Hydroxy-5,6-dihydropyranone deriv. AIDS-001796 AIDS001796 N-[3-[1-(4-Hydroxy-2-oxo-6-phenylethyl-6-propyl-5,6-dihydro-2H-pyran-3-yl)-propyl]-phenyl]-1-methyl-1H-imidazole-4-sulfonamide

pdb file: 596299.pdb
sdf file: 596299.sdf
directory: 596299


(3R,4R)-N,N'-(t-Butyloxycarbonyl)-2,5-diamino-3,4-dihydroxy-1,6-diphenylhexane 1,6-Diphenylhexane deriv. 129491-63-0 AIDS-001832 AIDS001832 L-Iditol, 1,2,5,6-tetradeoxy-2,5-bis[[(1,1-dimethylethoxy)carbonyl]amino]-1,6-diphenyl-

pdb file: 596335.pdb
sdf file: 596335.sdf
directory: 596335


(3S,4S)-N,N'-(t-Butyloxycarbonyl)-2,5-diamino-3,4-dihydroxy-1,6-diphenylhexane 1,6-Diphenylhexane deriv. 129491-64-1 AIDS-001833 AIDS001833 L-Mannitol, 1,2,5,6-tetradeoxy-2,5-bis[[(1,1-dimethylethoxy)carbonyl]amino]-1,6-diphenyl-

pdb file: 596336.pdb
sdf file: 596336.sdf
directory: 596336


1,6-Diphenylhexane deriv. 129491-65-2 A-76215 AIDS-001834 AIDS001834 L-Altritol, 1,2,5,6-tetradeoxy-2,5-bis[[(1,1-dimethylethoxy)carbonyl]amino]-1,6-diphenyl- N,N'-(t-Butyloxycarbonyl)-2,5-diamino-3,4-dihydroxy-1,6-diphenylhexane-, (2S,3R,4S,5S)

pdb file: 596337.pdb
sdf file: 596337.sdf
directory: 596337


4-Thienyl-2-SEtNMe2-Pyrimidine 83726-78-7 83726-79-8 (HYDROGEN BROMIDE) AIDS-001923 AIDS001923 Ethanamine, N,N-dimethyl-2-[[4-(2-thienyl)-2-pyrimidinyl]thio]- N,N-dimethyl-2-[[4-(2-thienyl)pyrimidine-4'-yl]thio]ethylamine - unfused bicyclic pyrimidine derivative

pdb file: 596423.pdb
sdf file: 596423.sdf
directory: 596423


4-Thiazol-2-SEtNMe2-Pyrimidine 83726-82-3 AIDS-001924 AIDS001924 Ethanamine, N,N-dimethyl-2-[[4-(2-thiazolyl)-2-pyrimidinyl]thio]- N,N-Dimethyl-2-[[4'-(thiazol-2''-yl)pyrimidin-2'-yl]thio]ethylamine - unfused bicyclic pyrimidine derivative

pdb file: 596424.pdb
sdf file: 596424.sdf
directory: 596424


1,2-Ethanediamine, N,N-dimethyl-N'-[4-(2-thiazolyl)-2-pyrimidinyl]- 4-Thiazol-2-NHEtNMe2-Pyrimidine 83726-81-2 AIDS-001925 AIDS001925 N-(2''-Dimethylaminoethyl)-4-(thiazol-2'-yl)pyrimidin-2-amine - unfused bicyclic pyrimidine derivative

pdb file: 596425.pdb
sdf file: 596425.sdf
directory: 596425


113669-49-1 113669-50-4 (HYDROGEN BROMIDE) 4-MePyrrol-2-SEtNMe2-Pyrimidine AIDS-001926 AIDS001926 Ethanamine, N,N-dimethyl-2-[[4-(1-methyl-1H-pyrrol-2-yl)-2-pyrimidinyl]thio]- N,N-Dimethyl-2-[[4'-(1''-methylpyrrol-2''-yl)pyrimidin-2'-yl]thio]ethylamine - unfused bicyclic pyrimidine derivative

pdb file: 596426.pdb
sdf file: 596426.sdf
directory: 596426


129224-78-8 131435-43-3 (DIHYDROGEN BROMIDE) 2-(3-SEtNMe2Ph)-4-SEtNMe2-Pyrimidine AIDS-001927 AIDS001927 Ethanamine, 2-[[4-[3-[[2-(dimethylamino)ethyl]thio]phenyl]-2-pyrimidinyl]thio]-N,N-dimethyl- N,N-Dimethyl-2-[[4-[3-[[2-(dimethylamino)ethyl]thio]phenyl]-2-pyrimidinyl]thio]ethanamine - unfused bicyclic pyrimidine derivative

pdb file: 596427.pdb
sdf file: 596427.sdf
directory: 596427


129224-97-1 2-[[2-(4-Methyl-1-piperazinyl)ethyl]thio]-4-(2-thienyl)-pyrimidine - unfusedbicyclic pyrimidine derivative 4-Thienyl-2-SEt(4-MePiperazine)Pyrimidine AIDS-001928 AIDS001928 Pyrimidine, 2-[[2-(4-methyl-1-piperazinyl)ethyl]thio]-4-(2-thienyl)-

pdb file: 596428.pdb
sdf file: 596428.sdf
directory: 596428


129242-20-2 4-Benzo[b]thien-2-yl-5-methyl-2-[[2-(4-methyl-1-piperazinyl)ethyl]thio]pyrimidine - unfused bicyclic pyrimidine derivative 4-Benzothienyl-5Me-2SEt(4MePiperazine)Pyr AIDS-001929 AIDS001929 NSC619012 Pyrimidine, 4-benzo[b]thien-2-yl-5-methyl-2-[[2-(4-methyl-1-piperazinyl)ethyl]thio]-

pdb file: 596429.pdb
sdf file: 596429.sdf
directory: 596429


124959-55-3 4,6-Dithienyl-2(4-Morpholino)Pyr 4-[4,6-Bis(2-thienyl)-pyrimidin-2-yl]morpholine - unfused tricyclic pyrimidine derivative AIDS-001940 AIDS001940 Morpholine, 4-(4,6-di-2-thienyl-2-pyrimidinyl)-

pdb file: 596440.pdb
sdf file: 596440.sdf
directory: 596440


124959-56-4 4,6-Dithienyl-2-NHEtOH-Pyr AIDS-001941 AIDS001941 Ethanol, 2-[(4,6-di-2-thienyl-2-pyrimidinyl)amino]- N-[4,6-Bis(2-thienyl)pyrimidin-2-yl]ethanolamine - unfused tricyclicpyrimidine derivative

pdb file: 596441.pdb
sdf file: 596441.sdf
directory: 596441


1,3-Propanediamine, N-(3-aminopropyl)-N'-(4,6-di-2-thienyl-2-pyrimidinyl)-N-methyl- 124959-58-6 4,6-Dithienyl-2-NHPrN(Me)PrNH2-Pyr AIDS-001942 AIDS001942 N-(3-aminopropyl)-N'-(4,6-di-2-thienyl-2-pyrimidinyl)-N-methyl-1,3-propanediamine - unfused tricyclic pyrimidine derivative

pdb file: 596442.pdb
sdf file: 596442.sdf
directory: 596442


124959-59-7 (MONOHYDROBROMIDE) 129224-85-7 4Thienyl-6(1-MePyrrol)-2SEtNMe2-Pyr AIDS-001943 AIDS001943 Ethanamine, N,N-dimethyl-2-[[4-(1-methyl-1H-pyrrol-2-yl)-6-(2-thienyl)-2-pyrimidinyl]thio]- N,N-Dimethyl-2-[[4-(2-thienyl)-6-(1-methylpyrrol-2-yl)pyrimidin-2-yl]thio]ethanamine - unfused tricyclic pyrimidine derivative

pdb file: 596443.pdb
sdf file: 596443.sdf
directory: 596443


133201-13-5 5'-[O-Ethyl-N-(methoxycarbonylethyl)phosphoramidate)-3'-azido-3'-deoxythymidine AIDS-002028 AIDS002028 AZT deriv. L-Alanine, N-(3'-azido-3'-deoxy-P-ethyl-5'-thymidylyl)-, methyl ester, (R)-

pdb file: 596528.pdb
sdf file: 596528.sdf
directory: 596528


1-(4-Azido-2-deoxy-.beta.-D-erythro-pentofuranosyl)-5-methyl-2,4-dioxopyrimidine 130108-72-4 AIDS-002115 AIDS002115 AZT deriv. Thymidine, 4'-azido-

pdb file: 596604.pdb
sdf file: 596604.sdf
directory: 596604


130108-94-0 (TETRASODIUM SALT) 140158-13-0 4'-Azidothymidine 5'-triphosphate4'-Azidothymidine 5'-triphosphate 4'-AzidothymidineTP deriv. AIDS-002116 AIDS002116 Thymidine 5'-(tetrahydrogen triphosphate), 4'-azido-Thymidine 5'-(tetrahydrogen triphosphate), 4'-azido-Thymidine 5'-(tetrahydrogen triphosphate), 4'-azido-

pdb file: 596605.pdb
sdf file: 596605.sdf
directory: 596605


1-[(2-Hydroxyethoxy)methyl]-6-(3-methylphenyl)thio)thymine 125056-58-8 2,4(1H,3H)-Pyrimidinedione, 1-[(2-hydroxyethoxy)methyl]-5-methyl-6-[(3-methylphenyl)thio]- 3'-MeHEPT AIDS-002172 AIDS002172 HEPT deriv. HEPT-M

pdb file: 596660.pdb
sdf file: 596660.sdf
directory: 596660


125056-74-8 2,4(1H,3H)-Pyrimidinedione, 6-(cyclohexylthio)-1-[(2-hydroxyethoxy)methyl]-5-methyl- 6-Cyclohexylthio-1-[(2-hydroxyethoxy)methyl]thymine AIDS-002173 AIDS002173 HEPT deriv. HEPT-H

pdb file: 596661.pdb
sdf file: 596661.sdf
directory: 596661


1-[(2-Hydroxyethoxy)methyl]-6-(phenylthio)-2-thiothymine 125057-07-0 4(1H)-Pyrimidinone, 2,3-dihydro-1-[(2-hydroxyethoxy)methyl]-5-methyl-6-(phenylthio)-2-thioxo- AIDS-002174 AIDS002174 HEPT deriv. HEPT-S

pdb file: 596662.pdb
sdf file: 596662.sdf
directory: 596662


126234-02-4 6-Cyanomethyl-4,5,6,7-tetrahydro-5-methylimidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one AIDS-002413 AIDS002413 Imidazo[4,5,1-jk][1,4]benzodiazepine-6(7H)-acetonitrile, 1,2,4,5-tetrahydro-5-methyl-2-oxo- TIBO deriv.

pdb file: 596897.pdb
sdf file: 596897.sdf
directory: 596897


131613-16-6 6-(2-Methyl-2-propenyl)-4,5,6,7-tetrahydro-5-methylimidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one AIDS-002414 AIDS002414 Imidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one, 4,5,6,7-tetrahydro-5-methyl-6-(2-methyl-2-propenyl)-, (1)- TIBO deriv.

pdb file: 596898.pdb
sdf file: 596898.sdf
directory: 596898


132933-14-3 190775-77-0 (S) 6-(2-Oxo-propyl)-4,5,6,7-tetrahydro-5-methylimidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one AIDS-002415 AIDS002415 Imidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one, 4,5,6,7-tetrahydro-5-methyl-6-(2-oxopropyl)- TIBO deriv.

pdb file: 596899.pdb
sdf file: 596899.sdf
directory: 596899


126234-03-5 6-Acetyl-4,5,6,7-tetrahydro-5-methylimidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one AIDS-002418 AIDS002418 Imidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one, 6-acetyl-4,5,6,7-tetrahydro-5-methyl- TIBO deriv.

pdb file: 596902.pdb
sdf file: 596902.sdf
directory: 596902


131514-86-8 190775-83-8 (S) 6-(2-Furanylmethyl)-4,5,6,7-tetrahydro-5-methylimidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one AIDS-002419 AIDS002419 Imidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one, 6-(2-furanylmethyl)-4,5,6,7-tetrahydro-5-methyl-, (1)- TIBO deriv.

pdb file: 596903.pdb
sdf file: 596903.sdf
directory: 596903


132933-15-4 6-(2-Ethoxycarbonyl-propen-3-yl)-4,5,6,7-tetrahydro-5-methylimidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one AIDS-002420 AIDS002420 Imidazo[4,5,1-jk][1,4]benzodiazepine-6(7H)-propanoic acid, 1,2,4,5-tetrahydro-5-methyl-.alpha.-methylene-2-oxo-, ethyl ester TIBO deriv.

pdb file: 596904.pdb
sdf file: 596904.sdf
directory: 596904


131514-88-0 2-Butenoic acid, 4-(1,2,4,5-tetrahydro-5-methyl-2-oxoimidazo[4,5,1-jk][1,4]benzodiazepin-6(7H)-yl)-, methyl ester, (E)-(1)- 4,5,6,7-Tetrahydro-5-methylimidazo[4,5,1-jk][1,4]benzodiazepin-2-oxo-6-trans-2-butenoic acid methyl ester AIDS-002421 AIDS002421 TIBO deriv.

pdb file: 596905.pdb
sdf file: 596905.sdf
directory: 596905


126233-79-2 126233-81-6 (R) AIDS-002422 AIDS002422 Imidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one, 4,5,6,7-tetrahydro-5-methyl-, (R)- R(-)-4,5,6,7-Tetrahydro-5-methylimidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one TIBO deriv.

pdb file: 596906.pdb
sdf file: 596906.sdf
directory: 596906


126233-80-5 (S) AIDS-002423 AIDS002423 Imidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one, 4,5,6,7-tetrahydro-5-methyl-, (S)- S(+)-4,5,6,7-Tetrahydro-5-methylimidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one TIBO deriv.

pdb file: 596907.pdb
sdf file: 596907.sdf
directory: 596907


126233-95-2 190775-91-8 (S) 6-(4-Butenyl)-4,5,6,7-tetrahydro-5-methylimidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one AIDS-002424 AIDS002424 Imidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one, 6-(3-butenyl)-4,5,6,7-tetrahydro-5-methyl- TIBO deriv.

pdb file: 596908.pdb
sdf file: 596908.sdf
directory: 596908


(+-)-6-Propyl-4,5,6,7-tetrahydro-5-methylimidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one 131514-90-4 190776-36-4 (S) AIDS-002425 AIDS002425 Imidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one, 4,5,6,7-tetrahydro-5-methyl-6-propyl-, (1)- TIBO deriv.

pdb file: 596909.pdb
sdf file: 596909.sdf
directory: 596909


126233-84-9 6-Ethyl-4,5,6,7-tetrahydro-5-methylimidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one AIDS-002426 AIDS002426 Imidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one, 6-ethyl-4,5,6,7-tetrahydro-5-methyl- TIBO deriv.

pdb file: 596910.pdb
sdf file: 596910.sdf
directory: 596910


126233-94-1 AIDS-002427 AIDS002427 Imidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one, 4,5,6,7-tetrahydro-5-methyl-6-(2-methyl-2-propenyl)-, (S)- R78819 S-(+)-6-(2-Methyl-3-propenyl)-4,5,6,7-tetrahydro-5-methylimidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one TIBO deriv.

pdb file: 596911.pdb
sdf file: 596911.sdf
directory: 596911


126234-01-3 136779-92-5 (S) 6-(Cyclopropylmethyl)-4,5,6,7-tetrahydro-5-methylimidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one AIDS-002428 AIDS002428 Imidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one, 6-(cyclopropylmethyl)-4,5,6,7-tetrahydro-5-methyl- TIBO deriv.

pdb file: 596912.pdb
sdf file: 596912.sdf
directory: 596912


131514-93-7 6-(1H-Pyrrol-2-yl-methyl)-4,5,6,7-tetrahydro-5-methylimidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one AIDS-002429 AIDS002429 Imidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one, 4,5,6,7-tetrahydro-5-methyl-6-(1H-pyrrol-2-ylmethyl)-, (1)- TIBO deriv.

pdb file: 596913.pdb
sdf file: 596913.sdf
directory: 596913


126233-86-1 6-(2-Propyl)-4,5,6,7-tetrahydro-5-methylimidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one AIDS-002430 AIDS002430 Imidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one, 4,5,6,7-tetrahydro-5-methyl-6-(1-methylethyl)- TIBO deriv.

pdb file: 596914.pdb
sdf file: 596914.sdf
directory: 596914


126234-04-6 6-(2-Hydroxyethyl)-4,5,6,7-tetrahydro-5-methylimidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one AIDS-002431 AIDS002431 Imidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one, 4,5,6,7-tetrahydro-6-(2-hydroxyethyl)-5-methyl- TIBO deriv.

pdb file: 596915.pdb
sdf file: 596915.sdf
directory: 596915


131514-96-0 6-(1H-Imidazol-2-yl-methyl)-4,5,6,7-tetrahydro-5-methylimidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one AIDS-002432 AIDS002432 Imidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one, 4,5,6,7-tetrahydro-6-(1H-imidazol-2-ylmethyl)-5-methyl- TIBO deriv.

pdb file: 596916.pdb
sdf file: 596916.sdf
directory: 596916


126233-97-4 (E) 126233-98-5 ((Z)-) 190776-37-5 ((S-[E])-) 190778-12-2 (S-[Z]-) 6-(E-2-Buten-1-yl)-4,5,6,7-tetrahydro-5-methylimidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one AIDS-002433 AIDS002433 Imidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one, 6-(2-butenyl)-4,5,6,7-tetrahydro-5-methyl-, (E)- TIBO deriv.

pdb file: 596917.pdb
sdf file: 596917.sdf
directory: 596917


126233-97-4 (E) 126233-98-5 (Z) 190776-37-5 (S-(E)) 190778-12-2 (S-(Z)) 6-(Z-2-Buten-1-yl)-4,5,6,7-tetrahydro-5-methylimidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one AIDS-002434 AIDS002434 Imidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one, 6-(2-butenyl)-4,5,6,7-tetrahydro-5-methyl-, (Z)- TIBO deriv.

pdb file: 596918.pdb
sdf file: 596918.sdf
directory: 596918


126262-72-4 6-(2-Methylpropyl)-4,5,6,7-tetrahydro-5-methylimidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one AIDS-002435 AIDS002435 Imidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one, 4,5,6,7-tetrahydro-5-methyl-6-(2-methylpropyl)- TIBO deriv.

pdb file: 596919.pdb
sdf file: 596919.sdf
directory: 596919


126233-87-2 190778-86-0 ((S)-) 6-Butyl-4,5,6,7-tetrahydro-5-methylimidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one AIDS-002436 AIDS002436 Imidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one, 6-butyl-4,5,6,7-tetrahydro-5-methyl- TIBO deriv.

pdb file: 596920.pdb
sdf file: 596920.sdf
directory: 596920


131515-01-0 AIDS-002437 AIDS002437 Imidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one, 6-(3,7-dimethyl-2,6-octadienyl)-4,5,6,7-tetrahydro-5-methyl-, (E)-(1)- TIBO derivative

pdb file: 596921.pdb
sdf file: 596921.sdf
directory: 596921


131515-03-2 6-(2,4-Hexadien-1-yl)-4,5,6,7-tetrahydro-5-methylimidazo-[4,5,1-jk][1,4]-benzodiazepin-2(1H)-one AIDS-002439 AIDS002439 Imidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one, 6-(2,4-hexadienyl)-4,5,6,7-tetrahydro-5-methyl-, (E,E)- TIBO deriv.

pdb file: 596923.pdb
sdf file: 596923.sdf
directory: 596923


141114-20-7 6-(2-Bromopropen-3-yl)-4,5,6,7-tetrahydro-5-methylimidazo-[4,5,1-jk][1,4]-benzodiazepin-2(1H)-one AIDS-002440 AIDS002440 Imidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one, 6-(2-bromo-2-propenyl)-4,5,6,7-tetrahydro-5-methyl- TIBO deriv.

pdb file: 596924.pdb
sdf file: 596924.sdf
directory: 596924


131613-18-8 ((R)-) AIDS-002443 AIDS002443 Imidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one, 4,5,6,7-tetrahydro-5-methyl-6-(3-methyl-2-butenyl)-, (R)- R-(-)-6-(2-Methyl-2-butene-4-yl)-4,5,6,7-tetrahydro-5-methylimidazo-[4,5,1-jk][1,4]-benzodiazepin-2(1H)-one TIBO deriv.

pdb file: 596927.pdb
sdf file: 596927.sdf
directory: 596927


131515-06-5 6-(2-Benzylpropen-3-yl)-4,5,6,7-tetrahydro-5-methylimidazo-[4,5,1-jk][1,4]-benzodiazepin-2(1H)-one AIDS-002444 AIDS002444 Imidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one, 4,5,6,7-tetrahydro-5-methyl-6-[2-(phenylmethyl)-2-propenyl]-, (1)- TIBO deriv.

pdb file: 596928.pdb
sdf file: 596928.sdf
directory: 596928


131515-07-6 6-(2,3-Dimethyl-2-buten-1-yl)-4,5,6,7-tetrahydro-5-methylimidazo-[4,5,1-jk][1,4]-benzodiazepin-2(1H)-one AIDS-002445 AIDS002445 Imidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one, 6-(2,3-dimethyl-2-butenyl)-4,5,6,7-tetrahydro-5-methyl-, (1)- TIBO deriv.

pdb file: 596929.pdb
sdf file: 596929.sdf
directory: 596929


131515-08-7 6-(E-3-Phenyl-2-propen-1-yl)-4,5,6,7-tetrahydro-5-methylimidazo-[4,5,1-jk][1,4]-benzodiazepin-2(1H)-one AIDS-002446 AIDS002446 Imidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one, 4,5,6,7-tetrahydro-5-methyl-6-(3-phenyl-2-propenyl)-, (E)-(1)- TIBO deriv.

pdb file: 596930.pdb
sdf file: 596930.sdf
directory: 596930


131515-09-8 6-(2-Methylenebutyl)-4,5,6,7-tetrahydro-5-methylimidazo-[4,5,1-jk][1,4]-benzodiazepin-2(1H)-one AIDS-002447 AIDS002447 Imidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one, 4,5,6,7-tetrahydro-5-methyl-6-(2-methylenebutyl)-, (1)- TIBO deriv.

pdb file: 596931.pdb
sdf file: 596931.sdf
directory: 596931


131515-11-2 6-(3-Methyl-2-methylene-butyl)-4,5,6,7-tetrahydro-5-methylimidazo-[4,5,1-jk][1,4]-benzodiazepin-2(1H)-one AIDS-002449 AIDS002449 Imidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one, 4,5,6,7-tetrahydro-5-methyl-6-(3-methyl-2-methylenebutyl)-, (1)- TIBO deriv.

pdb file: 596933.pdb
sdf file: 596933.sdf
directory: 596933


131515-12-3 6-(2-Phenylpropen-3-yl)-4,5,6,7-tetrahydro-5-methylimidazo-[4,5,1-jk][1,4]-benzodiazepin-2(1H)-one AIDS-002450 AIDS002450 Imidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one, 4,5,6,7-tetrahydro-5-methyl-6-(2-phenyl-2-propenyl)-, (1)- TIBO deriv.

pdb file: 596934.pdb
sdf file: 596934.sdf
directory: 596934


131515-13-4 6-(1-Cyclohexenylmethyl)-4,5,6,7-tetrahydro-5-methylimidazo-[4,5,1-jk][1,4]-benzodiazepin-2(1H)-one AIDS-002451 AIDS002451 Imidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one, 6-(1-cyclohexen-1-ylmethyl)-4,5,6,7-tetrahydro-5-methyl-, (1)- TIBO deriv.

pdb file: 596935.pdb
sdf file: 596935.sdf
directory: 596935


131515-14-5 (Z)- 190779-09-0 (S-[Z])- 6-(Z-1-Phenylpropen-3-yl)-4,5,6,7-tetrahydro-5-methylimidazo-[4,5,1-jk][1,4]-benzodiazepin-2(1H)-one AIDS-002452 AIDS002452 Imidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one, 4,5,6,7-tetrahydro-5-methyl-6-(3-phenyl-2-propenyl)-, (Z)-(1)- TIBO deriv.

pdb file: 596936.pdb
sdf file: 596936.sdf
directory: 596936


131515-15-6 6-(3-Methylenebuten-4-yl)-4,5,6,7-tetrahydro-5-methylimidazo-[4,5,1-jk][1,4]-benzodiazepin-2(1H)-one AIDS-002453 AIDS002453 Imidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one, 4,5,6,7-tetrahydro-5-methyl-6-(2-methylene-3-butenyl)-, (1)- TIBO deriv.

pdb file: 596937.pdb
sdf file: 596937.sdf
directory: 596937


131515-16-7 6-(2-Isopropyloxyethyl)-4,5,6,7-tetrahydro-5-methylimidazo-[4,5,1-jk][1,4]-benzodiazepin-2(1H)-one AIDS-002454 AIDS002454 Imidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one, 4,5,6,7-tetrahydro-5-methyl-6-[2-(1-methylethoxy)ethyl]-, (1)- TIBO deriv.

pdb file: 596938.pdb
sdf file: 596938.sdf
directory: 596938


5'-Cholesteryl phosphorothiocytidine AIDS-002463 AIDS002463 Chol-SdC10 Nucleotide deriv.

pdb file: 596947.pdb
sdf file: 596947.sdf
directory: 596947


130469-39-5 6-Amino-9-[2,3-dideoxy-2-hydroxymethyl-.beta.-D-ribofuranosyl]-9H-purine 6NH2-2'CH2OHriboddP AIDS-002485 AIDS002485 Adenosine, 2',3'-dideoxy-2'-(hydroxymethyl)- Oxetanocin deriv.

pdb file: 596961.pdb
sdf file: 596961.sdf
directory: 596961


.beta.-D-Glucopyranosiduronic acid, (3b,20b)-20-carboxy-30-noroleana-11,13(18)-dien-3-yl 2-O-b-D-glucopyranuronosyl- 118525-49-8 30-Noroleanane, b-D-glucopyranosiduronic acid deriv. AIDS-002509 AIDS002509 Glycyrrhizin deriv. Licoricesaponin C2 Olean-11,13(18)-diene-3.beta.-ol-30-oic acid 3-O-.beta.-D-glucuronopyranosyl- (1-

pdb file: 596983.pdb
sdf file: 596983.sdf
directory: 596983


1-(5,6-Di-O-acetyl-3-phthalimido-2,3-dideoxy-.alpha.-D-arabino-hexafuranosyl)uracil 133488-18-3 2,4(1H,3H)-Pyrimidinedione, 1-[5,6-di-O-acetyl-2,3-dideoxy-3-(1,3-dihydro-1,3-dioxo-2H-isoindol-2-yl)-.alpha.-D-arabino-hexofuranosyl]- AIDS-002518 AIDS002518 DiOAcPhthN-D-arab-ddU deriv.

pdb file: 596991.pdb
sdf file: 596991.sdf
directory: 596991


1-(5,6-Di-O-acetyl-2,3-dideoxy-3-phthalimido-.alpha.-D-arabino-hexafuranosyl)thymine 133488-19-4 2,4(1H,3H)-Pyrimidinedione, 1-[5,6-di-O-acetyl-2,3-dideoxy-3-(1,3-dihydro-1,3-dioxo-2H-isoindol-2-yl)-.alpha.-D-arabino-hexofuranosyl]-5-methyl- AIDS-002519 AIDS002519 DiOAcPhthN-D-arab-ddT deriv.

pdb file: 596992.pdb
sdf file: 596992.sdf
directory: 596992


1-(5,6-Di-O-acetyl-2,3-dideoxy-3-phthalimido-2,3-dideoxy-.alpha.-D-arabino- hexofuranosyl)-5-fluorouracil 133488-20-7 2,4(1H,3H)-Pyrimidinedione, 1-[5,6-di-O-acetyl-2,3-dideoxy-3-(1,3-dihydro-1,3-dioxo-2H-isoindol-2-yl)-.alpha.-D-arabino-hexofuranosyl]-5-fluoro- AIDS-002520 AIDS002520 DiOAcPhthN-D-arab-ddU deriv.

pdb file: 596993.pdb
sdf file: 596993.sdf
directory: 596993


1-(5,6-Di-O-acetyl-2,3-dideoxy-3-phthalimido-.alpha.-D-arabino-hexofuranosyl)-5-chlorouracil 133488-21-8 2,4(1H,3H)-Pyrimidinedione, 5-chloro-1-[5,6-di-O-acetyl-2,3-dideoxy-3-(1,3-dihydro-1,3-dioxo-2H-isoindol-2-yl)-.alpha.-D-arabino-hexofuranosyl]- AIDS-002521 AIDS002521 DiOAcPhthN-D-arab-ddU deriv.

pdb file: 596994.pdb
sdf file: 596994.sdf
directory: 596994


1-(5,6-Di-O-acetyl-2,3-dideoxy-3-phthalimido-2,3-.alpha.-D-arabino-hexofuranosyl)-5-bromouracil 133488-22-9 2,4(1H,3H)-Pyrimidinedione, 5-bromo-1-[5,6-di-O-acetyl-2,3-dideoxy-3-(1,3-dihydro-1,3-dioxo-2H-isoindol-2-yl)-.alpha.-D-arabino-hexofuranosyl]- AIDS-002522 AIDS002522 DiOAcPhthN-D-arab-ddU deriv.

pdb file: 596995.pdb
sdf file: 596995.sdf
directory: 596995


1-(5,6-Di-O-acetyl-3-phthalimido-2,3-dideoxy-.alpha.-D-arabino-hexofuranosyl)- 5-iodoruracil 133488-23-0 2,4(1H,3H)-Pyrimidinedione, 1-[5,6-di-O-acetyl-2,3-dideoxy-3-(1,3-dihydro-1,3-dioxo-2H-isoindol-2-yl)-.alpha.-D-arabino-hexofuranosyl]-5-iodo- AIDS-002523 AIDS002523 DiOAcPhthN-D-arab-ddU deriv.

pdb file: 596996.pdb
sdf file: 596996.sdf
directory: 596996


1-(3-Amino-2,3-dideoxy-.alpha.-D-arabino-hexofuranosyl)uracil 133488-24-1 2,4(1H,3H)-Pyrimidinedione, 1-(3-amino-2,3-dideoxy-.alpha.-D-arabino-hexofuranosyl)- 3NH-D-arab-ddU deriv. AIDS-002524 AIDS002524

pdb file: 596997.pdb
sdf file: 596997.sdf
directory: 596997


1-(3-Amino-2,3-dideoxy-.alpha.-D-arabino-hexofuranosyl)thymine 133488-25-2 2,4(1H,3H)-Pyrimidinedione, 1-(3-amino-2,3-dideoxy-.alpha.-D-arabino-hexofuranosyl)-5-methyl- 3NH-D-arab-ddT deriv. AIDS-002525 AIDS002525

pdb file: 596998.pdb
sdf file: 596998.sdf
directory: 596998


1-(3-Amino-2,3-dideoxy.-alpha.-D-arabino-hexofuranosyl)-5-fluorouracil 133488-26-3 2,4(1H,3H)-Pyrimidinedione, 1-(3-amino-2,3-dideoxy-.alpha.-D-arabino-hexofuranosyl)-5-fluoro- 3NH-D-arab-ddU deriv. AIDS-002526 AIDS002526

pdb file: 596999.pdb
sdf file: 596999.sdf
directory: 596999


1-(3-Amino-2,3-dideoxy.-alpha.-D-arabino-hexofuranosyl)-5-chlorouracil 133488-27-4 2,4(1H,3H)-Pyrimidinedione, 1-(3-amino-2,3-dideoxy-.alpha.-D-arabino-hexofuranosyl)-5-chloro- 3NH-D-arab-ddU deriv. AIDS-002527 AIDS002527

pdb file: 597000.pdb
sdf file: 597000.sdf
directory: 597000


1-(3-Amino-2,3-dideoxy-.alpha.-D-arabino-hexofuranosyl)-5-bromouracil 133488-28-5 2,4(1H,3H)-Pyrimidinedione, 1-(3-amino-2,3-dideoxy-.alpha.- D-arabino-hexofuranosyl)-5-bromo- 3NH-D-arab-ddU deriv. AIDS-002528 AIDS002528

pdb file: 597001.pdb
sdf file: 597001.sdf
directory: 597001


1-(3-Amino-2,3-dideoxy-.alpha.-D-arabino-hexofuranosyl)-5-methylaminouracil 133488-29-6 2,4(1H,3H)-Pyrimidinedione, 1-(3-amino-2,3-dideoxy-.alpha.-D-arabino-hexofuranosyl)-5-(methylamino)- 3NH-D-arab-ddU deriv. AIDS-002529 AIDS002529

pdb file: 597002.pdb
sdf file: 597002.sdf
directory: 597002


.beta.-1-(5,6-Di-O-acetyl-2,3-dideoxy-3-phthalimido-D-ribo-hexafuranosyl)uracil 133488-30-9 4(1H,3H)-Pyrimidinedione, 1-[5,6-di-O-acetyl-2,3-dideoxy-3-(1,3-dihydro-1,3-dioxo-2H-isoindol-2-yl)-.beta.-D-ribo-hexofuranosyl]- AIDS-002530 AIDS002530 DiOAcPhthN-D-ribo-ddU deriv.

pdb file: 597003.pdb
sdf file: 597003.sdf
directory: 597003


.alpha.-1-(5,6-Di-O-acetyl-2,3-dideoxy-3-phthalimido-D-ribo-hexofuranosyl)uracil 133488-33-2 2,4(1H,3H)-Pyrimidinedione, 1-[5,6-di-O-acetyl-2,3-dideoxy-3-(1,3-dihydro-1,3-dioxo-2H-isoindol-2-yl)-.alpha.-D-ribo-hexofuranosyl]- AIDS-002533 AIDS002533 DiOAcPhthN-D-ribo-ddU deriv.

pdb file: 597006.pdb
sdf file: 597006.sdf
directory: 597006


.alpha.-1-(5,6-Di-O-acetyl-2,3-dideoxy-3-phthalimido-D-ribo-hexafuranosyl)thymine 133488-31-0 2,4(1H,3H)-Pyrimidinedione, 1-[5,6-di-O-acetyl-2,3-dideoxy-3-(1,3-dihydro-1,3-dioxo-2H-isoindol-2-yl)-.alpha.-D-ribo-hexofuranosyl]-5-methyl-. AIDS-002534 AIDS002534 DiOAcPhthN-D-ribo-ddT deriv.

pdb file: 597007.pdb
sdf file: 597007.sdf
directory: 597007


.beta.-1-(5,6-Di-O-acetyl-3- phthalimido-2,3-dideoxy-D-ribo-hexofuranosyl)-5-chlorouracil 133488-36-5 2,4(1H,3H)-Pyrimidinedione, 5-chloro-1-[5,6-di-O-acetyl-2,3-dideoxy-3-(1,3-dihydro-1,3-dioxo-2H-isoindol-2-yl)-.beta.-D-ribo-hexofuranosyl]- AIDS-002535 AIDS002535 DiOAcPhthN-D-ribo-ddU deriv.

pdb file: 597008.pdb
sdf file: 597008.sdf
directory: 597008


.alpha.-1-(5,6-Di-O-acetyl-3-phthalimido-2,3-dideoxy-D-ribo-hexofuranosyl)-5-chlorouracil 133488-37-6 2,4(1H,3H)-Pyrimidinedione, 5-chloro-1-[5,6-di-O-acetyl-2,3-dideoxy-3-(1,3-dihydro-1,3-dioxo-2H-isoindol-2-yl)-.alpha.-D-ribo-hexofuranosyl]- AIDS-002536 AIDS002536 DiOAcPhthN-D-ribo-ddU deriv.

pdb file: 597009.pdb
sdf file: 597009.sdf
directory: 597009


1-(3-Amino-2,3-dideoxy-.beta.-D-ribo-hexofuranosyl)uracil 133488-38-7 2,4(1H,3H)-Pyrimidinedione, 1-(3-amino-2,3-dideoxy-.beta.-D-ribo-hexofuranosyl)- 3NH-D-ribo-ddU deriv. AIDS-002537 AIDS002537

pdb file: 597010.pdb
sdf file: 597010.sdf
directory: 597010


1-(3-Amino-2,3-dideoxy-.beta.-D-ribo-hexofuranosyl)thymine 133488-39-8 2,4(1H,3H)-Pyrimidinedione, 1-(3-amino-2,3-dideoxy-.beta.-D-ribo-hexofuranosyl)-5-methyl- 3NH-D-ribo-ddT deriv. AIDS-002538 AIDS002538

pdb file: 597011.pdb
sdf file: 597011.sdf
directory: 597011


1-(3-Amino-2,3-dideoxy-.beta.-D-ribo-hexofuranosyl)-5-fluorouracil 133488-40-1 2,4(1H,3H)-Pyrimidinedione, 1-(3-amino-2,3-dideoxy-.beta.-D-ribo-hexofuranosyl)-5-fluoro- 3NH-D-ribo-ddU deriv. AIDS-002539 AIDS002539

pdb file: 597012.pdb
sdf file: 597012.sdf
directory: 597012


1-(3-Amino-2,3-dideoxy-.beta.-D-ribo-hexofuranosyl)-5-chlorouracil 133488-41-2 2,4(1H,3H)-Pyrimidinedione, 1-(3-amino-2,3-dideoxy-.beta.-D-ribo-hexofuranosyl)-5-chloro- 3NH-D-ribo-ddU deriv. AIDS-002540 AIDS002540

pdb file: 597013.pdb
sdf file: 597013.sdf
directory: 597013


1-(3-Amino-2,3-dideoxy-.alpha.-D-ribo-hexofuranosyl)thymine 133488-42-3 2,4(1H,3H)-Pyrimidinedione, 1-(3-amino-2,3-dideoxy-.alpha.-D-ribo-hexofuranosyl)-5-methyl- 3NH-D-ribo-ddT deriv. AIDS-002541 AIDS002541

pdb file: 597014.pdb
sdf file: 597014.sdf
directory: 597014


1-(3-Amino-2,3-dideoxy-.alpha.-D-ribo-hexofuranosyl)-5-flourouracil 133488-43-4 2,4(1H,3H)-Pyrimidinedione, 1-(3-amino-2,3-dideoxy-.alpha.-D-ribo-hexofuranosyl)-5-fluoro- 3NH-D-ribo-ddU deriv. AIDS-002542 AIDS002542

pdb file: 597015.pdb
sdf file: 597015.sdf
directory: 597015


140132-24-7 3'-Azido-5'-phosphite-2',3'-dideoxycytidine 5'-H2PO3-AZddC deriv. AIDS-002543 AIDS002543 Cytidine, 3'-azido-2',3'-dideoxy-, 5'-(hydrogen phosphonate)

pdb file: 597016.pdb
sdf file: 597016.sdf
directory: 597016


1-(2OHEtOMe)-6(MeS)T 1-[(2-Hydroxyethoxy)methyl]-6-(methylthio)thymine 125056-71-5 2,4(1H,3H)-Pyrimidinedione, 1-[(2-hydroxyethoxy)methyl]-5-methyl-6-(methylthio)- AIDS-002552 AIDS002552 HEPT deriv.

pdb file: 597025.pdb
sdf file: 597025.sdf
directory: 597025


125056-72-6 2,4(1H,3H)-Pyrimidinedione, 6-(ethylthio)-1-[(2-hydroxyethoxy)methyl]-5-methyl- 6-Ethylthio-1-[(2-hydroxyethoxy)methyl]thymine 6EtS-1-(2-OHEtOMe)T AIDS-002553 AIDS002553 HEPT deriv.

pdb file: 597026.pdb
sdf file: 597026.sdf
directory: 597026


125056-73-7 6-Butylthio-1-[(2-hydroxyethoxy)methyl]thymine 6BuS-1-(2OHEtOMe)T AIDS-002554 AIDS002554 HEPT deriv.

pdb file: 597027.pdb
sdf file: 597027.sdf
directory: 597027


131193-99-2 2,4(1H,3H)-Pyrimidinedione, 6-[(1,1-dimethylethyl)thio]-1-[(2-hydroxyethoxy)methyl]-5-methyl- 6-(tert-Butylthio)-1-[(2-hydroxyethoxy)methyl]thymine 6tBuS-1-(2OHEtOMe)T AIDS-002555 AIDS002555 HEPT deriv.

pdb file: 597028.pdb
sdf file: 597028.sdf
directory: 597028


1-(2OHEtOMe)-6MeOT 1-[(2-Hydroxyethoxy)methyl]-6-methoxythymine 131194-00-8 2,4(1H,3H)-Pyrimidinedione, 1-[(2-hydroxyethoxy)methyl]-6-methoxy-5-methyl- AIDS-002556 AIDS002556 HEPT deriv.

pdb file: 597029.pdb
sdf file: 597029.sdf
directory: 597029


131194-01-9 2,4(1H,3H)-Pyrimidinedione, 6-(cyclohexyloxy)-1-[(2-hydroxyethoxy)methyl]-5-methyl- 6-(Cyclohexyloxy)-1-[(2-hydroxyethoxy)methyl]thymine 6CyHexO-1-(2OHEtOMe)T AIDS-002557 AIDS002557 HEPT deriv.

pdb file: 597030.pdb
sdf file: 597030.sdf
directory: 597030


1-(2OHEtOMe)-6PhOT 1-[(2-hydroxyethoxy)methyl]-6-(phenoxy)thymine 131194-02-0 2,4(1H,3H)-Pyrimidinedione, 1-[(2-hydroxyethoxy)methyl]-5-methyl-6-phenoxy- AIDS-002558 AIDS002558 HEPT deriv.

pdb file: 597031.pdb
sdf file: 597031.sdf
directory: 597031


105408-01-3 2,4(1H,3H)-Pyrimidinedione, 6-(cyclohexylamino)-1-[(2-hydroxyethoxy)methyl]-5-methyl- 6-Aminocyclohexyl-1-[(2-hydroxyethoxy)methyl]thymine 6CyHexNH-1-(2OHEtOMe)T AIDS-002559 AIDS002559 HEPT deriv.

pdb file: 597032.pdb
sdf file: 597032.sdf
directory: 597032


131194-03-1 2,4(1H,3H)-Pyrimidinedione, 1-[(2-hydroxyethoxy)methyl]-5-methyl-6-(phenylamino)- 6-Aminophenyl-1-[(2-hydroxyethoxy)methyl]thymine 6PhNH-1(2OHEtOMe)T AIDS-002560 AIDS002560 HEPT deriv.

pdb file: 597033.pdb
sdf file: 597033.sdf
directory: 597033


131194-10-0 2,4(1H,3H)-Pyrimidinedione, 6-bromo-1-[(2-hydroxyethoxy)methyl]-5-methyl- 6-Bromo-1-[(2-hydroxyethoxy)methyl]thymine 6Br-1-(2OHEtOMe)T AIDS-002561 AIDS002561 HEPT deriv.

pdb file: 597034.pdb
sdf file: 597034.sdf
directory: 597034


131194-11-1 2,4(1H,3H)-Pyrimidinedione, 6-chloro-1-[(2-hydroxyethoxy)methyl]-5-methyl- 6-Chloro-1-[(2-hydroxyethoxy)methyl]thymine 6Cl-1-(2OHEtOMe)T AIDS-002562 AIDS002562 HEPT deriv.

pdb file: 597035.pdb
sdf file: 597035.sdf
directory: 597035


131194-12-2 2,4(1H,3H)-Pyrimidinedione, 6-benzoyl-1-[(2-hydroxyethoxy)methyl]-5-methyl- 6-Benzoyl-1-[(2-hydroxyethoxy)methyl]thymine 6PHCO-1-(2OHEtOMe)T AIDS-002563 AIDS002563 HEPT deriv.

pdb file: 597036.pdb
sdf file: 597036.sdf
directory: 597036


1-(2OHEtOMe)-6(OHBz)T 1-[(2-Hydroxyethoxy)methyl]-6-(1-hydroxy-1-phenyl-methyl)thymine 131194-13-3 2,4(1H,3H)-Pyrimidinedione, 1-[(2-hydroxyethoxy)methyl]-6-(hydroxyphenylmethyl)-5-methyl- AIDS-002564 AIDS002564 HEPT deriv.

pdb file: 597037.pdb
sdf file: 597037.sdf
directory: 597037


131194-14-4 2,4(1H,3H)-Pyrimidinedione, 1-[(2-hydroxyethoxy)methyl]-5-methyl-6-(phenylmethyl)- 6-Benzyl-1-[(2-hydroxyethoxy)methyl]thymine 6Bz-1-(2OHEtOMe)T AIDS-002565 AIDS002565 HEPT deriv.

pdb file: 597038.pdb
sdf file: 597038.sdf
directory: 597038


1-(2OHEtOMe)-6(MeEthynyl)T 1-[(2-Hydroxyethoxy)methyl]-6-(2-methylethynyl)thymine 125056-88-4 2,4(1H,3H)-Pyrimidinedione, 1-[(2-hydroxyethoxy)methyl]-5-methyl-6-(1-propynyl)- AIDS-002566 AIDS002566 HEPT deriv.

pdb file: 597039.pdb
sdf file: 597039.sdf
directory: 597039


1(OHEtOMe)-6(PhEthynyl)T 1-[(2-Hydroxyethoxy)methyl]-6-(2-phenylethynyl)thymine 125056-87-3 2,4(1H,3H)-Pyrimidinedione, 1-[(2-hydroxyethoxy)methyl]-5-methyl-6-(phenylethynyl)- AIDS-002567 AIDS002567 HEPT deriv.

pdb file: 597040.pdb
sdf file: 597040.sdf
directory: 597040


125056-89-5 2,4(1H,3H)-Pyrimidinedione, 6-ethynyl-1-[(2-hydroxyethoxy)methyl]-5-methyl- 6-Ethynyl-1-[(2-hydroxyethoxy)methyl]thymine 6Ethynyl-1(-2OHEtOMe)T AIDS-002568 AIDS002568 HEPT deriv.

pdb file: 597041.pdb
sdf file: 597041.sdf
directory: 597041


1-(2OHEtOMe)-6MeVinylT 1-[(2-Hydroxyethoxy)methyl]-6-[2-(Z)-methylvinyl]thymine 131194-18-8 2,4(1H,3H)-Pyrimidinedione, 1-[(2-hydroxyethoxy)methyl]-5-methyl-6-[(1Z)-1-propenyl]- AIDS-002569 AIDS002569 HEPT deriv.

pdb file: 597042.pdb
sdf file: 597042.sdf
directory: 597042


1-(2OHEtOMe)-6PhVinylT 1-[(2-Hydroxyethoxy)methyl]-6-[2-(Z)-phenylvinyl]thymine 131194-19-9 2,4(1H,3H)-Pyrimidinedione, 1-[(2-hydroxyethoxy)methyl]-5-methyl-6-[(1Z)-2-phenylethenyl]- AIDS-002570 AIDS002570 HEPT deriv.

pdb file: 597043.pdb
sdf file: 597043.sdf
directory: 597043


1-(2OHEtOMe)-6VinylT 1-[(2-Hydroxyethoxy)methyl]-6-vinylthymine 125083-81-0 2,4(1H,3H)-Pyrimidinedione, 6-ethenyl-1-[(2-hydroxyethoxy)methyl]-5-methyl- AIDS-002571 AIDS002571 HEPT deriv.

pdb file: 597044.pdb
sdf file: 597044.sdf
directory: 597044


1-(2OHEtOMe)-5I-6PhSU 1-[(2-Hydroxyethoxy)methyl]-5-iodo-6-(phenylthio)uracil 125056-92-0 2,4(1H,3H)-Pyrimidinedione, 1-[(2-hydroxyethoxy)methyl]-5-iodo-6-(phenylthio)- AIDS-002572 AIDS002572 HEPT deriv.

pdb file: 597045.pdb
sdf file: 597045.sdf
directory: 597045


1-(2OHEtOMe)-5, 6-bis(PhS)U 1-[(2-Hydroxyethoxy)methyl]-5,6-bis(phenylthio)uracil 125057-00-3 2,4(1H,3H)-Pyrimidinedione, 1-[(2-hydroxyethoxy)methyl]-5,6-bis(phenylthio)- AIDS-002573 AIDS002573 HEPT deriv.

pdb file: 597046.pdb
sdf file: 597046.sdf
directory: 597046


1-(2OHEtOMe)-5iButyr-6PhSU 1-[(2-Hydroxyethoxy)methyl]-5-isobutyryl-6-(phenylthio)uracil 125057-02-5 2,4(1H,3H)-Pyrimidinedione, 1-[(2-hydroxyethoxy)methyl]-5-(2-methyl-1-oxopropyl)-6-(phenylthio)- AIDS-002574 AIDS002574 HEPT deriv.

pdb file: 597047.pdb
sdf file: 597047.sdf
directory: 597047


125057-01-4 2,4(1H,3H)-Pyrimidinedione, 5-benzoyl-1-[(2-hydroxyethoxy)methyl]-6-(phenylthio)- 5-Benzoyl-1-[(2-hydroxyethoxy)methyl]-6-(phenylthio)uracil 5PhCO-1-(2OHEtOMe)-6PhSU AIDS-002575 AIDS002575 HEPT deriv.

pdb file: 597048.pdb
sdf file: 597048.sdf
directory: 597048


125056-99-7 2,4(1H,3H)-Pyrimidinedione, 1-[(2-hydroxyethoxy)methyl]-5-(phenylmethyl)-6-(phenylthio)- 5-Benzyl-1-[(2-hydroxyethoxy)methyl]-6-(phenylthio)uracil 5Bz-1(OHEtOMe)-6PhSU AIDS-002576 AIDS002576 HEPT deriv.

pdb file: 597049.pdb
sdf file: 597049.sdf
directory: 597049


1-(2OHEtOMe)-6PhS-5diPhVinylU 1-[(2-Hydroxyethoxy)methyl]-6-(phenylthio)-5-(2,2-diphenylvinyl)uracil 125057-11-6 2,4(1H,3H)-Pyrimidinedione, 5-(2,2-diphenylethenyl)-1-[(2-hydroxyethoxy)methyl]-6-(phenylthio)- AIDS-002577 AIDS002577 HEPT deriv.

pdb file: 597050.pdb
sdf file: 597050.sdf
directory: 597050


1-(2OHEtOMe)-5MeEthynyl-6PhSU 1-[(2-Hydroxyethoxy)methyl]-5-(2-methylethynyl)-6-(phenylthio)uracil 125056-94-2 2,4(1H,3H)-Pyrimidinedione, 1-[(2-hydroxyethoxy)methyl]-6-(phenylthio)-5-(1-propynyl)- AIDS-002578 AIDS002578 HEPT deriv.

pdb file: 597051.pdb
sdf file: 597051.sdf
directory: 597051


1-(2OHEtOMe)-5PhEthynyl-6PhSU 1-[(2-Hydroxyethoxy)methyl]-5-(2-phenylethynyl)-6-(phenylthio)uracil 125056-93-1 2,4(1H,3H)-Pyrimidinedione, 1-[(2-hydroxyethoxy)methyl]-5-(phenylethynyl)-6-(phenylthio)- AIDS-002579 AIDS002579 HEPT deriv.

pdb file: 597052.pdb
sdf file: 597052.sdf
directory: 597052


125056-95-3 2,4(1H,3H)-Pyrimidinedione, 5-ethynyl-1-[(2-hydroxyethoxy)methyl]-6-(phenylthio)- 5-Ethynyl-1-[(2-hydroxyethoxy)methyl]-6-(phenylthio)uracil 5Ethynyl-1-(2OHEtOMe)-6PhSU AIDS-002580 AIDS002580 HEPT deriv.

pdb file: 597053.pdb
sdf file: 597053.sdf
directory: 597053


1-(2OHEtOMe)-6PhS-5PhVinylU 1-[(2-Hydroxyethoxy)methyl]-6-(phenylthio)-5-[2-(Z)-phenylvinyl]uracil 131194-26-8 2,4(1H,3H)-Pyrimidinedione, 1-[(2-hydroxyethoxy)methyl]-5-[(1Z)-2-phenylethenyl]-6-(phenylthio)- AIDS-002581 AIDS002581 HEPT deriv.

pdb file: 597054.pdb
sdf file: 597054.sdf
directory: 597054


1-(2OHEtOMe)-6PhS-5Vinylu 1-[(2-Hydroxyethoxy)methyl]-6-(phenylthio)-5-vinyluracil 125056-98-6 2,4(1H,3H)-Pyrimidinedione, 5-ethenyl-1-[(2-hydroxyethoxy)methyl]-6-(phenylthio)- AIDS-002582 AIDS002582 HEPT deriv.

pdb file: 597055.pdb
sdf file: 597055.sdf
directory: 597055


1-Ethoxymethyl-6-(phenylthio)thymine 132774-39-1 AIDS-002583 AIDS002583 EPT HEPT deriv.

pdb file: 597056.pdb
sdf file: 597056.sdf
directory: 597056


1-Propoxymethyl-6-(phenylthio)thymine 133563-27-6 AIDS-002584 AIDS002584 HEPT deriv. PPT

pdb file: 597057.pdb
sdf file: 597057.sdf
directory: 597057


1-[(2-Benzyloxy)methyl]-6-(phenylthio)thymine 132774-43-7 AIDS-002585 AIDS002585 BPT HEPT deriv.

pdb file: 597058.pdb
sdf file: 597058.sdf
directory: 597058


132774-44-8 5-Ethyl-1-[(2-hydroxyethoxy)methyl]-6-(phenylthio)uracil AIDS-002586 AIDS002586 E-HEPU HEPT deriv.

pdb file: 597059.pdb
sdf file: 597059.sdf
directory: 597059


1-[(Ethoxy)methyl]-6-(phenylthio)-5-ethyluracil 132774-45-9 AIDS-002587 AIDS002587 E-EPU HEPT deriv.

pdb file: 597060.pdb
sdf file: 597060.sdf
directory: 597060


1-(Benzyloxymethyl)-6-phenylthio-5-ethyluracil 132774-46-0 AIDS-002588 AIDS002588 E-BPU HEPT deriv.

pdb file: 597061.pdb
sdf file: 597061.sdf
directory: 597061


1-[(2-Hydroxyethoxy)methyl]-6-(phenylthio)-5-propyluracil 133563-28-7 AIDS-002589 AIDS002589 HEPT deriv. P-HEPU

pdb file: 597062.pdb
sdf file: 597062.sdf
directory: 597062


.alpha.-L-(+)-(2R,5R)-1-[2-(Hydroxymethyl)-1,3-oxathiolan-5-yl]cytosine .alpha.-L-Oxathionyl-cytidine 1,3-Oxathiolane deriv. 139757-68-9 2(1H)-Pyrimidinone, 4-amino-1-[2-(hydroxymethyl)-1,3-oxathiolan-5-yl]-, (2R-trans)- AIDS-002618 AIDS002618 trans-2-Hydroxymethyl-5-(cytosin-1-yl)-1,3-oxathiolane

pdb file: 597091.pdb
sdf file: 597091.sdf
directory: 597091


(+/-) Cis-2-hydroxymethyl-5-(thymin-N-1-yl)-1,3-oxathiolane 1,3-Oxathiolane, 2,4(1H,3H)-pyrimidinedione deriv. 1,3-oxathiolane deriv. 2,4(1H,3H)-Pyrimidinedione, 1-[2-(hydroxymethyl)-1,3-oxathiolan-5-yl]-5-methyl-, (cis)- 5-Me SddU, 5-MeSddU AIDS-002619 AIDS002619

pdb file: 597092.pdb
sdf file: 597092.sdf
directory: 597092


1,3-oxathiolane deriv. 131086-25-4 6H-Purin-6-one, 1,9-dihydro-9-[2-(hydroxymethyl)-1,3-oxathiolan-5-yl]-, cis- AIDS-002620 AIDS002620 Cis-2-hydroxymethyl-5-(6'-hydroxypurin-N-9'-yl)-1,3-oxathiolane

pdb file: 597093.pdb
sdf file: 597093.sdf
directory: 597093


1,3-oxathiolane deriv. 131086-26-5 2,4(1H,3H)-Pyrimidinedione, 1-[2-(hydroxymethyl)-1,3-oxathiolan-5-yl]-, cis- AIDS-002621 AIDS002621 Cis-2-Hydroxymethyl-5-(uracil-N-1'-yl)-1,3-oxathiolane SddU

pdb file: 597094.pdb
sdf file: 597094.sdf
directory: 597094


1-[(2-Hydroxyethoxy)methyl]-6-phenylthio-4-thiothymine 4(1H)-Pyrimidinone, 2,3-dihydro-1-[(2-hydroxyethoxy)methyl]-5-methyl-6-(phenylthio)-4-thioxo- AIDS-002626 AIDS002626 HEPT derivative HEPT-4S

pdb file: 597099.pdb
sdf file: 597099.sdf
directory: 597099


1-[(2-Hydroxyethoxy)methyl]-6-phenylthio-4-thiouracil 125057-08-1 2(1H)-Pyrimidinone, 3,4-dihydro-1-[(2-hydroxyethoxy)methyl]-6-(phenylthio)-4-thioxo- AIDS-002627 AIDS002627 HEPT derivative

pdb file: 597100.pdb
sdf file: 597100.sdf
directory: 597100


1-[(2-Hydroxyethoxy)methyl]-5-methyl-6-phenylthiocytosine 125057-05-8 2(1H)-Pyrimidinone, 4-amino-1-[(2-hydroxyethoxy)methyl]-5-methyl-6-(phenylthio)- AIDS-002628 AIDS002628 HEPT derivative

pdb file: 597101.pdb
sdf file: 597101.sdf
directory: 597101


1-[(2-Hydroxyethoxy)methyl]-6-phenylthiocytosine 125057-04-7 2(1H)-Pyrimidinone, 4-amino-1-[(2-hydroxyethoxy)methyl]-6-(phenylthio)- AIDS-002629 AIDS002629 HEPT derivative

pdb file: 597102.pdb
sdf file: 597102.sdf
directory: 597102


1-[(2-Hydroxyethoxy)methyl]-3-methyl-6-phenylthiothymine 132885-44-0 2,4(1H,3H)-Pyrimidinedione, 1-[(2-hydroxyethoxy)methyl]-3,5-dimethyl-6-(phenylthio)- 3-Me-HEPT AIDS-002630 AIDS002630 HEPT derivative

pdb file: 597103.pdb
sdf file: 597103.sdf
directory: 597103


132885-45-1 2,4(1H,3H)-Pyrimidinedione, 1-[(2-hydroxyethoxy)methyl]-5-methyl-3-(phenylmethyl)-6-(phenylthio)- 3-Benzyl-1-[(2-hydroxyethoxy)methyl]-6-phenylthiothymine 3-Bz-HEPT AIDS-002631 AIDS002631 HEPT derivative

pdb file: 597104.pdb
sdf file: 597104.sdf
directory: 597104


120503-52-8 9-.beta.-D-2',3'-Dideoxyribofuranosyl N(6)-diethylaminopurine AIDS-002633 AIDS002633 Adenosine, 2',3'-dideoxy-N,N-diethyl- N-6 Diethyl ddA deriv.

pdb file: 597105.pdb
sdf file: 597105.sdf
directory: 597105


134720-13-1 9-.beta.-D-2',3'-Dideoxyribofuranosyl N(6)-n-hexylaminopurine;N-6 n-Hexyl ddA deriv. AIDS-002634 AIDS002634 Adenosine, 2',3'-dideoxy-N-hexyl-

pdb file: 597106.pdb
sdf file: 597106.sdf
directory: 597106


1-Deaza ddP deriv. 134720-14-2 2-Furanmethanol, tetrahydro-5-(3H-imidazo[4,5-b]pyridin-3-yl)-, (2S-cis)- 9-.beta.-D-2',3'-Dideoxyribofuranosyl 1-deazapurine AIDS-002635 AIDS002635

pdb file: 597107.pdb
sdf file: 597107.sdf
directory: 597107


132101-22-5 5'-Isocyano-5'-deoxythymidine 5'-IsocyanoT deriv. AIDS-002636 AIDS002636 Thymidine, 5'-deoxy-5'-isocyano-

pdb file: 597108.pdb
sdf file: 597108.sdf
directory: 597108


132125-31-6 2',5'-dd-5'-IsocyanoU deriv. 5'-Isocyano-2',5'-dideoxyuridine AIDS-002637 AIDS002637 Uridine, 2',5'-dideoxy-5'-isocyano-

pdb file: 597109.pdb
sdf file: 597109.sdf
directory: 597109


132101-32-7 3'-Azido-5'-isocyano-3',5'-dideoxythymidine 5'-IsocyanoAZT deriv. AIDS-002638 AIDS002638 Thymidine, 3'-azido-3',5'-dideoxy-5'-isocyano-

pdb file: 597110.pdb
sdf file: 597110.sdf
directory: 597110


35846-53-8 4,24-Dioxa-9,22-diazatetracyclo[19.3.1.110,14.03,5]hexacosane, maytansine deriv. AIDS-002647 AIDS002647 Ansa macrolide L-Alanine, N-acetyl-N-methyl-, 11-chloro-21-hydroxy-12,20-dimethoxy-2,5,9,16-tetramethyl-8,23-dioxo-4,24-dioxa-9,22-diazatetracyclo[19.3.1.110,14.03,5]hexacosa-10,12,14(26),16,18-pentaen-6-yl ester, [1S-(1R*,2S*,3R*,5R*,6R*,16E,18E,20S*,21R*)]- Maitansine Maytansine N-Acetyl-N-methyl-L-alanine NSC153858

pdb file: 597117.pdb
sdf file: 597117.sdf
directory: 597117


130108-74-6 4'-Azido-2'-deoxyadenosine AIDS-002723 AIDS002723 AzdG deriv. Guanosine, 4'-azido-2'-deoxy-

pdb file: 597192.pdb
sdf file: 597192.sdf
directory: 597192


130108-75-7 4'-Azido-2'-deoxyuridine AIDS-002724 AIDS002724 AzdU deriv. Uridine, 4'-azido-2'-deoxy-

pdb file: 597193.pdb
sdf file: 597193.sdf
directory: 597193


146202-53-1 6-Hexopurine-2',3'-dideoxynucleoside 6-Hexoxy-PddN deriv. AIDS-002727 AIDS002727 Inosine, 2',3'-dideoxy-6-O-hexyl-

pdb file: 597196.pdb
sdf file: 597196.sdf
directory: 597196


135444-85-8 2'-F-Cyclopentyl-T deriv. 3'-Diphosphoryl-phosphonate-2'-fluorocyclopentylthymine AIDS-002728 AIDS002728 Triphosphoric acid, P-[[[3-(3,4-dihydro-5-methyl-2,4-dioxo-1(2H)-pyrimidinyl)-2-fluorocyclopentyl]oxy]methyl] ester, (1a,2b,3a)-

pdb file: 597197.pdb
sdf file: 597197.sdf
directory: 597197


5'-Ph AZT deriv. 5'-Phenyl-3'-azido thymidine AIDS-002730 AIDS002730

pdb file: 597199.pdb
sdf file: 597199.sdf
directory: 597199


(+)-(S)-4,5,6,7-Tetrahydro-8-chloro-5-methyl-6-(3-methyl-2-butenyl)imidazo[4,5,1-jk][1,4]benzodiazepine-2-(1H)-thione 137332-54-8 8-Chloro-TIBO 8-ClTIBO AIDS-002738 AIDS002738 NSC636661 R-86183 R86183 TIBO deriv. Tivirapine

pdb file: 597207.pdb
sdf file: 597207.sdf
directory: 597207


13345-50-1 (A2) 14152-28-4 (A1) AIDS-002744 AIDS002744 PGA Prosta-10,13-dien-1-oic acid, 15-hydroxy-9-oxo-, (13E,15S)- & Prosta-5,10,13-trien-1-oic acid, 15-hydroxy-9-oxo-, (5Z,13E,15S)- Prostaglandin A1 & Prostaglandin A2 Prostanoic acid deriv.

pdb file: 597211.pdb
sdf file: 597211.sdf
directory: 597211


126409-25-4 AIDS-002745 AIDS002745 Boc-CH2Ph-NHBn deriv. Carbamic acid, [(1S,2S,4R)-2-hydroxy-5-oxo-1,4-bis(phenylmethyl)-5-[(phenylmethyl)amino]pentyl]-, 1,1-dimethylethyl ester N-t-Butyloxycarbonyl-5-amino-1,6-diphenyl-4-hydroxy-2-(N-benzylcarbamoyl)hexane

pdb file: 597212.pdb
sdf file: 597212.sdf
directory: 597212


135525-78-9 3-[(4,7-Dichlorobenzoxazolylmethyl)amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-002756 AIDS002756 L 697,661 L-697,661 L697,661 Pyridinone Pyridinone deriv.

pdb file: 597223.pdb
sdf file: 597223.sdf
directory: 597223


1-(2,3-Anhydro-5-O-trityl-.beta.-D-lyxofuranosyl)thymine 115913-84-3 2,4(1H,3H)-Pyrimidinedione, 1-[2,3-anhydro-5-O-(triphenylmethyl)-.beta.-D-lyxofuranosyl]-5-methyl- 3,6-Dioxabicyclo[3.1.0]hexane, 2,4(1H,3H)-pyrimidinedione deriv. AIDS-002762 AIDS002762 Trityl-epoxide-T

pdb file: 597229.pdb
sdf file: 597229.sdf
directory: 597229


128924-99-2 4-Quinolinamine, N-(1-methylethyl)-2-phenyl- AIDS-002788 AIDS002788 N-Isopropyl-2-phenylquinolin-4-amine Quinolin-4-amine deriv.

pdb file: 597255.pdb
sdf file: 597255.sdf
directory: 597255


128925-00-8 4-Quinolinamine, N-(2-methylpropyl)-2-phenyl- AIDS-002789 AIDS002789 N-Isobutyl-2-phenylquinoline-4-amine Quinolin-4-amine deriv.

pdb file: 597256.pdb
sdf file: 597256.sdf
directory: 597256


128924-95-8 4-Quinolinamine, N-(1,1-dimethylethyl)-2-phenyl- AIDS-002790 AIDS002790 N-tert-Butyl-2-phenylquinolin-4-amine Quinolin-4-amine deriv.

pdb file: 597257.pdb
sdf file: 597257.sdf
directory: 597257


133671-41-7 (MONOHYDROBROMIDE) 4-(2-Methylpiperidino)-2-phenylquinoline AIDS-002791 AIDS002791 Quinoline deriv. Quinoline, 4-(2-methyl-1-piperidinyl)-2-phenyl-

pdb file: 597258.pdb
sdf file: 597258.sdf
directory: 597258


133671-42-8 (MONOHYDROBROMIDE) 4-(3-Methylpiperidino)-2-phenylquinoline AIDS-002792 AIDS002792 Quinoline deriv. Quinoline, 4-(3-methyl-1-piperidinyl)-2-phenyl-

pdb file: 597259.pdb
sdf file: 597259.sdf
directory: 597259


1,2-Ethanediamine, N,N-dimethyl-N'-(2-phenyl-4-quinolinyl)- 133671-43-9 (DIHYDROBROMIDE) 148726-12-9 AIDS-002793 AIDS002793 N-[2-(Dimethylamino)ethyl]-2-phenylquinolin-4-amine Quinolin-4-amine deriv.

pdb file: 597260.pdb
sdf file: 597260.sdf
directory: 597260


1,2-Ethanediamine, N-ethyl-N',N'-dimethyl-N-(2-phenyl-4-quinolinyl)- 133671-44-0 (DIHYDROBROMIDE) AIDS-002794 AIDS002794 N-[2-(Dimethylamino)ethyl]-N-ethyl-2-phenyl-4-quinolinamine Quinolinamine deriv.

pdb file: 597261.pdb
sdf file: 597261.sdf
directory: 597261


133671-45-1 (DIHYDROBROMIDE) 181775-68-8 4-(4-Methylpiperazino)-2-phenylquinoline AIDS-002795 AIDS002795 Quinoline deriv. Quinoline, 4-(4-methyl-1-piperazinyl)-2-phenyl-

pdb file: 597262.pdb
sdf file: 597262.sdf
directory: 597262


1,2-Ethanediamine, N'-[2-(4-fluorophenyl)-4-quinolinyl]-N,N-dimethyl- 133671-46-2 AIDS-002796 AIDS002796 N-[2-(Dimethylamino)ethyl]-2-(4-fluorophenyl)quinolin-4-amine Quinolin-4-amine deriv.

pdb file: 597263.pdb
sdf file: 597263.sdf
directory: 597263


1,2-Ethanediamine, N'-[2-(4-chlorophenyl)-4-quinolinyl]-N,N-dimethyl- 133671-47-3 AIDS-002797 AIDS002797 N-[2-(Dimethylamino)ethyl]-2-(4-chlorophenyl)quinolin-4-amine Quinolin-4-amine deriv.

pdb file: 597264.pdb
sdf file: 597264.sdf
directory: 597264


1,2-Ethanediamine, N'-[2-(4-bromophenyl)-4-quinolinyl]-N,N-dimethyl- 133671-48-4 AIDS-002798 AIDS002798 N-[2-(Dimethylamino)ethyl]-2-(4-bromophenyl)quinolin-4-amine Quinolin-4-amine deriv.

pdb file: 597265.pdb
sdf file: 597265.sdf
directory: 597265


1,2-Ethanediamine, N'-[2-(4-methoxyphenyl)-4-quinolinyl]-N,N-dimethyl- 133671-49-5 AIDS-002799 AIDS002799 N-[2-(Dimethylamino)ethyl]-2-(4-methoxyphenyl)quinolin-4-amine Quinolin-4-amine deriv.

pdb file: 597266.pdb
sdf file: 597266.sdf
directory: 597266


1,2-Ethanediamine, N,N-dimethyl-N'-[2-(4-methylphenyl)-4-quinolinyl]- 133671-50-8 AIDS-002800 AIDS002800 N-[2-(Dimethylamino)ethyl]-2-(4-methylphenyl)quinolin-4-amine Quinolin-4-amine deriv.

pdb file: 597267.pdb
sdf file: 597267.sdf
directory: 597267


133671-51-9 ( HYDROBROMIDE) 4-(2-Methylpiperidino)-2-(2-pyridyl)quinoline AIDS-002801 AIDS002801 Quinoline deriv. Quinoline, 4-(2-methyl-1-piperidinyl)-2-(2-pyridinyl)-

pdb file: 597268.pdb
sdf file: 597268.sdf
directory: 597268


133671-52-0 (HYDROBROMIDE) 4-(3-Methylpiperidino)-2-(2-pyridyl)quinoline AIDS-002802 AIDS002802 Quinoline deriv. Quinoline, 4-(3-methyl-1-piperidinyl)-2-(2-pyridinyl)-

pdb file: 597269.pdb
sdf file: 597269.sdf
directory: 597269


133671-53-1 (HYDROBROMIDE) 4-(4-Methylpiperidino)-2-(2-pyridyl)quinoline AIDS-002803 AIDS002803 Quinoline deriv.

pdb file: 597270.pdb
sdf file: 597270.sdf
directory: 597270


133698-98-3 4-Morpholino-2-(2-pyridyl)quinoline AIDS-002804 AIDS002804 Quinoline deriv. Quinoline, 4-(4-morpholinyl)-2-(2-pyridinyl)-

pdb file: 597271.pdb
sdf file: 597271.sdf
directory: 597271


133671-54-2 4-(-Thiomorpholino)-2-(2-pyridyl)quinoline AIDS-002805 AIDS002805 Quinoline deriv. Quinoline, 2-(2-pyridinyl)-4-(4-thiomorpholinyl)- Thiomorpholine

pdb file: 597272.pdb
sdf file: 597272.sdf
directory: 597272


1,2-Ethanediamine, N,N-dimethyl-N'-[2-(2-pyridinyl)-4-quinolinyl]- 133671-55-3 (DIHYDROBROMIDE) AIDS-002806 AIDS002806 N-[2-(Dimethylamino)ethyl]-2-(2-pyridyl)quinolin-4-amine Quinolin-4-amine deriv.

pdb file: 597273.pdb
sdf file: 597273.sdf
directory: 597273


1,2-Ethanediamine, N-ethyl-N',N'-dimethyl-N-[2-(2-pyridinyl)-4-quinolinyl]- 133671-56-4 (DIHYDROBROMIDE) AIDS-002807 AIDS002807 N-[2-(Dimethylamino)ethyl]-N-ethyl-2-(2-pyridyl)-quinolin-4-amine Quinolin-4-amine deriv.

pdb file: 597274.pdb
sdf file: 597274.sdf
directory: 597274


133671-57-5 (DIHYDROBROMIDE) 4-(4-Methylpiperazino)-2-(2-pyridyl)quinoline AIDS-002808 AIDS002808 Quinoline deriv. Quinoline, 4-(4-methyl-1-piperazinyl)-2-(2-pyridinyl)-, dihydrobromide

pdb file: 597275.pdb
sdf file: 597275.sdf
directory: 597275


133671-58-6 4-Pyrrolidino-2-(3-pyridyl)quinoline AIDS-002809 AIDS002809 Quinoline deriv. Quinoline, 2-(3-pyridinyl)-4-(1-pyrrolidinyl)-

pdb file: 597276.pdb
sdf file: 597276.sdf
directory: 597276


133671-59-7 4-Piperidino-2-(3-pyridyl)quinoline AIDS-002810 AIDS002810 Quinoline deriv. Quinoline, 4-(1-piperidinyl)-2-(3-pyridinyl)-

pdb file: 597277.pdb
sdf file: 597277.sdf
directory: 597277


133671-60-0 (TRIHYDROBROMIDE) AIDS-002811 AIDS002811 N-[2-(Dimethylamino)ethyl]-2-(3-pyridyl)quinolin-4-amine Quinolin-4-amine deriv.

pdb file: 597278.pdb
sdf file: 597278.sdf
directory: 597278


1,2-Ethanediamine, N-ethyl-N',N'-dimethyl-N-[2-(3-pyridinyl)-4-quinolinyl]- 133671-61-1 (TRIHYDROBROMIDE) AIDS-002812 AIDS002812 N-[2-(Dimethylamino)ethyl]-N-ethyl-2-(3-pyridyl)quinolin-4-amine Quinolin-4-amine deriv.

pdb file: 597279.pdb
sdf file: 597279.sdf
directory: 597279


133671-62-2 4-(4-Methylpiperazino)-2-(3-pyridyl)quinoline AIDS-002813 AIDS002813 Quinoline deriv. Quinoline, 4-(4-methyl-1-piperazinyl)-2-(3-pyridinyl)-

pdb file: 597280.pdb
sdf file: 597280.sdf
directory: 597280


1,2-Ethanediamine, N,N-dimethyl-N'-[2-(4-pyridinyl)-4-quinolinyl]- 133671-63-3 AIDS-002814 AIDS002814 N-[2-(Dimethylamino)ethyl]-2-(4-pyridyl)quinolin-4-amine Quinolin-4-amine deriv.

pdb file: 597281.pdb
sdf file: 597281.sdf
directory: 597281


1,2-Ethanediamine, N-ethyl-N',N'-dimethyl-N-[2-(4-pyridinyl)-4-quinolinyl]- 133671-64-4 (TRIHYDROBROMIDE) AIDS-002815 AIDS002815 N-[2-(Dimethylamino)ethyl]-N-ethyl-2-(4-pyridyl)quinolin-4-amine Quinolin-4-amine deriv.

pdb file: 597282.pdb
sdf file: 597282.sdf
directory: 597282


133671-65-5 (DIHYDROBROMIDE) 4-(4-Methylpiperazino)-2-(4-pyridyl)quinoline AIDS-002816 AIDS002816 Quinoline deriv. Quinoline, 4-(4-methyl-1-piperazinyl)-2-(4-pyridinyl)-, dihydrobromide

pdb file: 597283.pdb
sdf file: 597283.sdf
directory: 597283


1,2-Ethanediamine, N'-[2-(2-furanyl)-4-quinolinyl]-N,N-dimethyl- 133671-66-6 AIDS-002817 AIDS002817 N-[2-(Dimethylamino)ethyl]-2-(2-furanyl)-4-quinolinamine Quinolinamine deriv.

pdb file: 597284.pdb
sdf file: 597284.sdf
directory: 597284


133671-67-7 (DIHYDROBROMIDE) 4-(4-Methylpiperazino)-2-(2-furanyl)quinoline AIDS-002818 AIDS002818 Quinoline deriv. Quinoline, 2-(2-furanyl)-4-(4-methyl-1-piperazinyl)-

pdb file: 597285.pdb
sdf file: 597285.sdf
directory: 597285


1,2-Ethanediamine, N,N-dimethyl-N'-[2-(2-thienyl)-4-quinolinyl]- 133671-68-8 AIDS-002819 AIDS002819 N-[2-(Dimethylamino)ethyl]-2-(2-thienyl)quinolin-4-amine Quinolin-4-amine deriv.

pdb file: 597286.pdb
sdf file: 597286.sdf
directory: 597286


1,2-Ethanediamine, N-ethyl-N',N'-dimethyl-N-[2-(2-thienyl)-4-quinolinyl]- 133671-69-9 (DIHYDROBROMIDE) AIDS-002820 AIDS002820 N-[2-(Dimethylamino)ethyl]-N-ethyl-2-(2-thienyl)-quinolin-4-amine Quinolin-4-amine deriv.

pdb file: 597287.pdb
sdf file: 597287.sdf
directory: 597287


133671-70-2 (DIHYDROBROMIDE) 4-(4-Methylpiperazino)-2-(2-thienyl)quinoline AIDS-002821 AIDS002821 Quinoline deriv. Quinoline, 4-(4-methyl-1-piperazinyl)-2-(2-thienyl)-

pdb file: 597288.pdb
sdf file: 597288.sdf
directory: 597288


2-Phenyl-4-aminoquinoline 2-Phenyl-4-quinolinamine 2-Phenylquinolin-4-amine 4-Quinolinamine, 2-phenyl- 5855-52-7 AIDS-002822 AIDS002822 Quinolin-4-amine deriv. Quinoline, 4-amino-2-phenyl-

pdb file: 597289.pdb
sdf file: 597289.sdf
directory: 597289


122664-09-9 2-(2-Pyridyl)-quinolin-4-amine 4-Amino-2-(2-pyridyl)quinoline 4-Quinolinamine, 2-(2-pyridinyl)- AIDS-002823 AIDS002823 Quinolin-4-amine deriv.

pdb file: 597290.pdb
sdf file: 597290.sdf
directory: 597290


133671-74-6 2-(3-Pyridyl)quinolin-4-amine 4-Quinolinamine, 2-(3-pyridinyl)- AIDS-002824 AIDS002824 Quinolin-4-amine deriv.

pdb file: 597291.pdb
sdf file: 597291.sdf
directory: 597291


122664-10-2 2-(2-Thienyl)quinolin-4-amine 4-Quinolinamine, 2-(2-thienyl)- AIDS-002825 AIDS002825 Quinolin-4-amine deriv.

pdb file: 597292.pdb
sdf file: 597292.sdf
directory: 597292


1-MeOEtOMe-6PhS T 1-[(2-Methoxyethoxy)methyl]-6-(phenylthio)thymine 132774-35-7 AIDS-002851 AIDS002851 HEPT deriv.

pdb file: 597318.pdb
sdf file: 597318.sdf
directory: 597318


1-BzOEtOMe-6PhS T 1-[[(2-Benzyloxy)ethoxy]methyl]-6-(phenylthio)thymine 132774-36-8 AIDS-002852 AIDS002852 HEPT deriv.

pdb file: 597319.pdb
sdf file: 597319.sdf
directory: 597319


1-[(2-Fluoroethoxy)methyl]-6-(phenylthio)thymine 132774-40-4 2,4(1H,3H)-Pyrimidinedione, 1-[(2-fluoroethoxy)methyl]-5-methyl-6-(phenylthio)- AIDS-002853 AIDS002853 HEPT deriv.

pdb file: 597320.pdb
sdf file: 597320.sdf
directory: 597320


1-[(2-Chloroethoxy)methyl]-6-(phenylthio)thymine 132774-41-5 2,4(1H,3H)-Pyrimidinedione, 1-[(2-chloroethoxy)methyl]-5-methyl-6-(phenylthio)- AIDS-002854 AIDS002854 HEPT deriv.

pdb file: 597321.pdb
sdf file: 597321.sdf
directory: 597321


1-[(2-Azidoethoxy)methyl]-6-(phenylthio)thymine 132774-42-6 2,4(1H,3H)-Pyrimidinedione, 1-[(2-azidoethoxy)methyl]-5-methyl-6-(phenylthio)- AIDS-002855 AIDS002855 HEPT deriv.

pdb file: 597322.pdb
sdf file: 597322.sdf
directory: 597322


133697-35-5 2',3'-Dideoxy-5'-O-(4-methylbenzoyl)-5-hydroxymethyluridine 2',3'-Dideoxyuridine deriv. AIDS-002856 AIDS002856 Benzoic acid, 4-methyl-, [5-[3,6-dihydro-5-(hydroxymethyl)-2,6-dioxo-1(2H)-pyrimidinyl]tetrahydro-2-furanyl]methyl ester, (2S-cis)-

pdb file: 597323.pdb
sdf file: 597323.sdf
directory: 597323


133697-36-6 2',3'-Dideoxy-5'-O-(4-methylbenzoyl)-5-methoxymethyluridine 2',3'-Dideoxyuridine deriv. AIDS-002857 AIDS002857 Benzoic acid, 4-methyl-, [5-[3,6-dihydro-5-(methoxymethyl)-2,6-dioxo-1(2H)-pyrimidinyl]tetrahydro-2-furanyl]methyl ester, (2S-cis)-

pdb file: 597324.pdb
sdf file: 597324.sdf
directory: 597324


133635-57-1 2',3'-Dideoxy-5'-O-(4-methylbenzoyl)-5-((2-butoxy)methyl)uridine 2',3'-Dideoxyuridine deriv. AIDS-002858 AIDS002858 Benzoic acid, 4-methyl-, [5-[3,4-dihydro-5-[(1-methylpropoxy)methyl]-2,4-dioxo-1(2H)-pyrimidinyl]tetrahydro-2-furanyl]methyl ester

pdb file: 597325.pdb
sdf file: 597325.sdf
directory: 597325


133635-58-2 (2S-TRANS) 133697-40-2 2',3'-Dideoxy-5'-O-(4-methylbenzoyl)-5-pentyloxymethyluridine 2',3'-Dideoxyuridine deriv. AIDS-002859 AIDS002859 Thymidine, 3'-deoxy-.alpha.-(pentyloxy)-, 5'-(4-methylbenzoate)

pdb file: 597326.pdb
sdf file: 597326.sdf
directory: 597326


133635-59-3 (2S-TRANS) 133698-20-1 (UNSPECIFIED) 2',3'-Dideoxyuridine deriv. 5-Benzyloxymethyl-2',3'-dideoxy-5-O-(4-methylbenzoyl)uridine AIDS-002860 AIDS002860 Thymidine, 3'-deoxy-.alpha.-(phenylmethoxy)-, 5'-(4-methylbenzoate)

pdb file: 597327.pdb
sdf file: 597327.sdf
directory: 597327


132820-97-4 133697-41-3 (2S-TRANS) 2',3'-Dideoxy-5-hydroxymethyluridine 2',3'-Dideoxyuridine deriv. AIDS-002861 AIDS002861 Thymidine, 3'-deoxy-.alpha.-hydroxy-

pdb file: 597328.pdb
sdf file: 597328.sdf
directory: 597328


133697-42-4 2',3'-Dideoxy-5-methoxymethyluridine 2',3'-Dideoxyuridine deriv. AIDS-002862 AIDS002862 NSC655543 Thymidine, 3'-deoxy-.alpha.-methoxy-

pdb file: 597329.pdb
sdf file: 597329.sdf
directory: 597329


133635-61-7 2',3'-Dideoxy-5-(1-methylpropoxymethyl)uridine 2',3'-Dideoxyuridine deriv. 2,4(1H,3H)-Pyrimidinedione, 5-[(1-methylpropoxy)methyl]-1-[tetrahydro-5-(hydroxymethyl)-2-furanyl]- AIDS-002863 AIDS002863

pdb file: 597330.pdb
sdf file: 597330.sdf
directory: 597330


133635-62-8 (2S-TRANS) 133697-43-5 2',3'-Dideoxy-5-pentyloxymethyluridine 2',3'-Dideoxyuridine deriv. AIDS-002864 AIDS002864 Thymidine, 3'-deoxy-.alpha.-(pentyloxy)-

pdb file: 597331.pdb
sdf file: 597331.sdf
directory: 597331


133635-63-9 (2S-TRANS) 133697-44-6 2',3'-Dideoxyuridine deriv. 5-Benzyloxymethyl-2',3'-dideoxyuridine AIDS-002865 AIDS002865 Thymidine, 3'-deoxy-.alpha.-(phenylmethoxy)-

pdb file: 597332.pdb
sdf file: 597332.sdf
directory: 597332


133635-68-4 (2S-TRANS) 133697-48-0 2',3'-Dideoxy-5-O-(4-methylbenzoyl)-5-methoxymethylcytidine 2',3'-Dideoxycytidine deriv. AIDS-002866 AIDS002866 Cytidine, 2',3'-dideoxy-5-(methoxymethyl)-, 5'-(4-methylbenzoate)

pdb file: 597333.pdb
sdf file: 597333.sdf
directory: 597333


133635-70-8 (2S-TRANS) 133697-49-1 2',3'-Dideoxy-5-O-(4-methylbenzoyl)-5-pentyloxymethylcytidine 2',3'-Dideoxycytidine deriv. AIDS-002867 AIDS002867 Cytidine, 2',3'-dideoxy-5-[(pentyloxy)methyl]-, 5'-(4-methylbenzoate)

pdb file: 597334.pdb
sdf file: 597334.sdf
directory: 597334


133635-71-9 (2S-TRANS) 133697-50-4 2',3'-Dideoxycytidine deriv. 5-Benzyloxymethyl-1-(2',3'-dideoxy-5-O-(4-methylbenzoyl)cytidine AIDS-002868 AIDS002868 Cytidine, 2',3'-dideoxy-5-[(phenylmethoxy)methyl]-, 5'-(4-methylbenzoate)

pdb file: 597335.pdb
sdf file: 597335.sdf
directory: 597335


133635-72-0 (2S-TRANS 133697-51-5 2',3'-Dideoxy-5-methoxymethylcytidine 2',3'-Dideoxycytidine deriv. AIDS-002869 AIDS002869 Cytidine, 2',3'-dideoxy-5-(methoxymethyl)-

pdb file: 597336.pdb
sdf file: 597336.sdf
directory: 597336


133635-73-1 2',3'-Dideoxy-5-(1-methylpropoxymethyl)cytidine 2',3'-Dideoxycytidine deriv. 2(1H)-Pyrimidinone, 4-amino-5-[(1-methylpropoxy)methyl]-1-[tetrahydro-5-(hydroxymethyl)-2-furanyl]- AIDS-002870 AIDS002870

pdb file: 597337.pdb
sdf file: 597337.sdf
directory: 597337


133635-74-2 (2S-TRANS) 133697-52-6 2',3'-Dideoxy-5-pentyloxymethylcytidine 2',3'-Dideoxycytidine deriv. AIDS-002871 AIDS002871 Cytidine, 2',3'-dideoxy-5-[(pentyloxy)methyl]-

pdb file: 597338.pdb
sdf file: 597338.sdf
directory: 597338


133635-75-3 (2S-TRANS) 133697-53-7 2',3'-Dideoxycytidine deriv. 5-Benzyloxymethyl-2',3'-dideoxycytidine AIDS-002872 AIDS002872 Cytidine, 2',3'-dideoxy-5-[(phenylmethoxy)methyl]-

pdb file: 597339.pdb
sdf file: 597339.sdf
directory: 597339


2-Demethylthiocolchicine 87424-26-8 AIDS-002898 AIDS002898 Acetamide, N-[(7S)-5,6,7,9-tetrahydro-2-hydroxy-1,3-dimethoxy-10-(methylthio)-9-oxobenzo[a]heptalen-7-yl]- Benzo[a]heptalene, acetamide deriv. Thiocolchicine analog

pdb file: 597362.pdb
sdf file: 597362.sdf
directory: 597362


10-Dimethylamino-10-demethoxycolchicine 2731-13-7 AIDS-002900 AIDS002900 Acetamide, N-[(7S)-10-(dimethylamino)-5,6,7,9-tetrahydro-1,2,3-trimethoxy-9-oxobenzo[a]heptalen-7-yl]- Benzo[a]heptalene, acetamide deriv. Colchiceinamide, N,N-dimethyl- Colchicine analog

pdb file: 597364.pdb
sdf file: 597364.sdf
directory: 597364


134568-33-5 2-Propenamide, N-(5,6,7,9-tetrahydro-1,2,3,10-tetramethoxy-9-oxobenzo[a]heptalen-7-yl)-3-(3,4,5-trimethoxyphenyl)-, (S)- AIDS-002904 AIDS002904 Benzo[a]heptalene, 2-propenamide deriv. Colchicine analog N-(3,4,5-Trimethoxycinnamoyl)-N-deacetylcolchicine

pdb file: 597368.pdb
sdf file: 597368.sdf
directory: 597368


2-Propenamide, 3-(4-hydroxy-3,5-dimethoxyphenyl)-N-(5,6,7,9-tetrahydro-1,2,3,10-tetramethoxy-9-oxobenzo[a]heptalen-7-yl)-, (S)- 86436-49-9 AIDS-002905 AIDS002905 Benzo[a]heptalene, 2-propenamide deriv. Colchicine analog N-Inapinoyl-N-deacetylcolchicine

pdb file: 597369.pdb
sdf file: 597369.sdf
directory: 597369


134568-34-6 2-Propenamide, 3-(3,4-dihydroxyphenyl)-N-(5,6,7,9-tetrahydro-1,2,3,10-tetramethoxy-9-oxobenzo[a]heptalen-7-yl)-, (S)- AIDS-002906 AIDS002906 Benzo[a]heptalene, 2-propenamide deriv. Colchicine analog N-Caffeoyl-N-deacetylcolchicine

pdb file: 597370.pdb
sdf file: 597370.sdf
directory: 597370


71324-48-6 AIDS-002909 AIDS002909 Acetamide, 2,2,2-trifluoro-N-(5,6,7,10-tetrahydro-1,2,3,9-tetramethoxy-10-oxobenzo[a]heptalen-7-yl)-, (S)- Benzo[a]heptalene, acetamide deriv. Isocolchicine analog N-Trifluoroacetyl-N-deacetylisocolchicine

pdb file: 597373.pdb
sdf file: 597373.sdf
directory: 597373


134568-36-8 AIDS-002910 AIDS002910 Acetamide, 2,2,2-trifluoro-N-(5,6,7,10-tetrahydro-1,2,3,9-tetrahydroxy-10-oxobenzo[a]heptalen-7-yl)-, (S)- Benzo[a]heptalene, acetamide deriv. Isocolchiceine analog N-Trifluoroacetyl-N-deacetyl-1,2,3-demethylisocolchiceine

pdb file: 597374.pdb
sdf file: 597374.sdf
directory: 597374


136105-77-6 6-[(3,5-Dimethylphenyl)thio]-5-ethyl-1-[(2-hydroxyethoxy)methyl]uracil AIDS-002912 AIDS002912 E-HEPU-dM HEPT deriv.

pdb file: 597376.pdb
sdf file: 597376.sdf
directory: 597376


1-EtOMe-6XylylS-5Et U 136011-44-4 5-Ethyl-1-ethoxymethyl-6-(3,5-dimethylphenylthio)uracil AIDS-002913 AIDS002913 E-EPU-dM HEPT deriv.

pdb file: 597377.pdb
sdf file: 597377.sdf
directory: 597377


1-Benzyloxymethyl-5-ethyl-6-(3,5-dimethylphenylthio)uracil 1-BzOMe-6XylylS-5Et U 136105-76-5 AIDS-002914 AIDS002914 E-BPU-dM HEPT deriv.

pdb file: 597378.pdb
sdf file: 597378.sdf
directory: 597378


4(1H)-Pyrimidinone, 6-[(3,5-dimethylphenyl)thio]-5-ethyl-2,3-dihydro-1-[(2-hydroxyethoxy)methyl]-2-thioxo- 5-Et-3',5'-DiMeHEPT-S 6-[(3,5-Dimethylphenyl)thio]-5-ethyl-1-[(2-hydroxyethoxy)methyl]-2-thiouracil AIDS-002915 AIDS002915 E-HEPU-SdM HEPT deriv.

pdb file: 597379.pdb
sdf file: 597379.sdf
directory: 597379


1-EtOMe-6XylylS-5Et2thio U 136011-45-5 5-Ethyl-1-ethoxymethyl-6-(3,5-dimethylphenylthio)-2-thiouracil AIDS-002916 AIDS002916 E-EPU-SdM HEPT deriv.

pdb file: 597380.pdb
sdf file: 597380.sdf
directory: 597380


1-Benzyloxymethyl-5-ethyl-6-(3,5-dimethylphenylthio)-2-thiouracil 1-BzOMe-6XylylS-6Et2thio U 136105-78-7 AIDS-002917 AIDS002917 E-BPU-SdM HEPT deriv.

pdb file: 597381.pdb
sdf file: 597381.sdf
directory: 597381


136160-30-0 2,4(1H,3H)-Pyrimidinedione, 6-[(3,5-dimethylphenyl)methyl]-1-(ethoxymethyl)-5-ethyl- 5-Ethyl-1-ethoxymethyl-6-(3,5-dimethylbenzyl)uracil AIDS-002919 AIDS002919 E-EBU-dM HEPT deriv.

pdb file: 597383.pdb
sdf file: 597383.sdf
directory: 597383


6620-00-4 AIDS-002924 AIDS002924 Diterpene deriv. Kaur-16-en-18-oic acid, 15-oxo-, (4a)- NSC692948 ent-15-Oxo-kaur-16-en-19-oic acid

pdb file: 597388.pdb
sdf file: 597388.sdf
directory: 597388


70324-42-4 AIDS-002925 AIDS002925 Diterpene deriv. Kaur-16-en-18-oic acid, 11-hydroxy-15-oxo-, methyl ester, (4a,11b)- ent-11S-Hydroxy-15-oxokaur-16-en-19-oic acid methyl ester

pdb file: 597389.pdb
sdf file: 597389.sdf
directory: 597389


22376-47-2 AIDS-002926 AIDS002926 Diterpene deriv. Kaur-16-en-18-oic acid, 15-oxo-, methyl ester, (4a)- ent-15-Oxo-kaur-16-en-19-oic acid methyl ester

pdb file: 597390.pdb
sdf file: 597390.sdf
directory: 597390


(6-(Hydroxymethyl)-1,4-oxathian-2-yl)-guanine 1,4-Oxathiane, 6H-purin-6-one deriv. 132062-74-9 6-OHMe-1,4-OXTh-G 6H-Purin-6-one, 2-amino-1,9-dihydro-9-[6-(hydroxymethyl)-1,4-oxathian-2-yl]-, (2R-cis)- AIDS-002950 AIDS002950

pdb file: 597414.pdb
sdf file: 597414.sdf
directory: 597414


142629-85-4 3'-Azido-3'-deoxy-5'-(O,O-diphenyl)phosphate thymidine 5'-Thymidylic acid, 3'-azido-3'-deoxy-, diphenyl ester AIDS-002959 AIDS002959 AZT deriv.

pdb file: 597423.pdb
sdf file: 597423.sdf
directory: 597423


1,6-Dioxaspiro[4.5]decane, monensin deriv. 129297-22-9 4-[2-(5-{5-[5-((1R)-1-Hydroxypropyl)(2S,3S,5S)-2-hydroxy-3,5-dimethyloxolan-2-yl](3S)-3-methyloxolan-2-yl}(5S)-5-methyloxolan-2-yl)(5R,8R,9R,10R)-9-methoxy-8,10-dimethyl-1,6-dioxaspiro[4.5]dec-7-yl](2S,4S,3R)-3-methoxy-2-methylpentanoic acid AIDS-002969 AIDS002969 Kijimicin Monensin, 21,25-deepoxy-16-deethyl-25-de(hydroxymethyl)-12-demethyl-21,24-epoxy-25-ethyl-21-hydroxy-8,16-dimethyl-7-O-methyl-, (8R)-

pdb file: 597431.pdb
sdf file: 597431.sdf
directory: 597431


135525-65-4 1H-Isoindole-1,3(2H)-dione, 2-[[(5-ethyl-1,2-dihydro-6-methyl-2-oxo-3-pyridinyl)amino]methyl]- 3-[(2-Phthalimidomethyl)amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-002976 AIDS002976 L 345516 L-345,516 Pyridinone deriv.

pdb file: 597438.pdb
sdf file: 597438.sdf
directory: 597438


135525-66-5 1H-Isoindole-1,3(2H)-dione, 2-(2-(5-ethyl-1,2-dihydro-6-methyl-2-oxo-3-pyridinyl)ethyl)- 2-Pyridinone deriv. 5-Ethyl-6-methyl-3-[(2-phthalimido)ethyl]-2-pyridinone AIDS-002977 AIDS002977 L 693593 L-693,593

pdb file: 597439.pdb
sdf file: 597439.sdf
directory: 597439


135525-70-1 2(1H)-Pyridinone, 3-[(2-benzoxazolylmethyl)amino]-5-ethyl-6-methyl- 3-[(2-Benzoxazolylmethyl)amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-002978 AIDS002978 L-696,040 Pyridinone deriv.

pdb file: 597440.pdb
sdf file: 597440.sdf
directory: 597440


135525-77-8 3-[(4,7-Dimethyl-2-benzoxazolylmethyl)amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-002979 AIDS002979 L-697,639 Pyridinone deriv.

pdb file: 597441.pdb
sdf file: 597441.sdf
directory: 597441


142629-84-3 3'-Azido-3'-deoxythymidine 5'-bis(4-nitrophenyl)phosphate 5'-Thymidylic acid, 3'-azido-3'-deoxy-, bis(4-nitrophenyl) ester AIDS-002992 AIDS002992 AZT deriv.

pdb file: 597453.pdb
sdf file: 597453.sdf
directory: 597453


142629-81-0 3'-Azidothymidine-5'-[phenyl-(methyl,-L-alaninyl)]phosphoramidate AIDS-002993 AIDS002993 AZT deriv. L-Alanine, N-(3'-azido-3'-deoxy-P-phenyl-5'-thymidylyl)-, methyl ester So221

pdb file: 597454.pdb
sdf file: 597454.sdf
directory: 597454


130829-12-8 3'-Azido-2',3'-dideoxy-5'-[trichloroethyl (methyl,L-alaninyl)] phosphoramidate AIDS-002994 AIDS002994 AZT deriv. L-Alanine, N-[3'-azido-3'-deoxy-P-(2,2,2-trichloroethyl)-5'-thymidylyl]-, methyl ester

pdb file: 597455.pdb
sdf file: 597455.sdf
directory: 597455


151725-76-7 4'-Fluoro-5'-iodo-O2',O3'-(dimethylmethylene)adenosine isomer 9H-Purin-6-amine, 9-[5-deoxy-4-C-fluoro-5-iodo-2,3-O-(1-methylethylidene)-.alpha.-L-lyxofuranosyl]- AIDS-002998 AIDS002998 Nucleocidin derivative

pdb file: 597459.pdb
sdf file: 597459.sdf
directory: 597459


151725-74-5 4'-Fluoro-5'-iodo-O2',O3'-(dimethylmethylene)adenosine isomer AIDS-002999 AIDS002999 Adenosine, 5'-deoxy-4'-C-fluoro-5'-iodo-2',3'-O-(1-methylethylidene)- Nucleocidin derivative

pdb file: 597460.pdb
sdf file: 597460.sdf
directory: 597460


.alpha.- Cyclohexadextrin hexasulfate .alpha.-Cyclodextrin, hexakis(hydrogen sulfate) 135514-70-4 2,4,7,9,12,14,17,19,22,24,27,29-Dodecaoxaheptacyclo[26.2.2.23,6.28,11.213,16.218,21.223,26]dotetracontane, a-cyclodextrin deriv. AIDS-003010 AIDS003010 a.-C6(D)-6(SO2OH)

pdb file: 597470.pdb
sdf file: 597470.sdf
directory: 597470


.alpha.- Cyclohexadextrin dodecasulfate .alpha.-Cyclodextrin, dodecakis(hydrogen sulfate) 120825-95-8 2,4,7,9,12,14,17,19,22,24,27,29-Dodecaoxaheptacyclo[26.2.2.23,6.28,11.213,16.218,21.223,26]dotetracontane, a-cyclodextrin deriv. AIDS-003013 AIDS003013 a.-C6(D)-12(SO2OH)

pdb file: 597473.pdb
sdf file: 597473.sdf
directory: 597473


.b.-C7(D)-14(SO2OH) .beta.-Cyclodextrin, tetradecakis(hydrogen sulfate) .beta.-Cycloheptadextrin tetradecasulfate 121369-51-5 2,4,7,9,12,14,17,19,22,24,27,29,32,34-Tetradecaoxaoctacyclo[31.2.2.23,6.28,11.213,16.218,21.223,26.228,31]nonatetracontane, b-cyclodextrin deriv. AIDS-003014 AIDS003014 b-Cyclodextrin tetradecasulfate

pdb file: 597474.pdb
sdf file: 597474.sdf
directory: 597474


.g.-C8(D)-16(SO2OH) .gamma.- Cyclooctadextrin hexadecasulfate .gamma.-Cyclodextrin, hexadecakis(hydrogen sulfate) 120825-96-9 2,4,7,9,12,14,17,19,22,24,27,29,32,34,37,39-Hexadecaoxanonacyclo[36.2.2.23,6.28,11.213,16.218,21.223,26.228,31.233,36]hexapentacontane, g-cyclodextrin deriv. AIDS-003015 AIDS003015

pdb file: 597475.pdb
sdf file: 597475.sdf
directory: 597475


2255-54-1 8-Acetoxydictamnine AIDS-003032 AIDS003032 Acetylrobustine Furo[2,3-b]quinolin-8-ol, 4-methoxy-, acetate (ester) Furoquinoline deriv. Robustine, acetate

pdb file: 597492.pdb
sdf file: 597492.sdf
directory: 597492


59442-99-8 AIDS-003033 AIDS003033 Furo[2,3,-b]quinolin-7-ol, 4,6-dimethoxy- Furoquinoline deriv. Heliparvifoline

pdb file: 597493.pdb
sdf file: 597493.sdf
directory: 597493


136088-27-2 AIDS-003064 AIDS003064 Cholestane, deoxyribonucleic acid deriv. Cholesteryl oligonucleotide Cholesteryl oligonucleotide(pTGGCGTACTCACCAGTCGCCGC) DNA, d(T-G-G-C-G-T-A-C-T-C-A-C-C-A-G-T-C-G-C-C-G-C), 5'-[(3.bETA.)-cholest-5-en-3-yl hydrogen phosphate]

pdb file: 597523.pdb
sdf file: 597523.sdf
directory: 597523


5-(4-Fluorophenyl)-6-(4-pyridyl)-2,3-dihydroimidazo(2,1-b)-thiazole 72873-75-7 AIDS-003069 AIDS003069 Imidazo[2,1-b]thiazole, 5-(4-fluorophenyl)-2,3-dihydro-6-(4-pyridinyl)- Thiazole deriv.

pdb file: 597528.pdb
sdf file: 597528.sdf
directory: 597528


5-(4-Pyridyl)-6-(4-fluorophenyl)-2,3-dihydroimidazo(2,1-b)-thiazole 72873-74-6 AIDS-003070 AIDS003070 Imidazo[2,1-b]thiazole, 6-(4-fluorophenyl)-2,3-dihydro-5-(4-pyridinyl)- Thiazole deriv.

pdb file: 597529.pdb
sdf file: 597529.sdf
directory: 597529


111908-94-2 2-(4-Fluorophenyl)-3-(4-pyridyl)-6,7-dihydro-[5H]-pyrrolo[1,2-a]imidazole 5H-Pyrrolo[1,2-a]imidazole, 2-(4-fluorophenyl)-6,7-dihydro-3-(4-pyridinyl)-2-(4-Fluorophenyl)-3-(4-pyridyl)-6,7-dihydro-[5H]-pyrrolo[1,2-a]imidazole AIDS-003071 AIDS003071 Imidazole deriv. SKF 104351

pdb file: 597530.pdb
sdf file: 597530.sdf
directory: 597530


1-[3-(Ethylamino)pyridin-2-yl]-4-[(indol-2-yl)carbonyl]piperazine 136816-72-3 AIDS-003075 AIDS003075 BHAP indole pyridine deriv. Piperazine, 1-[3-(ethylamino)-2-pyridinyl]-4-(1H-indol-2-ylcarbonyl)- U-85961

pdb file: 597533.pdb
sdf file: 597533.sdf
directory: 597533


1-(Indolyl-2-carbonyl)-4-[3-[(1-methylethyl)amino]pyridyl]piperazine 136816-76-7 (FREE BASE) 148692-46-0 (MESYLATE SALT) AIDS-003077 AIDS003077 BHAP deriv. U 88204 U-88204 U-88204E

pdb file: 597535.pdb
sdf file: 597535.sdf
directory: 597535


1-[(5-Fluoroindol-2yl)carbonyl]-4-[3-[(1-methylethyl)amino]-2-pyridyl]piperazine 136816-84-7 AIDS-003078 AIDS003078 BHAP indolyl pyridyl deriv. Piperazine, 1-[(5-fluoro-1H-indol-2-yl)carbonyl]-4-[3-[(1-methylethyl)amino]-2-pyridinyl]- U-88352

pdb file: 597536.pdb
sdf file: 597536.sdf
directory: 597536


1-[(5-Methoxyindol-2yl)carbonyl]-4-[3-[(1-methylethyl)amino]-2-pyridyl]piperazine 136816-75-6 AIDS-003079 AIDS003079 Atevirdine BHAP indolyl pyridyl deriv. U-88353

pdb file: 597537.pdb
sdf file: 597537.sdf
directory: 597537


136994-82-6 1H,3H-Thiazolo[3,4-a]benzimidazole, 1-(2-bromophenyl)- AIDS-003080 AIDS003080 Benzimidazole derivative

pdb file: 597538.pdb
sdf file: 597538.sdf
directory: 597538


136994-83-7 1H,3H-Thiazolo[3,4-a]benzimidazole, 1-(3-bromophenyl)- AIDS-003081 AIDS003081 Benzimidazole derivative

pdb file: 597539.pdb
sdf file: 597539.sdf
directory: 597539


136994-84-8 1H,3H-Thiazolo[3,4-a]benzimidazole, 1-(4-bromophenyl)- AIDS-003082 AIDS003082 Benzimidazole derivative

pdb file: 597540.pdb
sdf file: 597540.sdf
directory: 597540


136994-85-9 1H,3H-Thiazolo[3,4-a]benzimidazole, 1-(2-chlorophenyl)- AIDS-003083 AIDS003083 Benzimidazole derivative

pdb file: 597541.pdb
sdf file: 597541.sdf
directory: 597541


136994-86-0 1H,3H-Thiazolo[3,4-a]benzimidazole, 1-(3-chlorophenyl)- AIDS-003084 AIDS003084 Benzimidazole derivative

pdb file: 597542.pdb
sdf file: 597542.sdf
directory: 597542


136994-87-1 1H,3H-Thiazolo[3,4-a]benzimidazole, 1-(4-chlorophenyl)- AIDS-003085 AIDS003085 Benzimidazole derivative

pdb file: 597543.pdb
sdf file: 597543.sdf
directory: 597543


1-(3-Cyanophenyl)-1H,3H-thiazolo[3,4-a]benzimidazole 137015-79-3 AIDS-003086 AIDS003086 Benzimidazole derivative Benzonitrile, 3-(1H,3H-thiazolo[3,4-a]benzimidazol-1-yl)-

pdb file: 597544.pdb
sdf file: 597544.sdf
directory: 597544


1-(4-Cyanophenyl)-1H,3H-thiazolo[3,4-a]benzimidazole 136994-88-2 AIDS-003087 AIDS003087 Benzimidazole derivative Benzonitrile, 4-(1H,3H-thiazolo[3,4-a]benzimidazol-1-yl)-

pdb file: 597545.pdb
sdf file: 597545.sdf
directory: 597545


136994-89-3 153634-53-8 ([+]-ISOMER) 153634-54-9 ([-]-ISOMER.) 1H,3H-Thiazolo[3,4-a]benzimidazole, 1-(2-fluorophenyl)- AIDS-003088 AIDS003088 Benzimidazole derivative NSC626762

pdb file: 597546.pdb
sdf file: 597546.sdf
directory: 597546


136994-90-6 1H,3H-Thiazolo[3,4-a]benzimidazole, 1-(3-fluorophenyl)- AIDS-003089 AIDS003089 Benzimidazole derivative

pdb file: 597547.pdb
sdf file: 597547.sdf
directory: 597547


136994-91-7 1H,3H-Thiazolo[3,4-a]benzimidazole, 1-(4-fluorophenyl)- AIDS-003090 AIDS003090 Benzimidazole derivative

pdb file: 597548.pdb
sdf file: 597548.sdf
directory: 597548


1-(3-Hydroxyphenyl)-1H,3H-thiazolo[3,4-a]benzimidazole 136994-92-8 AIDS-003091 AIDS003091 Benzimidazole derivative Phenol, 3-(1H,3H-thiazolo[3,4-a]benzimidazol-1-yl)-

pdb file: 597549.pdb
sdf file: 597549.sdf
directory: 597549


136994-93-9 1H,3H-Thiazolo[3,4-a]benzimidazole, 1-(3-methoxyphenyl)- AIDS-003092 AIDS003092 Benzimidazole derivative Methyl 3-(3H-[1,3]thiazolo[3,4-a]benzimidazol-1-yl)phenyl ether NSC625479

pdb file: 597550.pdb
sdf file: 597550.sdf
directory: 597550


1H,3H-Thiazolo[3,4-a]benzimidazole, 1-(4-methoxyphenyl)- AIDS-003093 AIDS003093 Benzimidazole derivative Methyl 4-(3H-[1,3]thiazolo[3,4-a]benzimidazol-1-yl)phenyl ether NSC624053

pdb file: 597551.pdb
sdf file: 597551.sdf
directory: 597551


136994-95-1 1H,3H-Thiazolo[3,4-a]benzimidazole, 1-(2-methylphenyl)- AIDS-003094 AIDS003094 Benzimidazole derivative

pdb file: 597552.pdb
sdf file: 597552.sdf
directory: 597552


136994-96-2 1H,3H-Thiazolo[3,4-a]benzimidazole, 1-(3-methylphenyl)- AIDS-003095 AIDS003095 Benzimidazole derivative

pdb file: 597553.pdb
sdf file: 597553.sdf
directory: 597553


136994-97-3 1H,3H-Thiazolo[3,4-a]benzimidazole, 1-(2-nitrophenyl)- AIDS-003096 AIDS003096 Benzimidazole derivative

pdb file: 597554.pdb
sdf file: 597554.sdf
directory: 597554


136994-98-4 1H,3H-Thiazolo[3,4-a]benzimidazole, 1-(3-nitrophenyl)- AIDS-003097 AIDS003097 Benzimidazole derivative

pdb file: 597555.pdb
sdf file: 597555.sdf
directory: 597555


136994-99-5 1H,3H-Thiazolo[3,4-a]benzimidazole, 1-(4-nitrophenyl)- AIDS-003098 AIDS003098 Benzimidazole derivative

pdb file: 597556.pdb
sdf file: 597556.sdf
directory: 597556


136995-00-1 1H,3H-Thiazolo[3,4-a]benzimidazole, 1-[2-(trifluoromethyl)phenyl]- AIDS-003099 AIDS003099 Benzimidazole derivative

pdb file: 597557.pdb
sdf file: 597557.sdf
directory: 597557


136995-01-2 1H,3H-Thiazolo[3,4-a]benzimidazole, 1-[3-(trifluoromethyl)phenyl]- AIDS-003100 AIDS003100 Benzimidazole derivative

pdb file: 597558.pdb
sdf file: 597558.sdf
directory: 597558


136995-02-3 1H,3H-Thiazolo[3,4-a]benzimidazole, 1-[4-(trifluoromethyl)phenyl]- AIDS-003101 AIDS003101 Benzimidazole derivative

pdb file: 597559.pdb
sdf file: 597559.sdf
directory: 597559


136816-68-7 136819-00-6 (HYDROCHLORIDE) AIDS-003258 AIDS003258 N-[(3,5-Dimethyl-4-hydroxyphenyl)methyl]-N'-(3-ethylamino-2-pyridinyl)piperazine Phenol, 4-[[4-[3-(ethylamino)-2-pyridinyl]-1-piperazinyl]methyl]-2,6-dimethyl- Piperazine deriv.

pdb file: 597712.pdb
sdf file: 597712.sdf
directory: 597712


136817-30-6 AIDS-003264 AIDS003264 N-[(3-Methyl-2-indol)carbonyl]-N'-[(3-isopropylamino)-2-pyridinyl]piperazine Piperazine deriv. Piperazine, 1-[3-[(1-methylethyl)amino]-2-pyridinyl]-4-[(3-methyl-1H-indol-2-yl)carbonyl]-

pdb file: 597713.pdb
sdf file: 597713.sdf
directory: 597713


138863-11-3 AIDS-003265 AIDS003265 N-[(4-Methoxy-2-indol)carbonyl]-N'-[(3-isopropylamino)-2-pyridinyl]piperazine Piperazine deriv. Piperazine, 1-[(4-methoxy-1H-indol-2-yl)carbonyl]-4-[3-[(1-methylethyl)amino]-2-pyridinyl]-

pdb file: 597714.pdb
sdf file: 597714.sdf
directory: 597714


136817-51-1 AIDS-003266 AIDS003266 N-[(4-Methyl-2-indol)carbonyl]-N'-[(3-isopropylamino)-2-pyridinyl]piperazine Piperazine deriv. Piperazine, 1-[3-[(1-methylethyl)amino]-2-pyridinyl]-4-[(4-methyl-1H-indol-2-yl)carbonyl]-

pdb file: 597715.pdb
sdf file: 597715.sdf
directory: 597715


1-[3-(Isopropylamino)-2-pyridinyl]-4-[(5-hydroxyindol-2-yl)carbonyl]piperazine 136816-97-2 AIDS-003267 AIDS003267 Piperazine 1Pyrid 4Indolyl deriv. Piperazine, 1-[(5-hydroxy-1H-indol-2-yl)carbonyl]-4-[3-[(1-methylethyl)amino]-2-pyridinyl]-

pdb file: 597716.pdb
sdf file: 597716.sdf
directory: 597716


136817-43-1 AIDS-003268 AIDS003268 N-[5-Methyl-2-indolcarbonyl]-N'-[3-(isopropylamino)-2-pyridinyl]piperazine Piperazine deriv. Piperazine, 1-[3-[(1-methylethyl)amino]-2-pyridinyl]-4-[(5-methyl-1H-indol-2-yl)carbonyl]-

pdb file: 597717.pdb
sdf file: 597717.sdf
directory: 597717


136817-55-5 AIDS-003269 AIDS003269 N-[5-Amino-2-indolcarbonyl]-N'-[3-(isopropylamino)-2-pyridinyl]piperazine Piperazine deriv. Piperazine, 1-[(5-amino-1H-indol-2-yl)carbonyl]-4-[3-[(1-methylethyl)amino]-2-pyridinyl]-

pdb file: 597718.pdb
sdf file: 597718.sdf
directory: 597718


136817-58-8 AIDS-003270 AIDS003270 Acetamide, N-[2-[[4-[3-[(1-methylethyl)amino]-2-pyridinyl]-1-piperazinyl]carbonyl]-1H-indol-5-yl]- N-[5-(Acetylamino)-2-indolcarbonyl]-N'-[3-(isopropylamino)-2-pyridinyl]piperazine Piperazine deriv.

pdb file: 597719.pdb
sdf file: 597719.sdf
directory: 597719


AIDS-003271 AIDS003271 N-[5-Benzyloxy-2-indolcarbonyl]-N'-[3-(isopropylamino)-2-pyridinyl]piperazine Piperazine deriv.

pdb file: 597720.pdb
sdf file: 597720.sdf
directory: 597720


136817-42-0 AIDS-003272 AIDS003272 N-[6-Methoxy-2-indolcarbonyl]-N'-[3-(isopropylamino)-2-pyridinyl]piperazine Piperazine deriv. Piperazine, 1-[(6-methoxy-1H-indol-2-yl)carbonyl]-4-[3-[(1-methylethyl)amino]-2-pyridinyl]-

pdb file: 597721.pdb
sdf file: 597721.sdf
directory: 597721


136817-84-0 AIDS-003273 AIDS003273 N-[6-Fluoro-2-indolcarbonyl]-N'-[3-(isopropylamino)-2-pyridinyl]piperazine Piperazine deriv. Piperazine, 1-[(6-fluoro-1H-indol-2-yl)carbonyl]-4-[3-[(1-methylethyl)amino]-2-pyridinyl]-

pdb file: 597722.pdb
sdf file: 597722.sdf
directory: 597722


147920-10-3 AIDS-003274 AIDS003274 N-[6-Benzyloxy-2-indolcarbonyl]-N'-[3-(isopropylamino)-2-pyridinyl]piperazine Piperazine deriv. Piperazine, 1-[3-[(1-methylethyl)amino]-2-pyridinyl]-4-[[6-(phenylmethoxy)-1H-indol-2-yl]carbonyl]-

pdb file: 597723.pdb
sdf file: 597723.sdf
directory: 597723


1-(Indolyl-2-carbonyl)-4-(3-nitro-2-pyridyl)piperazine 136816-99-4 AIDS-003275 AIDS003275 BHAP indolyl pyridyl deriv. Piperazine, 1-(1H-indol-2-ylcarbonyl)-4-(3-nitro-2-pyridinyl)-

pdb file: 597724.pdb
sdf file: 597724.sdf
directory: 597724


1-(Indolyl-2-carbonyl)-4-(3-amino-2-pyridyl)piperazine 136818-09-2 AIDS-003276 AIDS003276 BHAP indolyl pyridyl deriv. Piperazine, 1-(3-amino-2-pyridinyl)-4-(1H-indol-2-ylcarbonyl)-

pdb file: 597725.pdb
sdf file: 597725.sdf
directory: 597725


153473-53-1 AIDS-003277 AIDS003277 Acetamide, N-[2-[4-(1H-indol-2-ylcarbonyl)-1-piperazinyl]-3-pyridinyl]- N-(2-Indolcarbonyl)-N'-[(3-acetylamino)-2-pyridinyl]piperazine Piperazine deriv.

pdb file: 597726.pdb
sdf file: 597726.sdf
directory: 597726


1-(Indolyl-2-carbonyl)-4-[3-(N-ethylacetamido)-2-pyridyl]piperazine 153473-54-2 AIDS-003278 AIDS003278 Acetamide, N-ethyl-N-[2-[4-(1H-indol-2-ylcarbonyl)-1-piperazinyl]-3-pyridinyl]- BHAP indolyl pyridyl deriv.

pdb file: 597727.pdb
sdf file: 597727.sdf
directory: 597727


1-(Indolyl-2-carbonyl)-4-[3-[(dimethylethyl)amino]-2-pyridyl]piperazine 136817-01-1 136819-06-2 (MONOHYDROCHLORIDE) AIDS-003279 AIDS003279 BHAP indolyl pyridyl deriv. Piperazine, 1-[3-[(1,1-dimethylethyl)amino]-2-pyridinyl]-4-(1H-indol-2-ylcarbonyl)-

pdb file: 597728.pdb
sdf file: 597728.sdf
directory: 597728


1-(Indolyl-2-carbonyl)-4-[(3-benzylamino)-2-pyridyl]piperazine 153473-56-4 AIDS-003280 AIDS003280 BHAP indolyl pyridyl deriv. Piperazine, 1-(1H-indol-2-ylcarbonyl)-4-[3-[(phenylmethyl)amino]-2-pyridinyl]-

pdb file: 597729.pdb
sdf file: 597729.sdf
directory: 597729


1-(Indolyl-2-carbonyl)-4-[3-[(1-methylpropyl)amino]-2-pyridyl]piperazine 153473-57-5 AIDS-003281 AIDS003281 BHAP indolyl pyridyl deriv. Piperazine, 1-(1H-indol-2-ylcarbonyl)-4-[3-[(1-methylpropyl)amino]-2-pyridinyl]-

pdb file: 597730.pdb
sdf file: 597730.sdf
directory: 597730


1-(Indolyl-2-carbonyl)-4-[3-(diethylamino)-2-pyridyl]piperazine 136816-78-9 AIDS-003282 AIDS003282 BHAP indolyl pyridyl deriv. Piperazine, 1-[3-(diethylamino)-2-pyridinyl]-4-(1H-indol-2-ylcarbonyl)-

pdb file: 597731.pdb
sdf file: 597731.sdf
directory: 597731


1-(Indolyl-2-carbonyl)-4-[3-[(cyclopropylmethyl)amino]-2-pyridyl]piperazine 136816-90-5 AIDS-003283 AIDS003283 BHAP indolyl pyridyl deriv. Piperazine, 1-[3-[(cyclopropylmethyl)amino]-2-pyridinyl]-4-(1H-indol-2-ylcarbonyl)-

pdb file: 597732.pdb
sdf file: 597732.sdf
directory: 597732


AIDS-003284 AIDS003284 N-(2-Indolcarbonyl)-N'-[(3-(t-butylmethyl)amino)-2-pyridinyl]piperazine Piperazine deriv.

pdb file: 597733.pdb
sdf file: 597733.sdf
directory: 597733


1-(Indolyl-2-carbonyl)-4-[3-[(2,2,2-trifluoroethyl)amino]-2-pyridyl]piperazine 136816-92-7 AIDS-003285 AIDS003285 BHAP indolyl pyridyl deriv. Piperazine, 1-(1H-indol-2-ylcarbonyl)-4-[3-[(2,2,2-trifluoroethyl)amino]-2-pyridinyl]-

pdb file: 597734.pdb
sdf file: 597734.sdf
directory: 597734


AIDS-003287 AIDS003287 N-[5-Fluoro-2-indolcarbonyl]-N'-[(3-isopropylamino)-2-pyrazinyl]piperazine Piperazine deriv.

pdb file: 597735.pdb
sdf file: 597735.sdf
directory: 597735


136817-09-9 1H-Indole-2-carboxamide, N-methyl-N-[2-[methyl[3-[(1-methylethyl)amino]-2-pyridinyl]amino]ethyl]- AIDS-003291 AIDS003291 Diaminoethane deriv. N,N'-Dimethyl-N-(2-indolcarbonyl)-N'-[(3-isopropylamino)-2-pyridinyl]-1,2-diaminoethane

pdb file: 597738.pdb
sdf file: 597738.sdf
directory: 597738


136817-10-2 1H-Indole-2-carboxamide, N-methyl-N-[3-[methyl[3-[(1-methylethyl)amino]-2-pyridinyl]amino]propyl]- AIDS-003292 AIDS003292 Diaminopropane deriv. N,N'-Dimethyl-N-(2-indolcarbonyl)-N'-[(3-isopropylamino)-2-pyridinyl]-1,3-diaminopropane

pdb file: 597739.pdb
sdf file: 597739.sdf
directory: 597739


1H-Indole-2-carboxamide, N-methyl-N-[3-[methyl[3-[(1-methylethyl)amino]-2-pyridinyl]amino]butyl]- AIDS-003293 AIDS003293 Diaminobutane deriv. N,N'-Dimethyl-N-(2-indolcarbonyl)-N'-[(3-isopropylamino)-2-pyridinyl]-1,4-diaminobutane

pdb file: 597740.pdb
sdf file: 597740.sdf
directory: 597740


136817-11-3 1H-Indole-2-carboxamide, N-methyl-N-[6-[methyl[3-[(1-methylethyl)amino]-2-pyridinyl]amino]hexyl]- AIDS-003294 AIDS003294 Diaminohexane deriv. N,N'-Dimethyl-N-(2-indolcarbonyl)-N'-[(3-isopropylamino)-2-pyridinyl]-1,6-diaminohexane

pdb file: 597741.pdb
sdf file: 597741.sdf
directory: 597741


1-(2-Indolcarboxylate)-2-[(3-isopropylamino)-2-pyridinoxy]ethane AIDS-003295 AIDS003295 Ethane deriv.

pdb file: 597742.pdb
sdf file: 597742.sdf
directory: 597742


2-(2-Indolcarboxylate)-N-methyl-N-[(3-isopropylamino)-2-pyridinyl]ethylamine AIDS-003296 AIDS003296 Ethylamine deriv.

pdb file: 597743.pdb
sdf file: 597743.sdf
directory: 597743


136817-15-7 1H-Indole-2-carboxamide, N-methyl-N-[2-[[3-[(1-methylethyl)amino]-2-pyridinyl]oxy]ethyl]- AIDS-003297 AIDS003297 Ethylamine deriv. N-(2-Indolcarbonyl)-N-methyl-2-[(3-isopropylamino)-2-pyridinoxy]ethylamine

pdb file: 597744.pdb
sdf file: 597744.sdf
directory: 597744


AIDS-003300 AIDS003300 Diazepine deriv. N-(2-Indolcarbonyl)-N'-[(3-isopropylamino)-2-pyridinyl]-1,4-tetrahydrodiazepine

pdb file: 597745.pdb
sdf file: 597745.sdf
directory: 597745


1-(Indolyl-2-carbonyl)-4-[2-(1-methylethylamino)phenyl]piperazine 153473-50-8 AIDS-003306 AIDS003306 Arylpiperazine indolyl deriv. Piperazine, 1-(1H-indol-2-ylcarbonyl)-4-[2-[(1-methylethyl)amino]phenyl]-

pdb file: 597746.pdb
sdf file: 597746.sdf
directory: 597746


1,7-Phenanthroline-2,8-dicarboxylic acid, 1,4,7,10-tetrahydro-4,10-dioxo-6-pentyl-, dimethyl ester 63921-03-9 AIDS-003315 AIDS003315 Dimethyl-1,4,7,10-tetrahydro-4,10-dioxo-6-(n-pentyl)-1,7-phenanthroline-2,8-dicarboxylate Quinoline deriv.

pdb file: 597755.pdb
sdf file: 597755.sdf
directory: 597755


1,7-Phenanthroline-2,8-dicarboxylic acid, 6-(1,1-dimethylpropyl)-1,4,7,10-tetrahydro-4,10-dioxo-, dimethyl ester 130292-73-8 AIDS-003316 AIDS003316 Dimethyl-1,4,7,10-tetrahydro-4,10-dioxo-6-(1,1-dimethylpropyl)-1,7-phenanthroline-2,8-dicarboxylate Quinoline deriv.

pdb file: 597756.pdb
sdf file: 597756.sdf
directory: 597756


1,7-Phenanthroline-2,8-dicarboxylic acid, 1,4,7,10-tetrahydro-6-(1-methylbutyl)-4,10-dioxo-, dimethyl ester 130292-74-9 AIDS-003317 AIDS003317 Dimethyl-1,4,7,10-tetrahydro-4,10-dioxo-6-(1-methyl-1-butyl)-1,7-phenanthroline-2,8-dicarboxylate Quinoline deriv.

pdb file: 597757.pdb
sdf file: 597757.sdf
directory: 597757


1-Benzoyl-4-[4-[[7-(trifluoromethyl)-4-quinolinyl]amino]benzoylpiperazine 130292-75-0 AIDS-003318 AIDS003318 Piperazine, 1-benzoyl-4-[4-[[7-(trifluoromethyl)-4-quinolinyl]amino]benzoyl]- Quinoline deriv.

pdb file: 597758.pdb
sdf file: 597758.sdf
directory: 597758


1-Benzoyl-4-[4-[[7-(trifluoromethyl)-4-quinolinyl]amino]benzoylpiperazine maleate 130292-76-1 AIDS-003319 AIDS003319 Piperazine, 1-benzoyl-4-[4-[[7-(trifluoromethyl)-4-quinolinyl]amino]benzoyl]-, (2Z)-2-butenedioate (1:1) Quinoline deriv.

pdb file: 597759.pdb
sdf file: 597759.sdf
directory: 597759


1-[(4-Methoxyphenyl)sulfonyl]-4-[4-[7-(trifluoromethyl)-4-quinolinyl]amino]benzoylpiperazine 72141-58-3 AIDS-003320 AIDS003320 Piperazine, 1-[(4-methoxyphenyl)sulfonyl]-4-[4-[[7-(trifluoromethyl)-4-quinolinyl]amino]benzoyl]- Quinoline deriv.

pdb file: 597760.pdb
sdf file: 597760.sdf
directory: 597760


1-[(4-Chlorophenyl)sulfonyl]-4-[4-[[7-(trifluoromethyl)-4-quinolinyl]amino]benzoyl]-piperazine 72141-56-1 AIDS-003321 AIDS003321 Piperazine, 1-[(4-chlorophenyl)sulfonyl]-4-[4-[[7-(trifluoromethyl)-4-quinolinyl]amino]benzoyl]- Quinoline deriv.

pdb file: 597761.pdb
sdf file: 597761.sdf
directory: 597761


130292-77-2 AIDS-003322 AIDS003322 N-(4-Chlorophenyl)-N-[4-[(7-chloro-4-quinolinyl)amino]phenyl]urea, methanol solvate Quinoline deriv. Urea, N-(4-chlorophenyl)-N'-[4-[(7-chloro-4-quinolinyl)amino]phenyl]-

pdb file: 597762.pdb
sdf file: 597762.sdf
directory: 597762


130292-78-3 AIDS-003323 AIDS003323 Benzamide, N-[4-[3-(trifluoromethyl)phenyl]-3-cyclohexen-1-yl]-4-[[7-(trifluoromethyl)-4-quinolinyl]amino]- N-[4-[3-(Trifluoromethylphenyl)-3-cyclohexen-1-yl]-4-[[7-(trifluoromethyl)-4-quinolinyl]-amino]benzamide Quinoline deriv.

pdb file: 597763.pdb
sdf file: 597763.sdf
directory: 597763


2,6-Xylenol, 4-[(7-chloro-4-quinolyl)amino]-.alpha.-[[4-[(6-methoxy-8-quinolyl)amino]pentyl]amino]-a'-1-pyrrolidinyl- 4-[(7-Chloro-4-quinolyl)(amino)]-.alpha.-[[4-[(6-methoxy-8-quinolyl)amino]pentyl]amino]-.alpha.'-1-pyrrolidinyl-2,6-xylenoltrihydrochloride 6037-03-2 (TRIHYDROCHLORIDE) 6773-33-7 AIDS-003324 AIDS003324 Phenol, 4-[(7-chloro-4-quinolinyl)amino]-2-[[[4-[(6-methoxy-8-quinolinyl)amino]pentyl]amino]methyl]-6-(1-pyrrolidinylmethyl)- Quinoline deriv.

pdb file: 597764.pdb
sdf file: 597764.sdf
directory: 597764


108199-09-3 31309-76-9 (MONOHYDROCHLORIDE) 4-[m[[(7-Chloro-4-quinolyl)amino]benzoyl]morpholine hydrochloride AIDS-003325 AIDS003325 Morpholine, 4-[4-[(7-chloro-4-quinolinyl)amino]benzoyl]- Quinoline deriv.

pdb file: 597765.pdb
sdf file: 597765.sdf
directory: 597765


2'-[6,7-Dimethoxy-1-isoquinolyl)methyl]-4',5'-dimethoxyacetophenone 38714-92-0 6'-Acetylpapaverine AIDS-003328 AIDS003328 Acetopapaverine Ethanone, 1-[2-[(6,7-dimethoxy-1-isoquinolinyl)methyl]-4,5-dimethoxyphenyl]- Isoquinoline deriv. NSC98542 Pseudocoralyne ST 38218

pdb file: 597767.pdb
sdf file: 597767.sdf
directory: 597767


(1-Isoquinolyl)oxamic acid, ethyl ester AIDS-003329 AIDS003329 Isoquinoline deriv.

pdb file: 597768.pdb
sdf file: 597768.sdf
directory: 597768


(5-Isoquinolinyloxy)acetic acid, methyl ester AIDS-003330 AIDS003330 Isoquinoline deriv.

pdb file: 597769.pdb
sdf file: 597769.sdf
directory: 597769


135525-67-6 3-[(2-Benzimidazolylmethyl)amino]-5-ethyl-6-methlpyridin-2(1H)-one AIDS-003334 AIDS003334 Pyridinone deriv.

pdb file: 597773.pdb
sdf file: 597773.sdf
directory: 597773


135525-68-7 3-[(2-Benzothiazolylmethyl)amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-003335 AIDS003335 Pyridinone deriv.

pdb file: 597774.pdb
sdf file: 597774.sdf
directory: 597774


135525-69-8 2-Pyridinone deriv. 5-Ethyl-6-methyl-3-[(2-benzothiazolyl)ethyl]-2-pyridinone AIDS-003336 AIDS003336

pdb file: 597775.pdb
sdf file: 597775.sdf
directory: 597775


135525-71-2 2(1H)-Pyridinone, 3-[2-(2-benzoxazoyl)ethyl]-5-ethyl-6-methyl 2-Pyridinone deriv. 3-[2-(Benzoxazol-2-yl)ethyl]-5-ethyl-6-methyl-pyridin-2(1H)-one AIDS-003337 AIDS003337 L-696,229

pdb file: 597776.pdb
sdf file: 597776.sdf
directory: 597776


135525-72-3 3-[(2-Benzofuranylmethyl)amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-003338 AIDS003338 Pyridinone deriv.

pdb file: 597777.pdb
sdf file: 597777.sdf
directory: 597777


135525-73-4 2-Pyridinone deriv. 5-Ethyl-6-methyl-3-[(2-benzofurano)ethyl]-2-pyridinone AIDS-003339 AIDS003339

pdb file: 597778.pdb
sdf file: 597778.sdf
directory: 597778


135525-74-5 3-[(2-Naphthylmethyl)amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-003340 AIDS003340 Pyridinone deriv.

pdb file: 597779.pdb
sdf file: 597779.sdf
directory: 597779


135525-75-6 3-[(4-Methylbenzoxazol-2-ylmethyl)amino]-5-ethyl-6-methlpyridin-2(1H)-one AIDS-003341 AIDS003341 Pyridinone deriv.

pdb file: 597780.pdb
sdf file: 597780.sdf
directory: 597780


135525-76-7 3-[(7-Methyl-Benzoxazol-2-ylmethyl)amino]-5-ethyl-6-methlpyridin-2(1H)-one AIDS-003342 AIDS003342 Pyridinone deriv.

pdb file: 597781.pdb
sdf file: 597781.sdf
directory: 597781


135560-40-6 2-Pyridinone deriv. 3-[2-(4,7-Dimethylbenzoxazol-2-yl)ethyl]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-003343 AIDS003343

pdb file: 597782.pdb
sdf file: 597782.sdf
directory: 597782


135560-41-7 2-Pyridinone deriv. 3-[2-(4,7-Dichlorobenzoxazol-2-yl)ethyl]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-003344 AIDS003344 L 697695 L-697,695

pdb file: 597783.pdb
sdf file: 597783.sdf
directory: 597783


3-(3,3-(Dimethylallyl)-5-(3-acetyl-2,4-dihydroxy-5-methyl-6-methoxybenzyl)-phloracetophenone) 86828-07-1 AIDS-003347 AIDS003347 Mallotojaponin Phloroglucinol deriv.

pdb file: 597786.pdb
sdf file: 597786.sdf
directory: 597786


3-(3-Methyl-2-hydroxybut-3-enyl)-5-(3-acetyl-2,4-dihydroxy-5-methyl-6-methoxybenzyl)-phloracetophenone AIDS-003348 AIDS003348 Mallotolerin Phloroglucinol deriv.

pdb file: 597787.pdb
sdf file: 597787.sdf
directory: 597787


8-Acetyl-5,7-dihydroxy-6-(3-acetyl-2,4-dihydroxy-5-methyl-6-methoxybenzyl)-2,2-dimethylchromene AIDS-003349 AIDS003349 Mallotochromene Phloroglucinol deriv.

pdb file: 597788.pdb
sdf file: 597788.sdf
directory: 597788


5-Methylene-bis-2,6-dihydroxy-3-methyl-4-methoxyacetophenone AIDS-003350 AIDS003350 Mallotophenone Phloroglucinol deriv.

pdb file: 597789.pdb
sdf file: 597789.sdf
directory: 597789


.alpha.-MAPI 70857-49-7 AIDS-003410 AIDS003410 L-Valinamide, N2-[[[(1S)-1-carboxy-2-phenylethyl]amino]carbonyl]-L-arginyl-N-[(1S)-1-formyl-2-phenylethyl]- N-[N-[N2-[[(1-Carboxy-2-phenylethyl)amino]carbonyl]-L-arginyl]-L-valyl]-L-phenylalanine, aldehyde deriv. Phe-CO-Arg-Val-L-Phe-H

pdb file: 597843.pdb
sdf file: 597843.sdf
directory: 597843


135042-28-3 4-Purinylpyrrolidine deriv. AIDS-003414 AIDS003414 cis-4-(6-Amino-9H-purin-9-yl)-D-prolinol

pdb file: 597847.pdb
sdf file: 597847.sdf
directory: 597847


(3R,5R)-1,9-Dihydro-9-[5-(hydroxymethyl)-3-pyrrolidinyl]-6H-purin-6-one 135042-29-4 4-Purinylpyrrolidine deriv. AIDS-003415 AIDS003415

pdb file: 597848.pdb
sdf file: 597848.sdf
directory: 597848


135042-30-7 4-Purinylpyrrolidine deriv. AIDS-003416 AIDS003416 cis-4-(2,6-Diamino-9H-purin-9-yl)-D-prolinol

pdb file: 597849.pdb
sdf file: 597849.sdf
directory: 597849


(3R,5R)-2-Amino-1,9-dihydro-9-[5-(hydroxymethyl)-3-pyrrolidinyl]-6H-purin-6-one 135042-31-8 4-Purinylpyrrolidine deriv. AIDS-003417 AIDS003417

pdb file: 597850.pdb
sdf file: 597850.sdf
directory: 597850


(3S,5S)-2-Amino-1,9-dihydro-9-[5-(hydroxymethyl)-3-pyrrolidinyl]-6H-purin-6-one 4-Purinylpyrrolidine deriv. 57653-47-1 AIDS-003418 AIDS003418

pdb file: 597851.pdb
sdf file: 597851.sdf
directory: 597851


2-(2-Deoxy-D-erythro-pent-1-enofuranosyl)pyridine 2-Pyridine deriv. AIDS-003422 AIDS003422

pdb file: 597855.pdb
sdf file: 597855.sdf
directory: 597855


2-(2-Deoxy-D-erythro-pent-1-enofuranosyl)-3-methylpyridine 2-Methylpyridine deriv. AIDS-003423 AIDS003423

pdb file: 597856.pdb
sdf file: 597856.sdf
directory: 597856


2-(2-Deoxy-D-erythro-pent-1-enofuranosyl)-4-methylpyridine 4-Methylpyridine deriv. AIDS-003424 AIDS003424

pdb file: 597857.pdb
sdf file: 597857.sdf
directory: 597857


2-(2-Deoxy-D-erythro-pent-1-enofuranosyl)-5-methylpyridine 5-Methylpyridine deriv. AIDS-003425 AIDS003425

pdb file: 597858.pdb
sdf file: 597858.sdf
directory: 597858


2-(2-Deoxy-D-erythro-pent-1-enofuranosyl)-6-methylpyridine 6-Methylpyridine deriv. AIDS-003426 AIDS003426

pdb file: 597859.pdb
sdf file: 597859.sdf
directory: 597859


2-(5-Hydroxymethylfur-2-yl)-6-methylpyridine 6-Methylpyridine deriv. AIDS-003427 AIDS003427

pdb file: 597860.pdb
sdf file: 597860.sdf
directory: 597860


2-(2-Deoxy-.alpha.-D-ribofuranosyl)-3-methylpyridine 3-Methylpyridine deriv. AIDS-003428 AIDS003428

pdb file: 597861.pdb
sdf file: 597861.sdf
directory: 597861


2-(2-Deoxy-.beta.-D-ribofuranosyl)-3-methylpyridine 3-Methylpyridine deriv. AIDS-003429 AIDS003429

pdb file: 597862.pdb
sdf file: 597862.sdf
directory: 597862


138228-18-9 AIDS-003433 AIDS003433 KNI 122 KNI-122 L-Valinamide, L-seryl-L-phenylalanyl-L-asparaginyl-(2R,3S)-2-hydroxy-4-phenyl-3-aminobutanoyl-L-prolyl-L-isoleucyl- Phenylnorstatin deriv. Ser-Phe-Asn-Pns-Pro-Ile-Val-NH2

pdb file: 597866.pdb
sdf file: 597866.sdf
directory: 597866


(2S,3S)-Seryl-phenylalanyl-asparagyl-allophenylnorstatyl-prolyl-isoleucyl-valinamide AIDS-003434 AIDS003434 Allophenylnorstatin deriv. KNI-93 Ser-Phe-Asn-Apns-Pro-Ile-Val-NH2

pdb file: 597867.pdb
sdf file: 597867.sdf
directory: 597867


AIDS-003435 AIDS003435 KNI-81 N-(Phenylethylcarbonyl)-asparagyl-phenylnorstatyl-prolyl-isoleucyl-valinamide Phenylnorstatin deriv.

pdb file: 597868.pdb
sdf file: 597868.sdf
directory: 597868


AIDS-003438 AIDS003438 Phenylnorstatin deriv. Val-Val-Pns-Phe-Val-Val-NH2 Valyl-valyl-phenylnorstatyl-phenylalanyl-valyl-valinamide

pdb file: 597871.pdb
sdf file: 597871.sdf
directory: 597871


AIDS-003439 AIDS003439 Acetylphenylalanyl deriv. N-[2-(N-Acetyl-phenylalanyl-asparaginyl)-3-(phenyl)propyl]prolyl-glutamyl-isoleucine amide

pdb file: 597872.pdb
sdf file: 597872.sdf
directory: 597872


(+)-S-4,5,6,7-Tetrahydro-9-chloro-5-methyl-6-(3-methyl-2-butenyl)-imidazo[4,5,1-jk][1,4]-benzodiazepin-2(1H)-one 131645-82-4 9-Chloro-TIBO AIDS-003440 AIDS003440 TIBO deriv.

pdb file: 597873.pdb
sdf file: 597873.sdf
directory: 597873


4,5,6,7-Tetrahydro-5-methyl-6-(3-methyl-2-butenyl)-imidazo-[4,5,1-jk][1,4]-benzodiazepin-2(1H)-one AIDS-003441 AIDS003441 TIBO deriv.

pdb file: 597874.pdb
sdf file: 597874.sdf
directory: 597874


AIDS-003445 AIDS003445 N-[5(S)-[(tert-Butoxycarbonyl)amino]-4(S)-hydroxy-6-phenyl-2(R)-(phenylmethyl)hexanoyl]valine amide Tetrapeptide deriv.

pdb file: 597878.pdb
sdf file: 597878.sdf
directory: 597878


AIDS-003446 AIDS003446 N-[5(S)-[(tert-Butoxycarbonyl)amino]-4(S)-hydroxy-6-phenyl-2(R)-(phenylmethyl)hexanoyl]glycine amide Tetrapeptide deriv.

pdb file: 597879.pdb
sdf file: 597879.sdf
directory: 597879


AIDS-003447 AIDS003447 N-[5(S)-[(tert-Butoxycarbonyl)amino]-4(S)-hydroxy-6-phenyl-2(R)-(phenylmethyl)hexanoyl]alanine amide Tetrapeptide deriv.

pdb file: 597880.pdb
sdf file: 597880.sdf
directory: 597880


AIDS-003449 AIDS003449 N-[5(S)-[(tert-Butoxycarbonyl)amino]-4(S)-hydroxy-6-phenyl-2(R)-(phenylmethyl)hexanoyl]isoleucine amide Tetrapeptide deriv.

pdb file: 597882.pdb
sdf file: 597882.sdf
directory: 597882


AIDS-003450 AIDS003450 N-[5(S)-[(tert-Butoxycarbonyl)amino]-4(S)-hydroxy-6-phenyl-2(R)-(phenylmethyl)hexanoyl]phenylglycine amide Tetrapeptide deriv.

pdb file: 597883.pdb
sdf file: 597883.sdf
directory: 597883


AIDS-003451 AIDS003451 N-[5(S)-[(tert-Butoxycarbonyl)amino]-4(S)-hydroxy-6-phenyl-2(R)-(phenylmethyl)hexanoyl]cyclohexglycine amide Tetrapeptide deriv.

pdb file: 597884.pdb
sdf file: 597884.sdf
directory: 597884


AIDS-003452 AIDS003452 N-[5(S)-[(tert-Butoxycarbonyl)amino]-4(S)-hydroxy-6-phenyl-2(R)-(phenylmethyl)hexanoyl]phenylalanine amide Tetrapeptide deriv.

pdb file: 597885.pdb
sdf file: 597885.sdf
directory: 597885


AIDS-003453 AIDS003453 N-[5(S)-[(tert-Butoxycarbonyl)amino]-4(S)-hydroxy-6-phenyl-2(R)-(phenylmethyl)hexanoyl]cyclohexylalanine amide Tetrapeptide deriv.

pdb file: 597886.pdb
sdf file: 597886.sdf
directory: 597886


AIDS-003454 AIDS003454 N-[5(S)-[(tert-Butoxycarbonyl)amino]-4(S)-hydroxy-6-phenyl-2(R)-(phenylmethyl)hexanoyl]serine amide Tetrapeptide deriv.

pdb file: 597887.pdb
sdf file: 597887.sdf
directory: 597887


AIDS-003455 AIDS003455 N-[5(S)-[(tert-Butoxycarbonyl)amino]-4(S)-hydroxy-6-phenyl-2(R)-(phenylmethyl)hexanoyl]tryptophan amide Tetrapeptide deriv.

pdb file: 597888.pdb
sdf file: 597888.sdf
directory: 597888


AIDS-003456 AIDS003456 N-[5(S)-[(tert-Butoxycarbonyl)amino]-4(S)-hydroxy-6-phenyl-2(R)-(phenylmethyl)hexanoyl]histidine amide Tetrapeptide deriv.

pdb file: 597889.pdb
sdf file: 597889.sdf
directory: 597889


AIDS-003457 AIDS003457 N-[5(S)-[(tert-Butoxycarbonyl)amino]-4(S)-hydroxy-6-phenyl-2(R)-(phenylmethyl)hexanoyl]-D-leucine amide Tetrapeptide deriv.

pdb file: 597890.pdb
sdf file: 597890.sdf
directory: 597890



AIDS-003462 AIDS003462 N'-(Benzyl)-N-[5(S)-[(tert-butoxycarbonyl)amino]-4(S)-hydroxy-6-phenyl-2(R)-(phenylmethyl)hexanoyl]phenylglycine amide Tetrapeptide deriv.

pdb file: 597895.pdb
sdf file: 597895.sdf
directory: 597895


00575001_00600000/597897 AIDS-003464 AIDS003464 N'-(1-Phenyl-3-hydroxy-2-propyl)-N-[5(S)-[(tert-butoxycarbonyl)amino]-4(S)-hydroxy-6-phenyl-2(R)-(phenylmethyl)hexanoyl]leucine amide Tetrapeptide deriv.

pdb file: 597896.pdb
sdf file: 597896.sdf
directory: 597896



AIDS-003466 AIDS003466 N'-(2-Hydroxyethyl)-N-[5(S)-[(tert-butoxycarbonyl)amino]-4(S)-hydroxy-6-phenyl-2(R)-(phenylmethyl)hexanoyl]isoleucine amide Tetrapeptide deriv.

pdb file: 597899.pdb
sdf file: 597899.sdf
directory: 597899


AIDS-003467 AIDS003467 N'-(2-Hydroxyethyl)-N-[5(S)-[(tert-butoxycarbonyl)amino]-4(S)-hydroxy-6-phenyl-2(R)-(phenylmethyl)hexanoyl]valine amide Tetrapeptide deriv.

pdb file: 597900.pdb
sdf file: 597900.sdf
directory: 597900


00575001_00600000/597902 AIDS-003469 AIDS003469 N'-(2,3-Dihydroxypropyl)-N-[5(S)-[(tert-butoxycarbonyl)amino]-4(S)-hydroxy-6-phenyl-2(R)-(phenylmethyl)hexanoyl]valine amide Tetrapeptide deriv.

pdb file: 597901.pdb
sdf file: 597901.sdf
directory: 597901



AIDS-003471 AIDS003471 N'-(3-Dimethylaminopropyl)-N-[5(S)-[(tert-butoxycarbonyl)amino]-4(S)-hydroxy-6-phenyl-2(R)-(phenylmethyl)hexanoyl]isoleucine amide Tetrapeptide deriv.

pdb file: 597904.pdb
sdf file: 597904.sdf
directory: 597904


AIDS-003472 AIDS003472 N'-(3-Dimethylaminopropyl)-N-[5(S)-[(tert-butoxycarbonyl)amino]-4(S)-hydroxy-6-phenyl-2(R)-(phenylmethyl)hexanoyl]valine amide Tetrapeptide deriv.

pdb file: 597905.pdb
sdf file: 597905.sdf
directory: 597905


AIDS-003473 AIDS003473 N'-(3-Dimethylaminopropyl)-N-[5(S)-[(tert-butoxycarbonyl)amino]-4(S)-hydroxy-6-phenyl-2(R)-(phenylmethyl)hexanoyl]phenylglycine amide Tetrapeptide deriv.

pdb file: 597906.pdb
sdf file: 597906.sdf
directory: 597906


AIDS-003474 AIDS003474 N'-(2-Dimethylaminoethyl)-N-[5(S)-[(tert-butoxycarbonyl)amino]-4(S)-hydroxy-6-phenyl-2(R)-(phenylmethyl)hexanoyl]isoleucine amide Tetrapeptide deriv.

pdb file: 597907.pdb
sdf file: 597907.sdf
directory: 597907


AIDS-003475 AIDS003475 N'-(2-Methylaminoethyl)-N-[5(S)-[(tert-butoxycarbonyl)amino]-4(S)-hydroxy-6-phenyl-2(R)-(phenylmethyl)hexanoyl]valine amide Tetrapeptide deriv.

pdb file: 597908.pdb
sdf file: 597908.sdf
directory: 597908


AIDS-003476 AIDS003476 N'-(2-Aminoethyl)-N-[5(S)-[(tert-butoxycarbonyl)amino]-4(S)-hydroxy-6-phenyl-2(R)-(phenylmethyl)hexanoyl]valine amide Tetrapeptide deriv.

pdb file: 597909.pdb
sdf file: 597909.sdf
directory: 597909


AIDS-003477 AIDS003477 N'-(2-Hydroxy-3-diethylaminopropyl)-N-[5(S)-[(tert-butoxycarbonyl)amino]-4(S)-hydroxy-6-phenyl-2(R)-(phenylmethyl)hexanoyl]valine amide Tetrapeptide deriv.

pdb file: 597910.pdb
sdf file: 597910.sdf
directory: 597910


AIDS-003478 AIDS003478 N'-(2-Hydroxy-3-morpholinopropyl)-N-[5(S)-[(tert-butoxycarbonyl)amino]-4(S)-hydroxy-6-phenyl-2(R)-(phenylmethyl)hexanoyl]valine amide Tetrapeptide deriv.

pdb file: 597911.pdb
sdf file: 597911.sdf
directory: 597911


AIDS-003479 AIDS003479 N'-(3-Morpholinopropyl)-N-[5(S)-[(tert-butoxycarbonyl)amino]-4(S)-hydroxy-6-phenyl-2(R)-(phenylmethyl)hexanoyl]valine amide Tetrapeptide deriv.

pdb file: 597912.pdb
sdf file: 597912.sdf
directory: 597912


AIDS-003480 AIDS003480 N'-(2-Pyridinylmethyl)-N-[5(S)-[(tert-butoxycarbonyl)amino]-4(S)-hydroxy-6-phenyl-2(R)-(phenylmethyl)hexanoyl]isoleucine amide Tetrapeptide deriv.

pdb file: 597913.pdb
sdf file: 597913.sdf
directory: 597913


AIDS-003481 AIDS003481 N'-(2-Pyridinylmethyl)-N-[5(S)-[(tert-butoxycarbonyl)amino]-4(S)-hydroxy-6-phenyl-2(R)-(phenylmethyl)hexanoyl]valine amide Tetrapeptide deriv.

pdb file: 597914.pdb
sdf file: 597914.sdf
directory: 597914


AIDS-003482 AIDS003482 N'-(3-Pyridinylmethyl)-N-[5(S)-[(tert-butoxycarbonyl)amino]-4(S)-hydroxy-6-phenyl-2(R)-(phenylmethyl)hexanoyl]valine amide Tetrapeptide deriv.

pdb file: 597915.pdb
sdf file: 597915.sdf
directory: 597915


AIDS-003483 AIDS003483 N'-(4-Pyridinylmethyl)-N-[5(S)-[(tert-butoxycarbonyl)amino]-4(S)-hydroxy-6-phenyl-2(R)-(phenylmethyl)hexanoyl]valine amide Tetrapeptide deriv.

pdb file: 597916.pdb
sdf file: 597916.sdf
directory: 597916


AIDS-003484 AIDS003484 N'-(2-Imidazolmethyl)-N-[5(S)-[(tert-butoxycarbonyl)amino]-4(S)-hydroxy-6-phenyl-2(R)-(phenylmethyl)hexanoyl]isoleucine amide Tetrapeptide deriv.

pdb file: 597917.pdb
sdf file: 597917.sdf
directory: 597917


AIDS-003485 AIDS003485 N'-(2-Benzimidazolmethyl)-N-[5(S)-[(tert-butoxycarbonyl)amino]-4(S)-hydroxy-6-phenyl-2(R)-(phenylmethyl)hexanoyl]valine amide Tetrapeptide deriv.

pdb file: 597918.pdb
sdf file: 597918.sdf
directory: 597918


AIDS-003486 AIDS003486 N'-(2-Benzimidazolmethyl)-N-[5(S)-[(tert-butoxycarbonyl)amino]-4(S)-hydroxy-6-phenyl-2(R)-(phenylmethyl)hexanoyl]phenylglycine amide Tetrapeptide deriv.

pdb file: 597919.pdb
sdf file: 597919.sdf
directory: 597919


AIDS-003488 AIDS003488 N-[5(S)-[(tert-Butoxycarbonyl)amino]-4(S)-(tert-butyldimethylsiloxy)-6-phenyl-2(R)-(phenylmethyl)hexanoyl]valine methyl ester Tetrapeptide deriv.

pdb file: 597921.pdb
sdf file: 597921.sdf
directory: 597921


1-[(2-Hydroxyethoxy)methyl]-6-(phenylselenenyl)uracil 136632-02-5 6-(Phenylselenenyl) deriv. AIDS-003516 AIDS003516

pdb file: 597949.pdb
sdf file: 597949.sdf
directory: 597949


1-[(2-Hydroxyethoxy)methyl]-6-(phenylselenenyl)thymine 136632-03-6 6-(Phenylselenenyl) deriv. AIDS-003517 AIDS003517

pdb file: 597950.pdb
sdf file: 597950.sdf
directory: 597950


1-[(2-Hydroxyethoxy)methyl]-6-(phenylselenenyl)-5-fluorouracil 136632-04-7 6-(Phenylselenenyl) deriv. AIDS-003518 AIDS003518

pdb file: 597951.pdb
sdf file: 597951.sdf
directory: 597951


1-[(2-Hydroxyethoxy)methyl]-6-(phenylselenenyl)-5-chlorouracil 136632-05-8 6-(Phenylselenenyl) deriv. AIDS-003519 AIDS003519

pdb file: 597952.pdb
sdf file: 597952.sdf
directory: 597952


1-[(2-Hydroxyethoxy)methyl]-6-(phenylselenenyl)-5-bromouracil 136632-06-9 6-(Phenylselenenyl) deriv. AIDS-003520 AIDS003520

pdb file: 597953.pdb
sdf file: 597953.sdf
directory: 597953


136632-07-0 4(1H)-Pyrimidinone, 2,3-dihydro-1-[(2-hydroxyethoxy)methyl]-5-methyl-6-(phenylseleno)-2-thioxo- 6-(Phenylselenenyl) deriv. AIDS-003521 AIDS003521

pdb file: 597954.pdb
sdf file: 597954.sdf
directory: 597954


6,6',7,7'-Tetrahydroxy-3,3'-dimethyl-2,2'-diacetoxy-5,5'-bis(1-methylethyl)-[2,2'-binaphthalene]-, 8,8'-dicarbonitrile 94242-60-1 AIDS-003522 AIDS003522 Gossylic nitrile-1,1'-diacetate Gossypol deriv.

pdb file: 597955.pdb
sdf file: 597955.sdf
directory: 597955


136105-62-9 AIDS-003523 AIDS003523 Gossylic iminolactone Gossypol deriv.

pdb file: 597956.pdb
sdf file: 597956.sdf
directory: 597956


136779-92-5 AIDS-003527 AIDS003527 Imidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one, 6-(cyclopropylmethyl)-4,5,6,7-tetrahydro-5-methyl-, (S)- TIBO deriv.

pdb file: 597960.pdb
sdf file: 597960.sdf
directory: 597960


131645-65-3 AIDS-003528 AIDS003528 Imidazo[4,5,1-jk][1,4]benzodiazepine-2(1H)-thione, 6-(cyclopropylmethyl)-4,5,6,7-tetrahydro-5-methyl-, (S)- TIBO deriv.

pdb file: 597961.pdb
sdf file: 597961.sdf
directory: 597961


136722-77-5 AIDS-003529 AIDS003529 Imidazo[4,5,1-jk][1,4]benzodiazepine-2(1H)-thione, 4,5,6,7-tetrahydro-5-methyl-6-(2-methyl-2-propenyl)-, (5S)- Imidazo[4,5,1-jk][1,4]benzodiazepine-2(1H)-thione, 4,5,6,7-tetrahydro-5-methyl-6-(2-methyl-2-propenyl)-, (S)- TIBO deriv.

pdb file: 597962.pdb
sdf file: 597962.sdf
directory: 597962


136779-94-7 AIDS-003530 AIDS003530 Imidazo[4,5,1-jk][1,4]benzodiazepine-2(1H)-thione, 4,5,6,7-tetrahydro-5-methyl-6-propyl- Imidazo[4,5,1-jk][1,4]benzodiazepine-2(1H)-thione, 4,5,6,7-tetrahydro-5-methyl-6-propyl-, (1)- R80806 TIBO deriv.

pdb file: 597963.pdb
sdf file: 597963.sdf
directory: 597963


136722-70-8 AIDS-003531 AIDS003531 Imidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one, 9-chloro-6-(cyclobutylmethyl)-4,5,6,7-tetrahydro-5-methyl-, (S)- TIBO deriv.

pdb file: 597964.pdb
sdf file: 597964.sdf
directory: 597964


136722-71-9 AIDS-003532 AIDS003532 Imidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one, 9-chloro-6-(2-cyclopropylethyl)-4,5,6,7-tetrahydro-5-methyl-, (S)- TIBO deriv.

pdb file: 597965.pdb
sdf file: 597965.sdf
directory: 597965


136722-72-0 AIDS-003533 AIDS003533 Imidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one, 9-chloro-6-(3-ethyl-2-pentenyl)-4,5,6,7-tetrahydro-5-methyl-, (S)- R 85386 TIBO deriv.

pdb file: 597966.pdb
sdf file: 597966.sdf
directory: 597966


136722-74-2 AIDS-003534 AIDS003534 Imidazo[4,5,1-jk][1,4]benzodiazepine-2(1H)-thione, 9-chloro-6-(cyclobutylmethyl)-4,5,6,7-tetrahydro-5-methyl-, (S)- R 85787 R85787 TIBO deriv.

pdb file: 597967.pdb
sdf file: 597967.sdf
directory: 597967


136722-75-3 AIDS-003535 AIDS003535 R 86085 R86085 TIBO deriv. midazo[4,5,1-jk][1,4]benzodiazepine-2(1H)-thione, 9-chloro-6-(2-cyclopropylethyl)-4,5,6,7-tetrahydro-5-methyl-, (S)-

pdb file: 597968.pdb
sdf file: 597968.sdf
directory: 597968


136722-76-4 AIDS-003536 AIDS003536 Imidazo[4,5,1-jk][1,4]benzodiazepine-2(1H)-thione, 9-chloro-6-(3-ethyl-2-pentenyl)-4,5,6,7-tetrahydro-5-methyl-, (S)- R86162 TIBO deriv.

pdb file: 597969.pdb
sdf file: 597969.sdf
directory: 597969


136722-78-6 AIDS-003537 AIDS003537 Cyanamide, [9-chloro-4,5,6,7-tetrahydro-5-methyl-6-(3-methyl-2-butenyl)imidazo[4,5,1-jk][1,4]benzodiazepin-2-yl]-, (S)- Imidazo[4,5,1-jk][1,4]benzodiazepine, cyanamide deriv TIBO deriv.

pdb file: 597970.pdb
sdf file: 597970.sdf
directory: 597970


136722-79-7 AIDS-003538 AIDS003538 Carbamic acid, [9-chloro-4,5,6,7-tetrahydro-5-methyl-6-(3-methyl-2-butenyl)imidazo[4,5,1-jk][1,4]benzodiazepin-2-yl]-, methyl ester, (S)- Imidazo[4,5,1-jk][1,4]benzodiazepine, carbamic acid deriv. TIBO deriv.

pdb file: 597971.pdb
sdf file: 597971.sdf
directory: 597971


136722-80-0 AIDS-003539 AIDS003539 Imidazo[4,5,1-jk][1,4]benzodiazepin-2-amine, 4,5,6,7-tetrahydro-N,5-dimethyl-6-(3-methyl-2-butenyl)- Imidazo[4,5,1-jk][1,4]benzodiazepin-2-amine, 4,5,6,7-tetrahydro-N,5-dimethyl-6-(3-methyl-2-butenyl)-, (1)- TIBO deriv.

pdb file: 597972.pdb
sdf file: 597972.sdf
directory: 597972


136722-81-1 AIDS-003540 AIDS003540 Imidazo[4,5,1-jk][1,4]benzodiazepin-2-amine, 4,5,6,7-tetrahydro-N,N,5-trimethyl-6-(3-methyl-2-butenyl)- Imidazo[4,5,1-jk][1,4]benzodiazepin-2-amine, 4,5,6,7-tetrahydro-N,N,5-trimethyl-6-(3-methyl-2-butenyl)-, (1)- TIBO deriv.

pdb file: 597973.pdb
sdf file: 597973.sdf
directory: 597973


136722-82-2 AIDS-003541 AIDS003541 Imidazo[4,5,1-jk][1,4]benzodiazepine, 4,5,6,7-tetrahydro-5-methyl-6-(3-methyl-2-butenyl)-2-(phenylthio)- Imidazo[4,5,1-jk][1,4]benzodiazepine, 4,5,6,7-tetrahydro-5-methyl-6-(3-methyl-2-butenyl)-2-(phenylthio)-, (1)- TIBO deriv.

pdb file: 597974.pdb
sdf file: 597974.sdf
directory: 597974


136722-84-4 (FUMARATE) AIDS-003542 AIDS003542 Imidazo[4,5,1-jk][1,4]benzodiazepine, 4,5,6,7-tetrahydro-2-methoxy-5-methyl-6-(3-methyl-2-butenyl)-, (2E)-2-butenedioate (2:3) TIBO deriv.

pdb file: 597975.pdb
sdf file: 597975.sdf
directory: 597975


136722-85-5 AIDS-003543 AIDS003543 Imidazo[4,5,1-jk][1,4]benzodiazepine-2(1H)-selone, 9-chloro-4,5,6,7-tetrahydro-5-methyl-6-(3-methyl-2-butenyl)-, (S)- TIBO deriv.

pdb file: 597976.pdb
sdf file: 597976.sdf
directory: 597976


136722-88-8 1H-[1,2,5]Thiadiazolo[4,3,2-jk][1,4]benzodiazepine, 9-chloro-6-(cyclopropylmethyl)-4,5,6,7-tetrahydro-5-methyl-, 2,2-dioxide 1H-[1,2,5]Thiadiazolo[4,3,2-jk][1,4]benzodiazepine, 9-chloro-6-(cyclopropylmethyl)-4,5,6,7-tetrahydro-5-methyl-, 2,2-dioxide, (1)- AIDS-003544 AIDS003544 TIBO deriv.

pdb file: 597977.pdb
sdf file: 597977.sdf
directory: 597977


136722-89-9 3H-Pyrazino[3,2,1-jk][1,4]benzodiazepin-3-one, 10-chloro-7-(cyclopropylmethyl)-1,2,5,6,7,8-hexahydro-6-methyl- 3H-Pyrazino[3,2,1-jk][1,4]benzodiazepin-3-one, 10-chloro-7-(cyclopropylmethyl)-1,2,5,6,7,8-hexahydro-6-methyl-, (1)- AIDS-003545 AIDS003545 TIBO deriv.

pdb file: 597978.pdb
sdf file: 597978.sdf
directory: 597978


136722-91-3 (FUMARATE) AIDS-003546 AIDS003546 Guanidine, [9-chloro-6-(cyclopropylmethyl)-4,5,6,7-tetrahydro-5-methylimidazo[4,5,1-jk][1,4]benzodiazepin-2-yl]-, (2E)-2-butenedioate (1:1) Imidazo[4,5,1-jk][1,4]benzodiazepine, guanidine deriv. TIBO deriv.

pdb file: 597979.pdb
sdf file: 597979.sdf
directory: 597979


136722-93-5 (MALEATE) 1H-1,4-Benzodiazepine-1-carbothioamide, 7-chloro-4-(cyclopropylmethyl)-2,3,4,5-tetrahydro-N,3-dimethyl-, (3S)-, (2Z)-2-butenedioate (1:1) AIDS-003547 AIDS003547 TIBO deriv.

pdb file: 597980.pdb
sdf file: 597980.sdf
directory: 597980


(+-)-4,5,6,7-Tetrahydro-5-methyl-6-(2-methyl-2-propenyl)-imidazo[4,5,1-jk][1,4]benzodiazepine (E)-2-Butenedioate AIDS-003548 AIDS003548 TIBO deriv.

pdb file: 597981.pdb
sdf file: 597981.sdf
directory: 597981


136723-00-7 1H-Pyrazino[3,2,1-jk][1,4]benzodiazepine-2,3-dione, 5,6,7,8-tetrahydro-6-methyl-7-propyl- AIDS-003549 AIDS003549 TIBO deriv.

pdb file: 597982.pdb
sdf file: 597982.sdf
directory: 597982


1,2,3-Triazolo[4,5,1-jk][1,4]benzodiazepine, 4,5,6,7-tetrahydro-5-methyl-6-propyl-, monohydrochloride 136723-01-8 AIDS-003550 AIDS003550 TIBO deriv.

pdb file: 597983.pdb
sdf file: 597983.sdf
directory: 597983


(+-)-4,5,6,7-Tetrahydro-1,5-dimethyl-6-propylimidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one 136723-02-9 AIDS-003551 AIDS003551 Imidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one, 4,5,6,7-tetrahydro-1,5-dimethyl-6-propyl- TIBO deriv.

pdb file: 597984.pdb
sdf file: 597984.sdf
directory: 597984


(+-)-4,5,6,7-Tetrahydro-1-isopropyl-5-methyl-6-propylimidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one 136723-03-0 AIDS-003552 AIDS003552 Imidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one, 4,5,6,7-tetrahydro-5-methyl-1-(1-methylethyl)-6-propyl- TIBO deriv.

pdb file: 597985.pdb
sdf file: 597985.sdf
directory: 597985


(+-)-4,5,6,7-Tetrahydro-1-allyl-5-methyl-6-propylimidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one 136723-04-1 AIDS-003553 AIDS003553 Imidazo[4,5,1-jk][1,4]benzodiazepin-2(1H)-one, 4,5,6,7-tetrahydro-5-methyl-1-(2-propenyl)-6-propyl- TIBO deriv.

pdb file: 597986.pdb
sdf file: 597986.sdf
directory: 597986


(+-)-4,5,6,7-Tetrahydro-5-methyl-2-oxo-6-propylimidazo[4,5,1-jk][1,4]benzodiazepine-1(2H)-acetonitrile 136723-05-2 AIDS-003554 AIDS003554 Imidazo[4,5,1-jk][1,4]benzodiazepine-1(2H)-acetonitrile, 4,5,6,7-tetrahydro-5-methyl-2-oxo-6-propyl- TIBO deriv.

pdb file: 597987.pdb
sdf file: 597987.sdf
directory: 597987


(+-)-6-(Cyclobutylmethyl)-4,5,6,7-tetrahydro-5-methyl-2H-oxazolo[5,4,3-jk][1,4]benzodiazepin-2-one & (E)-2-Butenedioate 136723-11-0 (FUMARATE) 2H-Oxazolo[5,4,3-jk][1,4]benzodiazepin-2-one, 6-(cyclobutylmethyl)-4,5,6,7-tetrahydro-5-methyl- & (2E)-2-butenedioate (1:1) AIDS-003555 AIDS003555 TIBO deriv.

pdb file: 597988.pdb
sdf file: 597988.sdf
directory: 597988


(+-)-3,4,5,6-Tetrahydro-2a-hydroxy-4-methyl-5-(2-methyl-2-propenyl)-2aH-azepino[5,4,3-cd]indol-2(1H)-one Monohydrochloride Ethanolate 136723-28-9 2H-Azepino[5,4,3-cd]indol-2-one, 1,2a,3,4,5,6-hexahydro-2a-hydroxy-4-methyl-5-(2-methyl-2-propenyl)-, monohydrochloride AIDS-003562 AIDS003562 TIBO deriv.

pdb file: 597995.pdb
sdf file: 597995.sdf
directory: 597995


3',4'-MeOxyT AIDS-003587 AIDS003587 Oxetan[2,3-c-]thymidine Oxetane deriv.

pdb file: 598019.pdb
sdf file: 598019.sdf
directory: 598019


AIDS-003588 AIDS003588 Oxetan[2,3-c-]thymidine-5'-sodiumphosphonate Oxetane deriv.

pdb file: 598020.pdb
sdf file: 598020.sdf
directory: 598020


3-Cyano-1-ethoxycarbonyl-4-imino-2-isopropyl-4-H-quinolizine 4-H-quinozoline deriv. AIDS-003611 AIDS003611 KAV-397

pdb file: 598043.pdb
sdf file: 598043.sdf
directory: 598043


9-(3,4-Bis(hydroxymethyl)cyclopentyl)guanine AIDS-003648 AIDS003648 Guanine deriv.

pdb file: 598080.pdb
sdf file: 598080.sdf
directory: 598080


(+/-)-6-Amino-9-[(1.beta.,3.alpha.,4.beta.)-3,4-bis(hydroxymethyl)cyclopentan-yl)]-9H-purine AIDS-003649 AIDS003649 NSC650985 Purine deriv.

pdb file: 598081.pdb
sdf file: 598081.sdf
directory: 598081


AIDS-003662 AIDS003662 Ac-Ser-Leu-Asn-Phe-psi [CH(OH)CH2N]Pro-Ile-OMe Hydroxyethylamine deriv. [N-(AcSerLeuAsn)-4-phenyl-3(S)-amino-2(S)-hydroxybutyl]Pro-Isoleucine methyl ester

pdb file: 598094.pdb
sdf file: 598094.sdf
directory: 598094


(2S)-N-((1S,2R)-3-{(1S,4S,6S)-3-aza-4-[N-(tert-butyl)carbamoyl]bicyclo[4.4.0]dec-3-yl}-2-hydroxy-1-benzylpropyl)-3-carbamoyl-2-[(phenylmethoxy)carbonylamino]propanamide 136522-18-4 AIDS-003663 AIDS003663 Hydroxyethylamine deriv. Ro31-8875 Z-Asn-Phe-psi [(R)-CH(OH)CH2N]DIQ-NH-tBu

pdb file: 598095.pdb
sdf file: 598095.sdf
directory: 598095


(S)-JG-365 AIDS-003664 AIDS003664 Ac-Ser-Leu-Asn-Phe-psi [CH(OH)CH2N]Pro-Ile-Val-OMe Hydroxyethylamine deriv. Methyl 1-{(2S,3S)-3-[(N-acetyl-L-seryl-L-leucyl-L-asparaginyl)amino]-2-hydroxy-4-phenylbutyl}-L-prolyl-L-isoleucyl-L-valinate

pdb file: 598096.pdb
sdf file: 598096.sdf
directory: 598096


AIDS-003665 AIDS003665 Hydroxyethylamine deriv. Methyl (2S)-2-(2-{[1-(3-{(2S)-3-carbamoyl-2-[(phenylmethoxy)carbonylamino]propanoylamino}(3S,2R)-2-hydroxy-4-phenylbutyl)pyrrolidin-2-yl]carbonylamino}(2S,3S)-3-methylpentanoylamino)-3-methylbutanoate Z-Asn-Phe-psi [(R)-CH(OH)CH2N]Pro-Ile-Val-OMe

pdb file: 598097.pdb
sdf file: 598097.sdf
directory: 598097


AIDS-003666 AIDS003666 Hydroxyethylamine deriv. Methyl (2S)-2-((2S)-2-{[(3S)-4-(3-{(2S)-3-carbamoyl-2-[(phenylmethoxy)carbonylamino]propanoylamino}(3S,2R)-2-hydroxy-4-phenylbutyl)-4-azabicyclo[4.4.0]dec-3-yl]carbonylamino}-3-methylpentanoylamino)-3-methylbutanoate Z-Asn-Phe-psi [(R)-CH(OH)CH2N]DIQ-Ile-Val-OMe

pdb file: 598098.pdb
sdf file: 598098.sdf
directory: 598098


131611-00-2 (TOSYLATE) AIDS-003671 AIDS003671 Aminoguanidine deriv. Hydrazinecarboximidamide, N-hydroxy-2-(phenylmethylene)-, mono(4-methylbenzenesulfonate) N1-Hydroxy-N3[(benzylidene)amino]guanidine tosylate

pdb file: 598103.pdb
sdf file: 598103.sdf
directory: 598103


139613-32-4 (TOSYLATE) AIDS-003672 AIDS003672 Aminoguanidine deriv. N1-Hydroxy-N3[(3-fluorobenzylidene)amino]guanidine tosylate

pdb file: 598104.pdb
sdf file: 598104.sdf
directory: 598104


139613-34-6 (TOSYLATE) AIDS-003673 AIDS003673 Aminoguanidine deriv. N1-Hydroxy-N3[(3-fluoro-4-methoxybenzylidene)amino]guanidine

pdb file: 598105.pdb
sdf file: 598105.sdf
directory: 598105


139613-36-8 (TOSYLATE) AIDS-003674 AIDS003674 Aminoguanidine deriv. N1-Hydroxy-N3[(3,4-dimethoxybenzylidene)amino]guanidine

pdb file: 598106.pdb
sdf file: 598106.sdf
directory: 598106


139613-38-0 (TOSYLATE) AIDS-003675 AIDS003675 Aminoguanidine deriv. N1-Hydroxy-N3[(3,4-dimethoxy-6-nitrobenzylidene)amino]guanidine

pdb file: 598107.pdb
sdf file: 598107.sdf
directory: 598107


139613-40-4 (TOSYLATE) AIDS-003676 AIDS003676 Aminoguanidine deriv. Hydrazinecarboximidamide, 2-[(2-bromo-4,5-dimethoxyphenyl)methylene]-N-hydroxy-, mono(4-methylbenzenesulfonate) N1-Hydroxy-N3[(6-bromo-3,4-dimethoxybenzylidene)amino]guanidine tosylate

pdb file: 598108.pdb
sdf file: 598108.sdf
directory: 598108


AIDS-003677 AIDS003677 Aminoguanidine deriv. N1-Hydroxy-N3[(3,4-dihydroxybenzylidene)amino]guanidine tosylate

pdb file: 598109.pdb
sdf file: 598109.sdf
directory: 598109


AIDS-003678 AIDS003678 Aminoguanidine deriv. N1-Hydroxy-N3[(3-hydroxy-4-methoxybenzylidene)amino]guanidine tosylate

pdb file: 598110.pdb
sdf file: 598110.sdf
directory: 598110


AIDS-003679 AIDS003679 Aminoguanidine deriv. N1-Hydroxy-N3[(4-hydroxy-3-methoxybenzylidene)amino]guanidine tosylate

pdb file: 598111.pdb
sdf file: 598111.sdf
directory: 598111


AIDS-003680 AIDS003680 Aminoguanidine deriv. N1-Hydroxy-N3[(6-chloro-4-hydroxy-3-methoxybenzylidene)amino]guanidine tosylate

pdb file: 598112.pdb
sdf file: 598112.sdf
directory: 598112


AIDS-003681 AIDS003681 Aminoguanidine deriv. N1-Hydroxy-N3[(2-chloro-3-hydroxy-4-methoxybenzylidene)amino]guanidine tosylate

pdb file: 598113.pdb
sdf file: 598113.sdf
directory: 598113


AIDS-003682 AIDS003682 Aminoguanidine deriv. N1-Hydroxy-N3[(2,4-dimethoxybenzylidene)amino]guanidine tosylate

pdb file: 598114.pdb
sdf file: 598114.sdf
directory: 598114


AIDS-003683 AIDS003683 Aminoguanidine deriv. N1-Hydroxy-N3[(2,4-dimethoxy-3-methylbenzylidene)amino]guanidine tosylate

pdb file: 598115.pdb
sdf file: 598115.sdf
directory: 598115


1-(2,3-Dideoxy-D-glycero-pent-2-enofuranosyl)-5-(methoxymethyl)uracil AIDS-003686 AIDS003686 NSC649647 Uracil deriv.

pdb file: 598118.pdb
sdf file: 598118.sdf
directory: 598118


1-[(2-Hydroxyethoxy)methyl]-6-[(2-methylphenyl)thio]thymine 125056-57-7 2'-MethylHEPT AIDS-003699 AIDS003699 HEPT deriv.

pdb file: 598125.pdb
sdf file: 598125.sdf
directory: 598125


125056-60-2 2'-ClHEPT 6-[(2-Chlorophenyl)thio]-1-[(2-hydroxyethoxy)methyl]thymine AIDS-003700 AIDS003700 HEPT deriv.

pdb file: 598126.pdb
sdf file: 598126.sdf
directory: 598126


1-[(2-Hydroxyethoxy)methyl]-6-[(2-nitrophenyl)thio]thymine 125056-66-8 2'-NO2HEPT AIDS-003701 AIDS003701 HEPT deriv.

pdb file: 598127.pdb
sdf file: 598127.sdf
directory: 598127


1-[(2-Hydroxyethoxy)methyl]-6-[(2-methoxyphenyl)thio]thymine 125056-63-5 2'-MeOHEPT AIDS-003702 AIDS003702 HEPT deriv.

pdb file: 598128.pdb
sdf file: 598128.sdf
directory: 598128


137897-65-5 3'-EtHEPT 6-[(3-Ethylphenyl)thio]-1-[(2-hydroxyethoxy)methyl]thymine AIDS-003703 AIDS003703 HEPT deriv.

pdb file: 598129.pdb
sdf file: 598129.sdf
directory: 598129


137897-66-6 3'-t-BuHEPT 6-[(3-tert-Butylphenyl)thio]-1-[(2-hydroxyethoxy)methyl]thymine AIDS-003704 AIDS003704 HEPT deriv.

pdb file: 598130.pdb
sdf file: 598130.sdf
directory: 598130


1-[(2-Hydroxyethoxy)methyl]-6-[[3-(hydroxymethyl)phenyl]thio]thymine 137897-67-7 3'-CH2OHHEPT AIDS-003705 AIDS003705 HEPT deriv.

pdb file: 598131.pdb
sdf file: 598131.sdf
directory: 598131


1-[(2-Hydroxyethoxy)methyl]-6-[[3-(trifluoromethyl)phenyl]thio]thymine 125056-75-9 3'-CF3HEPT AIDS-003706 AIDS003706 HEPT deriv.

pdb file: 598132.pdb
sdf file: 598132.sdf
directory: 598132


137897-68-8 3'-FHEPT 6-[(3-Fluorophenyl)thio]-1-[(2-hydroxyethoxy)methyl]thymine AIDS-003707 AIDS003707 HEPT deriv.

pdb file: 598133.pdb
sdf file: 598133.sdf
directory: 598133


125056-61-3 3'-ClHEPT 6-[(3-Chlorophenyl)thio]-1-[(2-hydroxyethoxy)methyl]thymine AIDS-003708 AIDS003708 HEPT deriv.

pdb file: 598134.pdb
sdf file: 598134.sdf
directory: 598134


137897-69-9 3'-BrHEPT 6-[(3-Bromophenyl)thio]-1-[(2-hydroxyethoxy)methyl]thymine AIDS-003709 AIDS003709 HEPT deriv.

pdb file: 598135.pdb
sdf file: 598135.sdf
directory: 598135


1-[(2-Hydroxyethoxy)methyl]-6-[(3-iodophenyl)thio]thymine 137897-70-2 3'-IHEPT AIDS-003710 AIDS003710 HEPT deriv.

pdb file: 598136.pdb
sdf file: 598136.sdf
directory: 598136


1-[(2-Hydroxyethoxy)methyl]-6-[(3-nitrophenyl)thio]thymine 125056-67-9 3'-NO2HEPT AIDS-003711 AIDS003711 HEPT deriv.

pdb file: 598137.pdb
sdf file: 598137.sdf
directory: 598137


1-[(2-Hydroxyethoxy)methyl]-6-[(3-hydroxyphenyl)thio]thymine 137897-71-3 3'-OHHEPT AIDS-003712 AIDS003712 HEPT deriv.

pdb file: 598138.pdb
sdf file: 598138.sdf
directory: 598138


1-[(2-Hydroxyethoxy)methyl]-6-[(3-methoxyphenyl)thio]thymine 125056-64-6 3'-MeOHEPT AIDS-003713 AIDS003713 HEPT deriv.

pdb file: 598139.pdb
sdf file: 598139.sdf
directory: 598139


1-[(2-Hydroxyethoxy)methyl]-6-[(4-methylphenyl)thio]thymine 125056-59-9 4'-MeHEPT AIDS-003714 AIDS003714 HEPT deriv.

pdb file: 598140.pdb
sdf file: 598140.sdf
directory: 598140


125056-65-7 4'-FHEPT 6-[(4-Fluorophenyl)thio]-1-[(2-hydroxyethoxy)methyl]thymine AIDS-003715 AIDS003715 HEPT deriv.

pdb file: 598141.pdb
sdf file: 598141.sdf
directory: 598141


125056-62-4 4'-ClHEPT 6-[(4-Chlorophenyl)thio]-1-[(2-hydroxyethoxy)methyl]thymine AIDS-003716 AIDS003716 HEPT deriv.

pdb file: 598142.pdb
sdf file: 598142.sdf
directory: 598142


1-[(2-Hydroxyethoxy)methyl]-6-[(4-nitrophenyl)thio]thymine 125056-68-0 4'-NO2HEPT AIDS-003717 AIDS003717 HEPT deriv.

pdb file: 598143.pdb
sdf file: 598143.sdf
directory: 598143


125056-69-1 4'-CNHEPT 6-[(4-Cyanophenyl)thio]-1-[(2-hydroxyethoxy)methyl]thymine AIDS-003718 AIDS003718 HEPT deriv.

pdb file: 598144.pdb
sdf file: 598144.sdf
directory: 598144


1-[(2-Hydroxyethoxy)methyl]-6-[(4-hydroxyphenyl)thio]thymine 137897-72-4 4'-OHHEPT AIDS-003719 AIDS003719 HEPT deriv.

pdb file: 598145.pdb
sdf file: 598145.sdf
directory: 598145


1-[(2-Hydroxyethoxy)methyl]-6-[(4-methoxyphenyl)thio]thymine 125083-80-9 4'-MeOHEPT AIDS-003720 AIDS003720 HEPT deriv.

pdb file: 598146.pdb
sdf file: 598146.sdf
directory: 598146


125056-77-1 3',5'-DiMeHEPT 6-[(3,5-Dimethylphenyl)thio]-1-[(2-hydroxyethoxy)methyl]thymine AIDS-003721 AIDS003721 HEPT deriv.

pdb file: 598147.pdb
sdf file: 598147.sdf
directory: 598147


125056-76-0 3',5'-DiClHEPT 6-[(3,5-Dichlorophenyl)thio]-1-[(2-hydroxyethoxy)methyl]thymine AIDS-003722 AIDS003722 HEPT deriv.

pdb file: 598148.pdb
sdf file: 598148.sdf
directory: 598148


137897-73-5 3',5'-DiMeHEPT-S 6-[(3,5-Dimethylphenyl)thio]-1-[(2-hydroxyethoxy)methyl]-2-thiothymine AIDS-003723 AIDS003723 HEPT deriv.

pdb file: 598149.pdb
sdf file: 598149.sdf
directory: 598149


1-[(2-Hydroxyethoxy)methyl]-6-[[3-(methoxycarbonyl)phenyl]thio]thymine 137897-74-6 3'-MeOCOHEPT AIDS-003724 AIDS003724 HEPT deriv.

pdb file: 598150.pdb
sdf file: 598150.sdf
directory: 598150


1-[(2-Hydroxyethoxy)methyl]-6-[[3-(methylcarbonyl)phenyl]thio]thymine 137897-75-7 3'-AcHEPT AIDS-003725 AIDS003725 HEPT deriv.

pdb file: 598151.pdb
sdf file: 598151.sdf
directory: 598151


1-[(2-Hydroxyethoxy)methyl]-6-[[4-(methylcarbonyl)phenyl]thio]thymine 125056-70-4 4'-AcHEPT AIDS-003726 AIDS003726 HEPT deriv.

pdb file: 598152.pdb
sdf file: 598152.sdf
directory: 598152


137897-77-9 3'-COOHHEPT 6-[(3-Carboxyphenyl)thio]-1-[(2-hydroxyethoxy)methyl]thymine AIDS-003727 AIDS003727 HEPT deriv.

pdb file: 598153.pdb
sdf file: 598153.sdf
directory: 598153


137897-78-0 3'-NH2COHEPT 6-[(3-Carbamoylphenyl)thio]-1-[(2-hydroxyethoxy)methyl]thymine AIDS-003728 AIDS003728 HEPT deriv.

pdb file: 598154.pdb
sdf file: 598154.sdf
directory: 598154


137897-80-4 3'-CNHEPT 6-[(3-Cyanophenyl)thio]-1-[(2-hydroxyethoxy)methyl]thymine AIDS-003729 AIDS003729 HEPT deriv.

pdb file: 598155.pdb
sdf file: 598155.sdf
directory: 598155


136011-41-1 5-Allyl-1-[(2-hydroxyethoxy)methyl]-6-(phenylthio)uracil 5-AllylHEPT AIDS-003730 AIDS003730 HEPT deriv.

pdb file: 598156.pdb
sdf file: 598156.sdf
directory: 598156


1-[(2-Hydroxyethoxy)methyl]-5-(methoxycarbonyl)-6-(phenylthio)uracil 137897-81-5 5-COOCH3HEPT AIDS-003731 AIDS003731 HEPT deriv.

pdb file: 598157.pdb
sdf file: 598157.sdf
directory: 598157


1-[(2-Hydroxyethoxy)methyl]-5-(phenylcarbamoyl)-6-(phenylthio)uracil 137897-82-6 5-CONHPhHEPT AIDS-003732 AIDS003732 HEPT deriv.

pdb file: 598158.pdb
sdf file: 598158.sdf
directory: 598158


137897-86-0 5-EtHEPT-S 5-Ethyl-1-[(2-hydroxyethoxy)methyl]-6-(phenylthio)-2-thiouracil AIDS-003733 AIDS003733 HEPT deriv.

pdb file: 598159.pdb
sdf file: 598159.sdf
directory: 598159


1-[(2-Hydroxyethoxy)methyl]-6-(phenylthio)-5-propyl-2-thiouracil 137897-87-1 5-PrHEPT-S AIDS-003734 AIDS003734 HEPT deriv.

pdb file: 598160.pdb
sdf file: 598160.sdf
directory: 598160


137897-88-2 5-Isopropyl-1-[(2-hydroxyethoxy)methyl]-6-(phenylthio)-2-thiouracil 5-iPrHEPT-S AIDS-003735 AIDS003735 HEPT deriv. I-HEPU-S

pdb file: 598161.pdb
sdf file: 598161.sdf
directory: 598161


137897-89-3 5-iPr-3',5'-DiMeHEPT-S 6-[(3,5-Dimethylphenyl)thio]-5-isopropyl-1-[(2-hydroxyethoxy)methyl]-2-thiouracil AIDS-003736 AIDS003736 HEPT deriv.

pdb file: 598162.pdb
sdf file: 598162.sdf
directory: 598162


137897-90-6 5-Et-3',5'-DiClHEPT-S 6-[(3,5-Dichlorophenyl)thio]-5-ethyl-1-[(2-hydroxyethoxy)methyl]-2-thiouracil AIDS-003737 AIDS003737 HEPT deriv.

pdb file: 598163.pdb
sdf file: 598163.sdf
directory: 598163


137897-91-7 5-Isopropyl-1-[(2-hydroxyethoxy)methyl]-6-(phenylthio)uracil 5-iPrHEPT AIDS-003738 AIDS003738 HEPT deriv. I-HEPU

pdb file: 598164.pdb
sdf file: 598164.sdf
directory: 598164


137897-92-8 5-iPr-3',5'-DiMeHEPT 6-(3,5-Dimethylphenyl)thio]-5-isopropyl-1-[(2-hydroxyethoxy)methyl]uracil AIDS-003739 AIDS003739 HEPT deriv. I-HEPU-dM

pdb file: 598165.pdb
sdf file: 598165.sdf
directory: 598165


137897-93-9 5-Et-3',5'-DiClHEPT 6-(3,5-Dichlorophenyl)thio]-5-ethyl-1-[(2-hydroxyethoxy)methyl]uracil AIDS-003740 AIDS003740 HEPT deriv.

pdb file: 598166.pdb
sdf file: 598166.sdf
directory: 598166


AIDS-003757 AIDS003757 DNA deriv. Synthetic polynucleotide d(C - C - C - C - C - C - C - C - C - C - C - C - C - C - C)

pdb file: 598182.pdb
sdf file: 598182.sdf
directory: 598182


AIDS-003758 AIDS003758 Dithioate DNA deriv. Synthetic polynucleotide d(CxCxCxCxCxCxCxCxCxCxCxCxCxC)

pdb file: 598183.pdb
sdf file: 598183.sdf
directory: 598183


AIDS-003759 AIDS003759 Dithioate DNA deriv. Synthetic polynucleotide d(CxCpCxCpCxCpCxCpCxCpCxCpCxCpC)

pdb file: 598184.pdb
sdf file: 598184.sdf
directory: 598184


AIDS-003760 AIDS003760 Dithioate DNA deriv. Synthetic polynucleotide d(TxTxTxTxTxTxTxTxTxTxTxTxTxT)

pdb file: 598185.pdb
sdf file: 598185.sdf
directory: 598185


AIDS-003761 AIDS003761 Dithioate DNA deriv. Synthetic polynucleotide d(AxAxAxAxAxAxAxAxAxAxAxAxAxA)

pdb file: 598186.pdb
sdf file: 598186.sdf
directory: 598186


AIDS-003762 AIDS003762 Dithioate DNA deriv. Synthetic polynucleotide d(CxCxCxCxCxCxCxCxCxCxCxCxCxCxCxCxCxCxCxC)

pdb file: 598187.pdb
sdf file: 598187.sdf
directory: 598187


AIDS-003778 AIDS003778 N-(1-{[((1S)-1-Carbamoyl-2-phenylethyl)amino](hydroxyphosphoryl)}-2-phenylethyl)-2,2,2-trifluoroacetamide Phosphonamidate deriv.

pdb file: 598203.pdb
sdf file: 598203.sdf
directory: 598203


(2S)-1-{[2-Phenyl-1-(2,2,2-trifluoroacetylamino)ethyl](hydroxyphosphoryl)}pyrrolidine-2-carboxamide AIDS-003779 AIDS003779 Phosphonamidate deriv.

pdb file: 598204.pdb
sdf file: 598204.sdf
directory: 598204


3-[6-(N^2-Benzyloxycarbonyl-L-lysine benzyl ester)]-1-methylurea AIDS-003791 AIDS003791 NSC634764 Urea deriv.

pdb file: 598216.pdb
sdf file: 598216.sdf
directory: 598216


3-[6-(N^2-Benzyloxycarbonyl-L-lysine benzyl ester)]-1-(2-propynyl)urea AIDS-003792 AIDS003792 NSC634770 Urea deriv.

pdb file: 598217.pdb
sdf file: 598217.sdf
directory: 598217


3-[6-(N^2-Benzyloxycarbonyl-L-lysine benzyl ester)]-1-methyl-1-nitrosourea AIDS-003793 AIDS003793 NSC634763 Nitrosourea deriv.

pdb file: 598218.pdb
sdf file: 598218.sdf
directory: 598218


3-[6-(N^2-Benzyloxycarbonyl-L-lysine benzyl ester)]-1-(2-propynyl)-1-nitrosourea AIDS-003794 AIDS003794 NSC636153 Nitrosourea deriv.

pdb file: 598219.pdb
sdf file: 598219.sdf
directory: 598219


3-[2-(N^6-Benzyloxycarbonyl-L-lysine benzyl ester)]-1-methylurea AIDS-003795 AIDS003795 NSC634762 Urea deriv.

pdb file: 598220.pdb
sdf file: 598220.sdf
directory: 598220


3-[2-(N^6-Benzyloxycarbonyl-L-lysine benzyl ester)]-1-(2-propynyl)urea AIDS-003796 AIDS003796 NSC634768 Urea deriv.

pdb file: 598221.pdb
sdf file: 598221.sdf
directory: 598221


3-[2-(N^6-Benzyloxycarbonyl-L-lysine benzyl ester)]-1-methyl-1-nitrosourea AIDS-003797 AIDS003797 NSC634765 Nitrosourea deriv.

pdb file: 598222.pdb
sdf file: 598222.sdf
directory: 598222


3-[2-(N^6-Benzyloxycarbonyl-L-lysine benzyl ester)]-1-(2-propynyl)-1-nitrosourea AIDS-003798 AIDS003798 NSC634769 Nitrosourea deriv.

pdb file: 598223.pdb
sdf file: 598223.sdf
directory: 598223


3-[2-(N^5-Benzyloxycarbonyl-L-ornithine benzyl ester)]-1-(2-propynyl)urea AIDS-003799 AIDS003799 NSC634766 Urea deriv.

pdb file: 598224.pdb
sdf file: 598224.sdf
directory: 598224


3-[2-(N^5-Benzyloxycarbonyl-L-ornithine benzyl ester)]-1-(2-propynyl)-1-nitrosourea AIDS-003800 AIDS003800 NSC634767 Nitrosourea deriv.

pdb file: 598225.pdb
sdf file: 598225.sdf
directory: 598225


138786-97-7 AIDS-003802 AIDS003802 N^1-.beta.-D-Ribofuranosylpyrazole-3-carboxamiide Pyrazole deriv.

pdb file: 598227.pdb
sdf file: 598227.sdf
directory: 598227


1-.beta.-D-Ribofuranosyl-4-nitro-pyrazole-3-carboxamide 138786-98-8 AIDS-003803 AIDS003803 Pyrazole deriv.

pdb file: 598228.pdb
sdf file: 598228.sdf
directory: 598228


1-.beta.-D-Ribofuranosyl-4-bromo-pyrazole-3-carboxamide 138786-99-9 AIDS-003804 AIDS003804 Pyrazole deriv.

pdb file: 598229.pdb
sdf file: 598229.sdf
directory: 598229


1-.beta.-D-Ribofuranosyl-5-methyl-4-nitropyrazole-3-carboxamide 138787-00-5 AIDS-003805 AIDS003805 Pyrazole deriv.

pdb file: 598230.pdb
sdf file: 598230.sdf
directory: 598230


1-.beta.-D-Ribofuranosyl-4-iodopyrazole-3-carboxamide 138787-01-6 AIDS-003806 AIDS003806 Pyrazole deriv.

pdb file: 598231.pdb
sdf file: 598231.sdf
directory: 598231


138787-11-8 7-Benzyl-3-methyl-N5-.beta.-D-ribofuranosylpyrazolo[4,3-d]-1,2,3-triazin-4-one AIDS-003807 AIDS003807 Pyrazolo[4,3-d]-1,2,3-triazin-4-one deriv.

pdb file: 598232.pdb
sdf file: 598232.sdf
directory: 598232


138787-13-0 7-Methyl-3-pentyl-N5-.beta.-D-ribofuranosylpyrazolo[4,3-d]-1,2,3-triazin-4-one AIDS-003808 AIDS003808 Pyrazolo[4,3-d]-1,2,3-triazin-4-one deriv.

pdb file: 598233.pdb
sdf file: 598233.sdf
directory: 598233


4-Amino-1-.beta.-D-ribofuranosyl-5-methylpyrazole-3-carboxamiide 61241-10-9 AIDS-003809 AIDS003809 Pyrazole deriv.

pdb file: 598234.pdb
sdf file: 598234.sdf
directory: 598234


1-(5'-O-Acetyl-3'-phthalimido-2',3'-dideoxy-.beta.-D-erythropentofuranosyl)-5-hydroxymethyluracil 5'-Ac-3'-phthalimido ddU deriv. AIDS-003820 AIDS003820

pdb file: 598245.pdb
sdf file: 598245.sdf
directory: 598245


1-(5'-O-Acetyl-3'-phthalimido-2',3'-dideoxy-.beta.-D-erythropentofuranosyl)-5-methoxymethyluracil 5'-Ac-3'-phthalimido ddU deriv. AIDS-003821 AIDS003821

pdb file: 598246.pdb
sdf file: 598246.sdf
directory: 598246


1-(5'-O-Acetyl-3'-phthalimido-2',3'-dideoxy-.beta.-D-erythropentofuranosyl)-5-(1-methylpropoxymethyl)uracil 5'-Ac-3'-phthalimido ddU deriv. AIDS-003822 AIDS003822

pdb file: 598247.pdb
sdf file: 598247.sdf
directory: 598247


1-(5'-O-Acetyl-3'-phthalimido-2',3'-dideoxy-.beta.-D-erythropentofuranosyl)-5-decyloxymethyluracil 5'-Ac-3'-phthalimido ddU deriv. AIDS-003823 AIDS003823

pdb file: 598248.pdb
sdf file: 598248.sdf
directory: 598248


1-(5'-O-Acetyl-3'-phthalimido-2',3'-dideoxy-.beta.-D-erythropentofuranosyl)-5-[2-(n-butoxy)ethoxymethyl]uracil 5'-Ac-3'-phthalimido ddU deriv. AIDS-003824 AIDS003824

pdb file: 598249.pdb
sdf file: 598249.sdf
directory: 598249


1-(3'-Amino-2',3'-dideoxy-.alpha.-D-erythro-pentofuranosyl)-5-benzyloxymethyluracil 5'-NH2 ddU deriv. AIDS-003825 AIDS003825

pdb file: 598250.pdb
sdf file: 598250.sdf
directory: 598250


3'-Amino-2',3'-dideoxy-5-hydroxymethyluridine 3'-NH2 ddU deriv. AIDS-003826 AIDS003826

pdb file: 598251.pdb
sdf file: 598251.sdf
directory: 598251


3'-Amino-2',3'-dideoxy-5-methoxymethyluridine 3'-NH2 ddU deriv. AIDS-003827 AIDS003827

pdb file: 598252.pdb
sdf file: 598252.sdf
directory: 598252


3'-Amino-2',3'-dideoxy-5-(1-methylpropoxymethyl)uridine 3'-NH2 ddU deriv. AIDS-003828 AIDS003828

pdb file: 598253.pdb
sdf file: 598253.sdf
directory: 598253


3'-Amino-2',3'-dideoxy-5-decyloxymethyluridine 3'-NH2 ddU deriv. AIDS-003829 AIDS003829

pdb file: 598254.pdb
sdf file: 598254.sdf
directory: 598254


3'-Amino-2',3'-dideoxy-5-[2-(n-butoxy)ethoxymethyl]uridine 3'-NH2 ddU deriv. AIDS-003830 AIDS003830

pdb file: 598255.pdb
sdf file: 598255.sdf
directory: 598255


3'-Amino-2',3'-dideoxy-5-benzyloxymethyluridine 3'-NH2 ddU deriv. AIDS-003831 AIDS003831

pdb file: 598256.pdb
sdf file: 598256.sdf
directory: 598256


3'-O-Acetylthymidine-5'-(propyl ethyl glycolyl)phosphate AIDS-003832 AIDS003832 Glycolyl phosphate deriv.

pdb file: 598257.pdb
sdf file: 598257.sdf
directory: 598257


3'-O-Acetylthymidine-5'-hexyl(ethyl glycolyl)phosphate AIDS-003833 AIDS003833 Glycolyl phosphate deriv.

pdb file: 598258.pdb
sdf file: 598258.sdf
directory: 598258


3'-Azido-3'-deoxythymidine-5'-propyl(ethyl glycolyl)phosphate AIDS-003834 AIDS003834 Glycolyl phosphate deriv.

pdb file: 598259.pdb
sdf file: 598259.sdf
directory: 598259


3'-Azido-3'-deoxythymidine-5'-dodecyl(ethyl glycolyl)phosphate AIDS-003835 AIDS003835 Glycolyl phosphate deriv.

pdb file: 598260.pdb
sdf file: 598260.sdf
directory: 598260


3'-Azido-3'-deoxythymidine-5'-methyl(methyl lactyl)phosphate AIDS-003836 AIDS003836 Lactyl phosphate deriv.

pdb file: 598261.pdb
sdf file: 598261.sdf
directory: 598261


3'-Azido-3'-deoxythymidine-5'-propyl(methyl lactyl)phosphate AIDS-003837 AIDS003837 Lactyl phosphate deriv.

pdb file: 598262.pdb
sdf file: 598262.sdf
directory: 598262


5'-(O-Phenyl-O-(2,2,2-trichloroethyl)phosphate)-3'-azido-3'-deoxythymidine AIDS-003838 AIDS003838 AZT deriv.

pdb file: 598263.pdb
sdf file: 598263.sdf
directory: 598263


5'-[O-(4-Nitrophenyl)-N-(methoxycarbonylethyl)phosphoramidate]-3'-azido-3'-deoxythymidine AIDS-003839 AIDS003839 AZT deriv.

pdb file: 598264.pdb
sdf file: 598264.sdf
directory: 598264


5'-[O-(2,2,2-Trichloroethyl)-N-(methoxycarbonylethyl)phosphoramidate]-3'-azido-3'-deoxythymidine AIDS-003840 AIDS003840 AZT deriv.

pdb file: 598265.pdb
sdf file: 598265.sdf
directory: 598265


3-(2-Hydroxyethylidene)-2-[((methoxycarbonyl-2-phenyleythyl)amino)carbonyl]-7-oxo-4-oxa-1-azabicyclo[3.2.0]heptane AIDS-003848 AIDS003848 Clavulanic acid deriv.

pdb file: 598273.pdb
sdf file: 598273.sdf
directory: 598273


3-(2-Hydroxyethylidene)-2-(benzylleucylphenylalanylcarbonyl)-7-oxo-4-oxa-1-azabicyclo[3.2.0]heptane AIDS-003849 AIDS003849 Clavulanic acid deriv.

pdb file: 598274.pdb
sdf file: 598274.sdf
directory: 598274


6-Amino-7-oxo-3,3-dimethyl-2-(methylphenylalanylcarbonyl)-4-thia-1-azabicyclo[3.2.0]heptane 6-Aminopenicillanic acid 6APA AIDS-003850 AIDS003850 Penicillanic acid deriv.

pdb file: 598275.pdb
sdf file: 598275.sdf
directory: 598275


141684-46-0 AIDS-003907 AIDS003907 XyloT TSAO deriv. [1-(.beta.-D-Xylofuranosyl)thymine]-3'-spiro-5-[4-amino-1,2-oxathiole2,2-dioxide]

pdb file: 598332.pdb
sdf file: 598332.sdf
directory: 598332


3'-Spiro-5-(4-amino-1,2-oxathiole-2,2-dioxide)ribofuranosylthymine AIDS-003908 AIDS003908 T TSAO deriv.

pdb file: 598333.pdb
sdf file: 598333.sdf
directory: 598333


141684-48-2 4-Hydroxy-3-[(2-t-butyl-5-methylpheny)thio]-6-[4-(2-methylthiazolemethoxy)phenyl]-2H-pyran-2-one AIDS-003910 AIDS003910 SilyriboT TSAO deriv. [1-[5'-O-(tert-butyldimethylsilyl)-.beta.-D-xylofuranosyl)thymine]-3'-spiro-5-(4-amino-1,2-oxathiole-2,2-dioxide)

pdb file: 598335.pdb
sdf file: 598335.sdf
directory: 598335


141706-86-7 AIDS-003925 AIDS003925 [1-[2',5'-Bis-O-(tert-butyldimethylsilyl)-.beta.-D-xylofuranosyl]uracil]-3'-spiro-5-[4-amino-1,2-oxathiole 2,2-dioxide] diSilyxyloU TSAO deriv.

pdb file: 598348.pdb
sdf file: 598348.sdf
directory: 598348


141684-51-7 AIDS-003926 AIDS003926 SilyxyloU TSAO deriv. [1-[2'-O-(tert-Butyldimethylsilyl)-.beta.-D-xylofuranosyl]uracil]-3'-spiro-5-[4-amino-1,2-oxathiole 2,2-dioxide

pdb file: 598349.pdb
sdf file: 598349.sdf
directory: 598349


141781-19-3 AIDS-003930 AIDS003930 N4-Acetyl-1-[2',5'-bis-O-(tert-butyldimethylsilyl)-.beta.-D-ribofuranosyl]cytosine]-3'-spiro-5-[4-amino-1,2-oxathiole 2,2-dioxide] diSilyC TSAO deriv.

pdb file: 598353.pdb
sdf file: 598353.sdf
directory: 598353


141684-56-2 AIDS-003931 AIDS003931 [N4-Acetyl-1-[2',5'-bis-O-(tert-butyldimethylsilyl)-.beta.-D-xylofuranosyl]cytosine]-3'-spiro-5-[4-amino-1,2-oxathiole 2,2-dioxide] diSilyxyloC TSAO deriv.

pdb file: 598354.pdb
sdf file: 598354.sdf
directory: 598354


2,2'-Bicyclam 2,2'-Bis(1,4,8,11-tetra-Azatetradecane) AIDS-003953 AIDS003953 Bis(tetraazacyclotetrdecane) deriv. JM1657

pdb file: 598374.pdb
sdf file: 598374.sdf
directory: 598374


AIDS-003961 AIDS003961 L685,434 deriv. N-[2(R)-Hydroxy-1(S)-indanyl]-5(S)-[[(1,1-dimethylethoxy)carbonyl]amino]-4(S)-hydroxy-6-phenyl-2(R)-(3-phenylprop-2-en-1-yl)hexanamide

pdb file: 598382.pdb
sdf file: 598382.sdf
directory: 598382


AIDS-003962 AIDS003962 L-685,434 deriv. N-[2(R)-Hydroxy-1(S)-indanyl]-5(S)-[[(1,1-dimethylethoxy)carbonyl]amino]-4(S)-hydroxy-6-phenyl-2(R)-(3-(4-hydroxyphenyl)prop-2-en-1-yl)hexanamide

pdb file: 598383.pdb
sdf file: 598383.sdf
directory: 598383


AIDS-003963 AIDS003963 L-685,434 deriv. N-[2(R)-Hydroxy-1(S)-indanyl]-5(S)-[[(1,1-dimethylethoxy)carbonyl]amino]-4(S)-hydroxy-6-phenyl-2(R)-[3-[4-(morpholinoethoxy)phenyl]prop-2-ene-1-yl]hexanamide

pdb file: 598384.pdb
sdf file: 598384.sdf
directory: 598384


AIDS-003964 AIDS003964 L-685,434 deriv. N-(2(R)-Hydroxy-1(S)-indanyl)-5(S)-[(tert-butyloxycarbonyl)amino]-4(S)-hydroxy-6-phenyl-2(R)-[(4-fluorophenyl)methyl]hexanamide

pdb file: 598385.pdb
sdf file: 598385.sdf
directory: 598385


AIDS-003965 AIDS003965 L-685,434 deriv. N-(2(R)-Hydroxy-1(S)-indanyl)-5(S)-[(tert-butyloxycarbonyl)amino]-4(S)-hydroxy-6-phenyl-2(R)-[(4-iodophenyl)methyl]hexanamide

pdb file: 598386.pdb
sdf file: 598386.sdf
directory: 598386


AIDS-003966 AIDS003966 L-685,434 deriv. N-[2(R)-Hydroxy-1(S)-indanyl]-5(S)-[[(1,1-dimethylethoxy)carbonyl]amino]-4(S)-hydroxy-6-phenyl-2(R)-[(4-nitrobenzyl)methyl]hexanamide

pdb file: 598387.pdb
sdf file: 598387.sdf
directory: 598387


AIDS-003967 AIDS003967 L-685,434 deriv. N-(2(R)-Hydroxy-1(S)-indanyl)-5(S)-[(tert-butyloxycarbonyl)amino]-4(S)-hydroxy-6-phenyl-2(R)-4-[2-(4-aminophenyl)methyl]hexanamide

pdb file: 598388.pdb
sdf file: 598388.sdf
directory: 598388


AIDS-003968 AIDS003968 L-685,434 deriv. N-(2(R)-Hydroxy-1(S)-indanyl)-5(S)-[(tert-butyloxycarbonyl)amino]-4(S)-hydroxy-6-phenyl-2(R)-[(4-methylphenyl)methyl]hexanamide

pdb file: 598389.pdb
sdf file: 598389.sdf
directory: 598389


AIDS-003969 AIDS003969 L-685,434 deriv. N-(2(R)-Hydroxy-1(S)-indanyl)-5(S)-[(tert-butyloxycarbonyl)amino]-4(S)-hydroxy-6-phenyl-2(R)-4-[2-(4-tert-butylphenyl)methyl]hexanamide

pdb file: 598390.pdb
sdf file: 598390.sdf
directory: 598390


AIDS-003970 AIDS003970 L-685,434 deriv. N-[2(R)-Hydroxy-1(S)-indanyl]-5(S)-[[(1,1-dimethylethoxy)carbonyl]amino]-4(S)-hydroxy-6-phenyl-2(R)-[(4-trifluorobenzyl)methyl]hexanamide

pdb file: 598391.pdb
sdf file: 598391.sdf
directory: 598391


AIDS-003971 AIDS003971 L-685,434 deriv. N-[2(R)-Hydroxy-1(S)-indanyl]-5(S)-[[(1,1-dimethylethoxy)carbonyl]amino]-4(S)-hydroxy-6-phenyl-2(R)-(2,3,4,5,6-pentafluorobenzyl)hexanamide

pdb file: 598392.pdb
sdf file: 598392.sdf
directory: 598392


AIDS-003972 AIDS003972 L-685,434 deriv. N-[2(R)-Hydroxy-1(S)-indanyl]-5(S)-[[(1,1-dimethylethoxy)carbonyl]amino]-4(S)-hydroxy-6-phenyl-2(R)-(4-methylthiobenzyl)hexanamide

pdb file: 598393.pdb
sdf file: 598393.sdf
directory: 598393


AIDS-003973 AIDS003973 L-685,434 deriv. N-[2(R)-Hydroxy-1(S)-indanyl]-5(S)-[[(1,1-dimethylethoxy)carbonyl]amino]-4(S)-hydroxy-6-phenyl-2(R)-(4-sulfinylmethylbenzyl)hexanamide

pdb file: 598394.pdb
sdf file: 598394.sdf
directory: 598394


AIDS-003974 AIDS003974 L-685,434 deriv. N-[2(R)-Hydroxy-1(S)-indanyl]-5(S)-[[(1,1-dimethylethoxy)carbonyl]amino]-4(S)-hydroxy-6-phenyl-2(R)-(4-sulfonylmethylbenzyl)hexanamide

pdb file: 598395.pdb
sdf file: 598395.sdf
directory: 598395


AIDS-003975 AIDS003975 L-685,434 deriv. N-[2(R)-Hydroxy-1(S)-indanyl]-5(S)-[[(1,1-dimethylethoxy)carbonyl]amino]-4(S)-hydroxy-6-phenyl-2(R)-(3-hydroxybenzyl)hexanamide

pdb file: 598396.pdb
sdf file: 598396.sdf
directory: 598396


AIDS-003976 AIDS003976 L-685,434 deriv. N-[2(R)-Hydroxy-1(S)-indanyl]-5(S)-[[(1,1-dimethylethoxy)carbonyl]amino]-4(S)-hydroxy-6-phenyl-2(R)-(4-hydroxybenzyl)hexanamide

pdb file: 598397.pdb
sdf file: 598397.sdf
directory: 598397


AIDS-003977 AIDS003977 L-685,434 deriv. N-[2(R)-Hydroxy-1(S)-indanyl]-5(S)-[[(1,1-dimethylethoxy)carbonyl]amino]-4(S)-hydroxy-6-phenyl-2(R)-[(4-hydroxymethyl)benzyl]hexanamide

pdb file: 598398.pdb
sdf file: 598398.sdf
directory: 598398


AIDS-003978 AIDS003978 L-685,434 deriv. N-[2(R)-Hydroxy-1(S)-indanyl]-5(S)-[[(1,1-dimethylethoxy)carbonyl]amino]-4(S)-hydroxy-6-phenyl-2(R)-[(4-hydroxyethyl)benzyl]hexanamide

pdb file: 598399.pdb
sdf file: 598399.sdf
directory: 598399


AIDS-003980 AIDS003980 L-685,434 deriv. N-[2(R)-Hydroxy-1(S)-indanyl]-5(S)-[[(1,1-dimethylethoxy)carbonyl]amino]-4(S)-hydroxy-6-phenyl-2(R)-[(4-methoxyethoxymethoxyethyl)benzyl]hexanamide

pdb file: 598401.pdb
sdf file: 598401.sdf
directory: 598401


AIDS-003981 AIDS003981 L685,434 deriv. N-[2(R)-Hydroxy-1(S)-indanyl]-5(S)-[[(1,1-dimethylethoxy)carbonyl]amino]-4(S)-hydroxy-6-phenyl-2(R)-[(4-methoxyethoxymethoxypropyl)benzyl]hexanamide

pdb file: 598402.pdb
sdf file: 598402.sdf
directory: 598402


AIDS-003982 AIDS003982 L685,434 deriv. N-[2(R)-Hydroxy-1(S)-indanyl]-5(S)-[[(1,1-dimethylethoxy)carbonyl]amino]-4(S)-hydroxy-6-phenyl-2(R)-[[4-(3,3-dimethoxypropyl)phenyl]methyl]hexanamide

pdb file: 598403.pdb
sdf file: 598403.sdf
directory: 598403


AIDS-003983 AIDS003983 L685,434 deriv. N-[2(R)-Hydroxy-1(S)-indanyl]-5(S)-[[(1,1-dimethylethoxy)carbonyl]amino]-4(S)-hydroxy-6-phenyl-2(R)-[[4-(3-morpholino)propyl]benzyl]hexanamide

pdb file: 598404.pdb
sdf file: 598404.sdf
directory: 598404


AIDS-003984 AIDS003984 L-685,434 deriv. N-(2(R)-Hydroxy-1(S)-indanyl)-5(S)-[(tert-butyloxycarbonyl)amino]-4(S)-hydroxy-6-phenyl-2(R)-[[4-[3-bis(2-methoxyethyl)amino]propyl]phenyl]methyl]hexanamide

pdb file: 598405.pdb
sdf file: 598405.sdf
directory: 598405


AIDS-003985 AIDS003985 L-685,434 deriv. N-(2(R)-Hydroxy-1(S)-indanyl)-5(S)-[(tert-butyloxycarbonyl)amino]-4(S)-hydroxy-6-phenyl-2(R)-[[(4-thiomorpholino)propyl]phenyl]methyl]hexanamide

pdb file: 598406.pdb
sdf file: 598406.sdf
directory: 598406


AIDS-003986 AIDS003986 L-685,434 deriv. N-(2(R)-Hydroxy-1(S)-indanyl)-5(S)-[(tert-butyloxycarbonyl)amino]-4(S)-hydroxy-6-phenyl-2(R)-[[(4-(3-dimethylaminopropyl)phenyl]methyl]hexanamide

pdb file: 598407.pdb
sdf file: 598407.sdf
directory: 598407


AIDS-003987 AIDS003987 L-685,434 deriv. N-(2(R)-Hydroxy-1(S)-indanyl)-5(S)-[(tert-butyloxycarbonyl)amino]-4(S)-hydroxy-6-phenyl-2(R)-[[(4-dimethylaminoethyl)phenyl]methyl]hexanamide

pdb file: 598408.pdb
sdf file: 598408.sdf
directory: 598408


AIDS-003988 AIDS003988 L-685,434 deriv. N-[2(R)-Hydroxy-1(S)-indanyl)-5(S)-[(tert-butyloxycarbonyl)amino]-4(S)-hydroxy-6-phenyl-2(R)-[[(4-morpholinomethyl)phenyl]methyl]hexanamide

pdb file: 598409.pdb
sdf file: 598409.sdf
directory: 598409


AIDS-003989 AIDS003989 L-685,434 deriv. N-[2(R)-Hydroxy-1(S)-indanyl)-5(S)-[(tert-butyloxycarbonyl)amino]-4(S)-hydroxy-6-phenyl-2(R)-[[4-[(3-trimethylamino]propyl]phenyl]methyl]hexanamide Iodide

pdb file: 598410.pdb
sdf file: 598410.sdf
directory: 598410


AIDS-003990 AIDS003990 L-685,434 deriv. N-[2(R)-Hydroxy-1(S)-indanyl]-5(S)-[[(1,1-dimethylethoxy)carbonyl]amino]-4(S)-hydroxy-6-phenyl-2(R)-pentadecylhexanamide

pdb file: 598411.pdb
sdf file: 598411.sdf
directory: 598411


AIDS-003991 AIDS003991 L-685,434 deriv. N-[2(R)-Hydroxy-1(S)-indanyl]-5(S)-[[(1,1-dimethylethoxy)carbonyl]amino]-4(S)-hydroxy-6-phenyl-2(R)-ethylhexanamide

pdb file: 598412.pdb
sdf file: 598412.sdf
directory: 598412


AIDS-003992 AIDS003992 L-685,434 deriv. N-[2(R)-Hydroxy-1(S)-indanyl]-5(S)-[[(1,1-dimethylethoxy)carbonyl]amino]-4(S)-hydroxy-6-phenyl-2(R)-methylhexanamide

pdb file: 598413.pdb
sdf file: 598413.sdf
directory: 598413


AIDS-003993 AIDS003993 L-685,434 deriv. N-[2(R)-Hydroxy-1(S)-indanyl]-5(S)-[[(1,1-dimethylethoxy)carbonyl]amino]-4(S)-hydroxy-6-phenyl-2(R)-(2-quinoxalinoethyl)hexanamide

pdb file: 598414.pdb
sdf file: 598414.sdf
directory: 598414


AIDS-004104 AIDS004104 L685,434 deriv. N-(2(R)-Hydroxy-1(S)-indanyl)-5(S)-[(tert-butyloxycarbonyl)amino]-4(S)-hydroxy-6-phenyl-2(R)-[[4-(benzyloxy)phenyl]methyl]hexanamide

pdb file: 598524.pdb
sdf file: 598524.sdf
directory: 598524


AIDS-004105 AIDS004105 L685,434 deriv. N-(2(R)-Hydroxy-1(S)-indanyl)-5(S)-[(tert-butyloxycarbonyl)amino]-4(S)-hydroxy-6-(4-hydroxyphenyl)-2-(R)-(phenylmethyl)hexanamide

pdb file: 598525.pdb
sdf file: 598525.sdf
directory: 598525


AIDS-004106 AIDS004106 L685,434 deriv. N-(2(R)-Hydroxy-1(S)-indanyl)-5(S)-[(tert-butyloxycarbonyl)amino]-4(S)-hydroxy-6-(4-hydroxyphenyl)-2-(R)-[(4-hydroxyphenyl)methyl]hexanamide

pdb file: 598526.pdb
sdf file: 598526.sdf
directory: 598526


AIDS-004107 AIDS004107 L685,434 deriv. N-(2(R)-Hydroxy-1(S)-indanyl)-5(S)-[(tert-butyloxycarbonyl)amino]-4(S)-hydroxy-6-[4-[2-(4-morpholinyl)ethoxy]phenyl]-2(R)-(phenylmethyl)hexanamide

pdb file: 598527.pdb
sdf file: 598527.sdf
directory: 598527


AIDS-004108 AIDS004108 L685,434 deriv. N-(2(R)-Hydroxy-1(S)-indanyl)-2(R),5(S)-di[[4-[2-(4-morpholinyl)ethoxy]phenyl]methyl]-5(S)-[(tert-butyloxycarbonyl)amino]-4(S)-hydroxypentamide

pdb file: 598528.pdb
sdf file: 598528.sdf
directory: 598528


AIDS-004109 AIDS004109 L685,434 deriv. N-(2(R)-Hydroxy-1(S)-indanyl)-5(S)-[(tert-butyloxycarbonyl)amino]-4(S)-hydroxy-2(R)-[[4-[3-(4-morpholinyl)propoxy]phenyl]methyl]-6-phenylhexanamide

pdb file: 598529.pdb
sdf file: 598529.sdf
directory: 598529


AIDS-004110 AIDS004110 L685,434 deriv. N-(2(R)-Hydroxy-1(S)-indanyl)-5(S)-[(tert-butyloxycarbonyl)amino]-4(S)-hydroxy-2(R)-[[4-(2-dimethylamino)ethoxy]phenyl]methyl]-6-phenylhexanamide

pdb file: 598530.pdb
sdf file: 598530.sdf
directory: 598530


AIDS-004111 AIDS004111 L685,434 deriv. N-[2(R)-Hydroxy-1(S)-indanyl)-5(S)-[(tert-butyloxycarbonyl)amino]-4(S)-hydroxy-6-phenyl-2(R)-[[4-[2-(1-piperidinyl)ethoxy]phenyl]methyl]hexanamide

pdb file: 598531.pdb
sdf file: 598531.sdf
directory: 598531


AIDS-004112 AIDS004112 L685,434 deriv. N-[2(R)-Hydroxy-1(S)-indanyl)-5(S)-[(tert-butyloxycarbonyl)amino]-4(S)-hydroxy-6-phenyl-2(R)-[[4-[2-(1-pyrrolidinyl)ethoxy]phenyl]methyl]hexanamide

pdb file: 598532.pdb
sdf file: 598532.sdf
directory: 598532


AIDS-004113 AIDS004113 L685,434 deriv. N-[2(R)-Hydroxy-1(S)-indanyl)-5(S)-[(tert-butyloxycarbonyl)amino]-4(S)-hydroxy-6-phenyl-2(R)-[[4-[2-(4-methylpiperazin-1-yl)ethoxy]phenyl]methyl]hexanamide

pdb file: 598533.pdb
sdf file: 598533.sdf
directory: 598533


AIDS-004114 AIDS004114 L685,434 deriv. N-[2(R)-Hydroxy-1(S)-indanyl)-5(S)-[(tert-butyloxycarbonyl)amino]-4(S)-hydroxy-6-phenyl-2(R)-[[4-[2-(N,N-bis(2-methoxyethyl)amino]ethoxy]phenyl]methyl]hexanamide

pdb file: 598534.pdb
sdf file: 598534.sdf
directory: 598534


AIDS-004115 AIDS004115 L685,434 deriv. N-[2(R)-Hydroxy-1(S)-indanyl)-5(S)-[(tert-butyloxycarbonyl)amino]-4(S)-hydroxy-6-phenyl-2(R)-[[4-[2-(thiamorpholin-4-yl)ethoxy]phenyl]methyl]hexanamide

pdb file: 598535.pdb
sdf file: 598535.sdf
directory: 598535


AIDS-004116 AIDS004116 L685,434 deriv. N-[2(R)-Hydroxy-1(S)-indanyl)-5(S)-[(tert-butyloxycarbonyl)amino]-4(S)-hydroxy-6-phenyl-2(R)-[[4-[2-(1-oxathiamorpholin-4-yl)ethoxy]phenyl]methyl]hexanamide

pdb file: 598536.pdb
sdf file: 598536.sdf
directory: 598536


AIDS-004117 AIDS004117 L685,434 deriv. N-[2(R)-Hydroxy-1(S)-indanyl)-5(S)-[(tert-butyloxycarbonyl)amino]-4(S)-hydroxy-6-phenyl-2(R)-[[4-[2-(1,1-dioxythiamorpholin-4-yl)ethoxy]phenyl]methyl]hexanamide

pdb file: 598537.pdb
sdf file: 598537.sdf
directory: 598537


AIDS-004118 AIDS004118 L685,434 deriv. N-[2(R)-Hydroxy-1(S)-indanyl)-5(S)-[(tert-butyloxycarbonyl)amino]-4(S)-hydroxy-6-phenyl-2(R)-[[4-[2-(4-oxo-4-morpholinyl)ethoxy]phenyl]methyl]hexanamide

pdb file: 598538.pdb
sdf file: 598538.sdf
directory: 598538


AIDS-004119 AIDS004119 L685,434 deriv. N-[2(R)-Hydroxy-1(S)-indanyl)-5(S)-[(tert-butyloxycarbonyl)amino]-4(S)-hydroxy-6-phenyl-2(R)-[[4-(2-hydroxyethoxy)phenyl]methyl]hexanamide

pdb file: 598539.pdb
sdf file: 598539.sdf
directory: 598539


AIDS-004120 AIDS004120 L685,434 deriv. N-[2(R)-Hydroxy-1(S)-indanyl)-5(S)-[(tert-butyloxycarbonyl)amino]-4(S)-hydroxy-6-phenyl-2(R)-[[4-[2-oxo-2-(4-morpholinyl)ethoxy]phenyl]methyl]hexanamide

pdb file: 598540.pdb
sdf file: 598540.sdf
directory: 598540


(+/-)-16-.alpha., 20-Dihydroxykauran-19-oic Acid 19-20-Lactone (+/-)-Tripterifordin AIDS-004233 AIDS004233 Diterpene deriv.

pdb file: 598651.pdb
sdf file: 598651.sdf
directory: 598651


8-Hydroxy-7-((4-(2-(4-((8-hydroxy-5-sulfo-7-quinolinyl)diazenyl)-2-sulfophenyl)vinyl)-3-sulfophenyl)diazenyl)-5-quinolinesulfonic acid compound with tetramethyl-lambda~5~-azane (1:1) AIDS-004236 AIDS004236 NSC651686 Quinobene Salt derivative

pdb file: 598654.pdb
sdf file: 598654.sdf
directory: 598654


AIDS-004278 AIDS004278 T6 Tachyplesin deriv.

pdb file: 598683.pdb
sdf file: 598683.sdf
directory: 598683


1,3-Diazepin-2-one deriv. 153223-14-4 2H-1,3-Diazepin-2-one, hexahydro-5,6-dihydroxy-4,7-bis(phenylmethyl)-1,3-di-2-propenyl-, (4R,5S,6S,7R)- AIDS-004346 AIDS004346 CU [4R-(4.alpha.,5.alpha.,6.beta.,7.beta.)]-1,3-Diallyl-5,6-dihydroxy-4,7-dibenzyl-1,3-diazepin-2-one

pdb file: 600013.pdb
sdf file: 600013.sdf
directory: 600013


1,3-Diazepin-2-one deriv. AIDS-004347 AIDS004347 CU [4R-(4.alpha.,5.alpha.,6.beta.,7.beta.)]-Hexahydro-4,7-dibenzyl-5,6-dihydroxy-2H-1,3-diazepin-2-one

pdb file: 600014.pdb
sdf file: 600014.sdf
directory: 600014


4,7-Dibenzyl-5,6-dihydroxy-1,3-bis(3,7-dimethyloctyl)hexahydro-1,3-diazepin-2-one AIDS-004348 AIDS004348 Diazepine cyclic urea deriv.

pdb file: 600015.pdb
sdf file: 600015.sdf
directory: 600015


AIDS-004358 AIDS004358 T5 Tachyplesin deriv. W-C-F-R-V-C-Y-R-G-I-C-Y-R-R-C-R-C-R-NH2

pdb file: 600025.pdb
sdf file: 600025.sdf
directory: 600025


AIDS-004360 AIDS004360 K-F-C-F-R-V-C-F-R-G-I-C-F-R-R-C-R-C-NH2 K-F-C-F-R-V-C-F-R-G-I-C-F-R-R-C-R-C-NH2;Tachyplesin deriv. T7

pdb file: 600027.pdb
sdf file: 600027.sdf
directory: 600027


AIDS-004361 AIDS004361 K-W-C-F-R-V-C-F-R-G-I-C-F-R-R-C-R-C-NH2 K-W-C-F-R-V-C-F-R-G-I-C-F-R-R-C-R-C-NH2;Tachyplesin deriv. T8

pdb file: 600028.pdb
sdf file: 600028.sdf
directory: 600028


AIDS-004362 AIDS004362 K-W-A-F-R-V-A-Y-R-G-I-A-Y-R-R-A-R-C-NH2 T9 Tachyplesin deriv.

pdb file: 600029.pdb
sdf file: 600029.sdf
directory: 600029


AIDS-004363 AIDS004363 K-W-A-F-R-V-A-Y-R-G-I-A-Y-R-R-A-R-C-NH2 T10 Tachyplesin deriv.

pdb file: 600030.pdb
sdf file: 600030.sdf
directory: 600030


AIDS-004364 AIDS004364 R-W-C-Y-R-K-C-Y-R-G-I-C-Y-R-K-C-R-C-NH2 T11 Tachyplesin deriv.

pdb file: 600031.pdb
sdf file: 600031.sdf
directory: 600031


AIDS-004365 AIDS004365 T12 Tachyplesin deriv. W-C-Y-R-K-C-Y-R-G-I-C-Y-R-K-C-R-C-NH2

pdb file: 600032.pdb
sdf file: 600032.sdf
directory: 600032


A-W-C-Y-R-K-C-Y-R-G-I-C-Y-R-K-C-R-C-NH2 AIDS-004366 AIDS004366 T13 Tachyplesin deriv.

pdb file: 600033.pdb
sdf file: 600033.sdf
directory: 600033


AIDS-004367 AIDS004367 R-W-C-Y-R-K-C-Y-K-G-I-C-Y-R-K-C-R-C-NH2 R-W-C-Y-R-K-C-Y-K-G-I-C-Y-R-K-C-R-C-NH2;Tachyplesin deriv. T14

pdb file: 600034.pdb
sdf file: 600034.sdf
directory: 600034


AIDS-004368 AIDS004368 R-W-C-Y-R-K-C-Y-K-G-F-C-Y-R-K-C-R-C-NH2 T15 Tachyplesin deriv.

pdb file: 600035.pdb
sdf file: 600035.sdf
directory: 600035


AIDS-004398 AIDS004398 Pyrrolo[1,2-d][1,4]benzodiazepin-6-one TIBO deriv.

pdb file: 600065.pdb
sdf file: 600065.sdf
directory: 600065


3-Formylpyrrolo[1,2-d][1,4]benzodiazepin-6-one AIDS-004399 AIDS004399 TIBO deriv.

pdb file: 600066.pdb
sdf file: 600066.sdf
directory: 600066


5-Benzyl-3-formylpyrrolo[1,2-d][1,4]benzodiazepin-6-one AIDS-004400 AIDS004400 TIBO deriv.

pdb file: 600067.pdb
sdf file: 600067.sdf
directory: 600067


5-Benzylpyrrolo[1,2-d][1,4]-benzodiazepin-6-one AIDS-004401 AIDS004401 TIBO deriv.

pdb file: 600068.pdb
sdf file: 600068.sdf
directory: 600068


5-(4-Hydroxybenzyl)pyrrolo[1,2-d][1,4]-benzodiazepin-6-one AIDS-004402 AIDS004402 TIBO deriv.

pdb file: 600069.pdb
sdf file: 600069.sdf
directory: 600069


5-(4-Hydroxybenzyl)-7-methylpyrrolo[1,2-d][1,4]-benzodiazepin-6-one AIDS-004403 AIDS004403 TIBO deriv.

pdb file: 600070.pdb
sdf file: 600070.sdf
directory: 600070


5-(4-Hydroxybenzyl)-7-[2-(4-hydroxyphenyl)ethyl]pyrrolo[1,2-d][1,4]-benzodiazepin-6-one AIDS-004404 AIDS004404 TIBO deriv.

pdb file: 600071.pdb
sdf file: 600071.sdf
directory: 600071


5-(4-Hydroxybenzyl)-7-(5-pthalimidylpentyl)pyrrolo[1,2-d][1,4]-benzodiazepin-6-one AIDS-004405 AIDS004405 TIBO deriv.

pdb file: 600072.pdb
sdf file: 600072.sdf
directory: 600072


6-Oxopyrrolo[1,2-d][1,4]-benzodiazepine-5-acetic acid AIDS-004406 AIDS004406 TIBO deriv.

pdb file: 600073.pdb
sdf file: 600073.sdf
directory: 600073


5-(4-Hydroxybenzyl)-7-(4-pthalimidylbutyl)pyrrolo[1,2-d][1,4]-benzodiazepin-6-one AIDS-004407 AIDS004407 TIBO deriv.

pdb file: 600074.pdb
sdf file: 600074.sdf
directory: 600074


145631-03-4 AIDS-004498 AIDS004498 Carbamic acid, [(1S,2S,4R)-5-[[(1S,2R)-2,3-dihydro-2-hydroxy-1H-inden-1-yl]amino]-2-hydroxy-5-oxo-1,4-bis(phenylmethyl)pentyl]-, (3S)-tetrahydro-3-furanyl ester L685,434 deriv. N-[2(R)-Hydroxy-1(S)-indanyl]-5-(S)-[[(3(S)-tetrahydrofuranyloxy)carbonyl]amino]-4(S)-hydroxy-6-phenyl-2(R)-benzylhexanamide

pdb file: 600164.pdb
sdf file: 600164.sdf
directory: 600164


145680-03-1 AIDS-004499 AIDS004499 Carbamic acid, [5-[(2,3-dihydro-2-hydroxy-1H-inden-1-yl)amino]-2-hydroxy-5-oxo-1,4-bis(phenylmethyl)pentyl]-, tetrahydro-3-furanyl ester, [1S-[1.alpha.[1R*(S*),2R*,4S*],2.alpha.]]- L685,434 deriv. N-[2-(R)-Hydroxy-1(S)-indanyl]-5(S)-[[3(R)-tetrahydrofuranyloxy)carbonyl]amino]-4(S)-hydroxy-6-phenyl-2(R)-benzylhexanamide

pdb file: 600165.pdb
sdf file: 600165.sdf
directory: 600165


145631-04-5 AIDS-004500 AIDS004500 Carbamic acid, [5-[(2,3-dihydro-2-hydroxy-1H-inden-1-yl)amino]-2-hydroxy-5-oxo-1,4-bis(phenylmethyl)pentyl]-, cyclopentyl ester, [1S-[1.alpha.(1R*,2R*,4S*),2.alpha.]]- L685,434 deriv. N-[2-(R)-Hydroxy-1(S)-indanyl]-5(S)-[[(cyclopentyloxy)carbonyl]amino]-4(S)-hydroxy-6-phenyl-2(R)-benzylhexanamide

pdb file: 600166.pdb
sdf file: 600166.sdf
directory: 600166


145631-05-6 AIDS-004501 AIDS004501 Carbamic acid, [5-[(2,3-dihydro-2-hydroxy-1H-inden-1-yl)amino]-2-hydroxy-5-oxo-1,4-bis(phenylmethyl)pentyl]-, tetrahydro-2H-pyran-3-yl ester, [1S-[1.alpha.[1R*(R*),2R*,4S*],2.alpha.]]- L685,434 deriv. N-[2(R)-Hydroxy-1(S)-indanyl]-5(S)-[[(3(S)-tetrahydropyranyloxy)carbonyl]amino]-4(S)-hydroxy-6-phenyl-2(R)-benzylhexanamide

pdb file: 600167.pdb
sdf file: 600167.sdf
directory: 600167


145680-04-2 AIDS-004502 AIDS004502 Carbamic acid, [5-[(2,3-dihydro-2-hydroxy-1H-inden-1-yl)amino]-2-hydroxy-5-oxo-1,4-bis(phenylmethyl)pentyl]-, tetrahydro-2H-pyran-3-yl ester, [1S-[1.alpha.[1R*(S*),2R*,4S*],2.alpha.]]- L685,434 deriv. N-[2(R)-Hydroxy-1(S)-indanyl]-5(S)-[[(4(R)-tetrahydroxypyranyloxy)carbonyl]amino]-4(S)-hydroxy-6-phenyl-2(R)-benzylhexanamide

pdb file: 600168.pdb
sdf file: 600168.sdf
directory: 600168


AIDS-004503 AIDS004503 L685,434 deriv. N-[2(R)-Hydroxy-1(S)-indanyl]-5(S)-[[(3(RS)-tetrahydropyranyloxy)carbonyl]amino]-4(S)-hydroxy-6-phenyl-2(R)-benzylhexanamide

pdb file: 600169.pdb
sdf file: 600169.sdf
directory: 600169


AIDS-004511 AIDS004511 N-Methyl-N'-methyl-N'-[[2(R)-hydroxy-4-phenyl-3(S)-[4-amino-1,4-dioxo-2(S)-[(benzyloxycarbonyl)amino]butylamino]butyl]urea OHEturea isostere, cbz deriv.

pdb file: 600177.pdb
sdf file: 600177.sdf
directory: 600177


AIDS-004512 AIDS004512 N-Butyl-N'methyl-N'-[[2(R)-hydroxy-4-phenyl-3(S)-[4-amino-1,4-dioxo-2(S)-[(benzyloxycarbonyl)amino]butylamino]butyl]urea OHEturea isostere, cbz deriv.

pdb file: 600178.pdb
sdf file: 600178.sdf
directory: 600178


AIDS-004513 AIDS004513 N-Methyl-N'-isobutyl-N'-[[2(R)-hydroxy-4-phenyl-3(S)-[4-amino-1,4-dioxo-2(S)-[(benzyloxycarbonyl)amino]butylamino]butyl]urea OHEturea isostere, cbz deriv.

pdb file: 600179.pdb
sdf file: 600179.sdf
directory: 600179


AIDS-004514 AIDS004514 N-Butyl-N'-isobutyl-N'-[[2(R)-hydroxy-4-phenyl-3(S)-[4-amino-1,4-dioxo-2(S)-[(benzyloxycarbonyl)amino]butylamino] butyl)urea OHEturea isostere, cbz deriv.

pdb file: 600180.pdb
sdf file: 600180.sdf
directory: 600180


(R)-OHEturea isostere, Qua deriv. AIDS-004515 AIDS004515 N-Butyl-N'-isobutyl-N'-[[2(R)-hydroxy-4-phenyl-3(S)-[4-amino-1,4-dioxo-2(S)-(2-quinolinylcarboxamido)butylamino]butyl]urea

pdb file: 600181.pdb
sdf file: 600181.sdf
directory: 600181


(R)-OHEturea isostere, cbz deriv. AIDS-004516 AIDS004516 N-Propyl-N'-isobutyl-N'-[[2(R)-hydroxy-4-phenyl-3(S)-[4-amino-1,4-dioxo-2(S)-[(benzyloxycarbonyl)amino]butylamino]butyl]urea

pdb file: 600182.pdb
sdf file: 600182.sdf
directory: 600182


(R)-OHEturea isostere, cbz deriv. AIDS-004517 AIDS004517 N-Ethyl-N'-isobutyl-N'-[[2(R)-hydroxy-4-phenyl-3(S)-[4-amino-1,4-dioxo-2(S)-[(benzyloxycarbonyl)amino]butylamino]butyl]urea

pdb file: 600183.pdb
sdf file: 600183.sdf
directory: 600183


(R)-OHEturea isostere, cbz deriv. AIDS-004518 AIDS004518 N-Isopropyl-N'-isobutyl-N'-[[2(R)-hydroxy-4-phenyl-3(S)-[4-amino-1,4-dioxo-2(S)-[(benzyloxycarbonyl)amino]butylamino]butyl]urea

pdb file: 600184.pdb
sdf file: 600184.sdf
directory: 600184


AIDS-004519 AIDS004519 N-tert-Butyl-N'-isobutyl-N'-[2(R)-hydroxy-4-phenyl-3(S)-[4-amino-1,4-dioxo-2(S)-[(benzyloxycarbonyl)amino]butylamino]butyl]urea OHEturea isostere, cbz deriv.

pdb file: 600185.pdb
sdf file: 600185.sdf
directory: 600185


(R)-OHEturea isostere, cbz deriv. AIDS-004521 AIDS004521 N-tert-Butyl-N-isopentyl-N-[[2(R)-hydroxy-4-phenyl-3(S)-[4-amino-1,4- dioxo-2(S)-[(benzyloxycarbonyl)amino]butylamino]butyl]urea

pdb file: 600187.pdb
sdf file: 600187.sdf
directory: 600187


(R)-OHEturea isostere, Qua deriv. AIDS-004522 AIDS004522 N-tert-Butyl-N'-isopentyl-N'-[2(R)-hydroxy-4-phenyl-3(S)-[4-amino-1,4-dioxo-2(S)-(2-quinolinylcarboxamido)butylamino]butyl]urea

pdb file: 600188.pdb
sdf file: 600188.sdf
directory: 600188


(R)-OHEturea isostere, cbz deriv. AIDS-004523 AIDS004523 N-tert-Butyl-N'-(cyclohexylmethyl)-N'-[[2(R)-hydroxy-4-phenyl-3(S)-[4-amino-1,4-dioxo-2(S)-[(benzyloxycarbonyl)amino]butyamino]butyl]urea

pdb file: 600189.pdb
sdf file: 600189.sdf
directory: 600189


(R)-OHEturea isostere, Qua deriv. AIDS-004524 AIDS004524 N-tert-Butyl-N'-(cyclohexylmethyl)-N'-[2(R)-hydroxy-4-phenyl-3(S)-[4-amino-1,4-dioxo-2(S)-(2-quinolinylcarboxamido)butylamino]butyl]urea

pdb file: 600190.pdb
sdf file: 600190.sdf
directory: 600190


(R)-OHEturea isostere, cbz deriv. AIDS-004525 AIDS004525 N-tert-Butyl-N'-benzyl-N'-[[2(R)-hydroxy-4-phenyl-3(S)-[4-amino-1,4-dioxo-2(S)-[(benzyoxycarbonyl)amino]butylamino]butyl]urea

pdb file: 600191.pdb
sdf file: 600191.sdf
directory: 600191


(R)-OHEturea isostere, Qua deriv. AIDS-004526 AIDS004526 N-tert-Butyl-N'-benzyl-N'-[[2(R)-hydroxy-4-phenyl-3(S)-[4-amino-1,4-dioxo-2(S)-(2-quinolinylcarboxamido)butylamino]butyl]urea

pdb file: 600192.pdb
sdf file: 600192.sdf
directory: 600192


(R)-OHEturea isostere, cbz deriv. AIDS-004527 AIDS004527 N-tert-Butyl-N'-(R)-(1-phenylethyl)-N'-[[2(R)-hydroxy-4-phenyl-3(S)-[4-amino-1,4-dioxo-2(S)-[(benzyloxycarbonyl]amino]butylamino]butyl]urea

pdb file: 600193.pdb
sdf file: 600193.sdf
directory: 600193


(R)-OHEturea isostere, cbz deriv. AIDS-004528 AIDS004528 N-tert-Butyl-N'-(S)-(1-phenylethyl)-N'-[[2(R)-hydroxy-4-phenyl-3(S)-[4-amino-1,4-dioxo-2(S)-[(benzyloxycarbonyl)amino]butylamino]butyl]urea

pdb file: 600194.pdb
sdf file: 600194.sdf
directory: 600194


(R)-OHEturea isostere, cbz deriv. AIDS-004529 AIDS004529 N-tert-Butyl-N'-(4-pyridylmethyl)-N'-[[2(R)-hydroxy-4-phenyl-3(S)-[4-amino-1,4-dioxo-2(S)-[(benzyloxycarbonyl)amino]butylamino]butyl]urea

pdb file: 600195.pdb
sdf file: 600195.sdf
directory: 600195


(R)-OHEturea isostere, Qua deriv. AIDS-004530 AIDS004530 N-tert-Butyl-N'-(4-pyridylmethyl)-N'-[[2(R)-hydroxy-4-phenyl-3(S)-[4-amino-1,4-dioxo-2(S)-(2-quinolinylcarboxamido)butylamino]butyl]urea

pdb file: 600196.pdb
sdf file: 600196.sdf
directory: 600196


1-[[1-Amino-3-(dimethylthexylsiloxy)-2-propoxy]methyl]thymine, (R,S)- AIDS-004531 AIDS004531 NH2-acycloT deriv.

pdb file: 600197.pdb
sdf file: 600197.sdf
directory: 600197


AIDS-004545 AIDS004545 CD4 84-89 deriv. Tyr-Ile-Cys-Glu-Val-Glu (CD4 84-89 derivative) YIC(bzl)EVE

pdb file: 600210.pdb
sdf file: 600210.sdf
directory: 600210


1,2-Bis(1,2-dihydro-5-ethyl-6-methyl-2-oxopyridin-3-yl)ethane 145901-75-3 2(1H)-Pyridinone, 3,3'-(1,2-ethanediyl)bis[5-ethyl-6-methyl- 2-Pyridinone 3pyrid3Et deriv. AIDS-004573 AIDS004573

pdb file: 600238.pdb
sdf file: 600238.sdf
directory: 600238


139548-16-6 2(1H)-Pyridinone, 5-ethyl-3-[[(5-ethyl-1,2-dihydro-6-methyl-2-oxo-3-pyridinyl)amino]methyl]-6-methyl- 3-[N-[(1,2-Dihydro-5-ethyl-6-methyl-2-oxopyridin-3-yl)methyl]amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004574 AIDS004574 Pyridinone deriv.

pdb file: 600239.pdb
sdf file: 600239.sdf
directory: 600239


139548-01-9 2(1H)-Pyridinone, 5-ethyl-3-[2-(5-ethyl-2-methoxy-6-methyl-3-pyridinyl)ethyl]-6-methyl- 3-[2-(5-Ethyl-2-methoxy-6-methyl-3-pyridyl)ethyl]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004575 AIDS004575 Pyridinone deriv.

pdb file: 600240.pdb
sdf file: 600240.sdf
directory: 600240


3-[(2-Methoxy-4,5-dimethylbenzyl)amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004577 AIDS004577 Pyridinone deriv.

pdb file: 600242.pdb
sdf file: 600242.sdf
directory: 600242


139548-36-0 2(1H)-Pyridinone, 5-ethyl-3-[[(3-methoxy-5,6-dimethyl-2-pyridinyl)methyl]amino]-6-methyl- 3-[[(3-Methoxy-5,6-dimethyl-2-pyridyl)methyl]amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004578 AIDS004578 Pyridinone deriv.

pdb file: 600243.pdb
sdf file: 600243.sdf
directory: 600243


139548-47-3 2(1H)-Pyridinone, 5-ethyl-6-methyl-3-[[(5,6,7,8-tetrahydro-3-methoxy-2-quinolinyl)methyl]amino]- 3-[[(3-Methoxy-5,6,7,8-tetrahydro-2-quinolinyl)methyl]amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004579 AIDS004579 Pyridinone deriv.

pdb file: 600244.pdb
sdf file: 600244.sdf
directory: 600244


145901-78-6 2(1H)-Pyridinone, 5-ethyl-3-[[(2-methoxy-3-pyridinyl)methyl]amino]-6-methyl- 3-[N-[(2-Methoxy-3-pyridyl)methyl]amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004580 AIDS004580 Pyridinone deriv.

pdb file: 600245.pdb
sdf file: 600245.sdf
directory: 600245


3-[(3-Pyridylmethyl)amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004581 AIDS004581 Pyridinone deriv.

pdb file: 600246.pdb
sdf file: 600246.sdf
directory: 600246


145901-79-7 2(1H)-Pyridinone, 5-ethyl-3-[[(2-methoxyphenyl)methyl]amino]-6-methyl- 3-[(2-Methoxybenzyl)amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004582 AIDS004582 Pyridinone deriv.

pdb file: 600247.pdb
sdf file: 600247.sdf
directory: 600247


3-(Benzylamino)-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004583 AIDS004583 Pyridinone deriv.

pdb file: 600248.pdb
sdf file: 600248.sdf
directory: 600248


145901-80-0 2(1H)-Pyridinone, 3-[[(2-ethoxyphenyl)methyl]amino]-5-ethyl-6-methyl- 3-[(2-Ethoxybenzyl)amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004584 AIDS004584 Pyridinone deriv.

pdb file: 600249.pdb
sdf file: 600249.sdf
directory: 600249


145901-81-1 2(1H)-Pyridinone, 5-ethyl-6-methyl-3-[[(2-nitrophenyl)methyl]amino]- 3-[(2-Nitrobenzyl)amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004585 AIDS004585 Pyridinone deriv.

pdb file: 600250.pdb
sdf file: 600250.sdf
directory: 600250


145901-82-2 3-[(2-Cyanobenzyl)amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004586 AIDS004586 Benzonitrile, 2-[[(5-ethyl-1,2-dihydro-6-methyl-2-oxo-3-pyridinyl)amino]methyl]- Pyridinone deriv.

pdb file: 600251.pdb
sdf file: 600251.sdf
directory: 600251


145901-83-3 2(1H)-Pyridinone, 5-ethyl-3-[[(2-fluorophenyl)methyl]amino]-6-methyl- 3-[(2-Flurobenzyl)amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004587 AIDS004587 Pyridinone deriv.

pdb file: 600252.pdb
sdf file: 600252.sdf
directory: 600252


145901-84-4 2(1H)-Pyridinone, 3-[[(2-chlorophenyl)methyl]amino]-5-ethyl-6-methyl- 3-[[(2-(Methylthio)benzyl]amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004588 AIDS004588 Pyridinone deriv.

pdb file: 600253.pdb
sdf file: 600253.sdf
directory: 600253


145901-85-5 2(1H)-Pyridinone, 5-ethyl-6-methyl-3-[[[2-(methylthio)phenyl]methyl]amino]- 3-[[(2-Methylthio)benzyl]amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004589 AIDS004589 Pyridinone deriv.

pdb file: 600254.pdb
sdf file: 600254.sdf
directory: 600254


145901-86-6 2(1H)-Pyridinone, 5-ethyl-6-methyl-3-[[(2-methylphenyl)methyl]amino]- 3-[(2-Methylbenzyl)amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004590 AIDS004590 Pyridinone deriv.

pdb file: 600255.pdb
sdf file: 600255.sdf
directory: 600255


145901-87-7 2(1H)-Pyridinone, 5-ethyl-3-[[(2-hydroxyphenyl)methyl]amino]-6-methyl- 3-[(2-Hydroxybenzyl)amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004591 AIDS004591 Pyridinone deriv.

pdb file: 600256.pdb
sdf file: 600256.sdf
directory: 600256


145901-88-8 2(1H)-Pyridinone, 5-ethyl-3-[[(2-ethylphenyl)methyl]amino]-6-methyl- 3-[(2-Ethylbenzyl)amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004592 AIDS004592 Pyridinone deriv.

pdb file: 600257.pdb
sdf file: 600257.sdf
directory: 600257


145901-89-9 2(1H)-Pyridinone, 5-ethyl-6-methyl-3-[[[2-(trifluoromethyl)phenyl]methyl]amino]- 3-[[(2-Trifluoromethyl)benzyl]amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004593 AIDS004593 Pyridinone deriv.

pdb file: 600258.pdb
sdf file: 600258.sdf
directory: 600258


145901-90-2 2(1H)-Pyridinone, 3-[[(2-aminophenyl)methyl]amino]-5-ethyl-6-methyl- 3-[(2-Aminobenzyl)amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004594 AIDS004594 Pyridinone deriv.

pdb file: 600259.pdb
sdf file: 600259.sdf
directory: 600259


145901-91-3 2(1H)-Pyridinone, 5-ethyl-3-[[[2-(methoxymethyl)phenyl]methyl]amino]-6-methyl- 3-[[(2-Methoxymethyl)benzyl]amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004595 AIDS004595 Pyridinone deriv.

pdb file: 600260.pdb
sdf file: 600260.sdf
directory: 600260


145901-92-4 2(1H)-Pyridinone, 5-ethyl-3-[[(3-methoxyphenyl)methyl]amino]-6-methyl- 3-[(3-Methoxybenzyl)amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004596 AIDS004596 Pyridinone deriv.

pdb file: 600261.pdb
sdf file: 600261.sdf
directory: 600261


145901-93-5 2(1H)-Pyridinone, 5-ethyl-3-[[(4-methoxyphenyl)methyl]amino]-6-methyl- 3-[(4-Methoxybenzyl)amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004597 AIDS004597 Pyridinone deriv.

pdb file: 600262.pdb
sdf file: 600262.sdf
directory: 600262


145901-94-6 2(1H)-Pyridinone, 5-ethyl-3-[[(3-methoxy-4-pyridinyl)methyl]amino]-6-methyl- 3-[[(2-Methoxy-4-pyridinyl)methyl]amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004598 AIDS004598 Pyridinone deriv.

pdb file: 600263.pdb
sdf file: 600263.sdf
directory: 600263


145901-95-7 2(1H)-Pyridinone, 5-ethyl-3-[[(4-methoxy-3-pyridinyl)methyl]amino]-6-methyl- 3-[[(6-Methoxy-3-pyridinyl)methyl]amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004599 AIDS004599 Pyridinone deriv.

pdb file: 600264.pdb
sdf file: 600264.sdf
directory: 600264


145901-96-8 2(1H)-Pyridinone, 5-ethyl-3-[[(3-methoxy-2-pyridinyl)methyl]amino]-6-methyl- 3-[[(6-Methoxy-2-pyridinyl)methyl]amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004600 AIDS004600 Pyridinone deriv.

pdb file: 600265.pdb
sdf file: 600265.sdf
directory: 600265


145901-97-9 2(1H)-Pyridinone, 5-ethyl-3-[[(2-methoxy-3-methylphenyl)methyl]amino]-6-methyl- 3-[(2-Methoxy-3-methylbenzyl)amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004601 AIDS004601 Pyridinone deriv.

pdb file: 600266.pdb
sdf file: 600266.sdf
directory: 600266


139548-20-2 2(1H)-Pyridinone, 5-ethyl-3-[[(2-methoxy-4-methylphenyl)methyl]amino]-6-methyl- 3-[(2-Methoxy-4-methylbenzyl)amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004602 AIDS004602 Pyridinone deriv.

pdb file: 600267.pdb
sdf file: 600267.sdf
directory: 600267


139548-19-9 2(1H)-Pyridinone, 5-ethyl-3-[[(2-methoxy-5-methylphenyl)methyl]amino]-6-methyl- 3-[(2-Methoxy-5-methylbenzyl)amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004603 AIDS004603 Pyridinone deriv.

pdb file: 600268.pdb
sdf file: 600268.sdf
directory: 600268


145901-98-0 2(1H)-Pyridinone, 5-ethyl-3-[[(2-methoxy-6-methylphenyl)methyl]amino]-6-methyl- 3-[(2-Methoxy-6-methylbenzyl)amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004604 AIDS004604 Pyridinone deriv.

pdb file: 600269.pdb
sdf file: 600269.sdf
directory: 600269


145901-99-1 2(1H)-Pyridinone, 5-ethyl-3-[[(4-ethyl-2-methoxyphenyl)methyl]amino]-6-methyl- 3-[(4-Ethyl-2-methoxybenzyl)amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004605 AIDS004605 Pyridinone deriv.

pdb file: 600270.pdb
sdf file: 600270.sdf
directory: 600270


139547-91-4 2(1H)-Pyridinone, 5-ethyl-3-[[(5-ethyl-2-methoxyphenyl)methyl]amino]-6-methyl- 3-[(5-Ethyl-2-methoxybenzyl)amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004606 AIDS004606 Pyridinone deriv.

pdb file: 600271.pdb
sdf file: 600271.sdf
directory: 600271


139548-24-6 2(1H)-Pyridinone, 5-ethyl-3-[[(5-ethyl-2-methoxy-4-methylphenyl)methyl]amino]-6-methyl- 3-[(2-Methoxy-5-ethyl-4-methylbenzyl)amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004607 AIDS004607 Pyridinone deriv.

pdb file: 600272.pdb
sdf file: 600272.sdf
directory: 600272


139548-21-3 2(1H)-Pyridinone, 3-[[(2,3-dihydro-6-methoxy-1H-inden-5-yl)methyl]amino]-5-ethyl-6-methyl- 3-[(2-Methoxy-5-indanyl)methyl]amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004608 AIDS004608 Pyridinone deriv.

pdb file: 600273.pdb
sdf file: 600273.sdf
directory: 600273


139548-56-4 2(1H)-Pyridinone, 5-ethyl-3-[[(2-methoxy-5,6-dimethyl-3-pyridinyl)methyl]amino]-6-methyl- 3-[[(2-Methoxy-5,6-dimethyl-3-pyridinyl)methyl]amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004609 AIDS004609 Pyridinone deriv.

pdb file: 600274.pdb
sdf file: 600274.sdf
directory: 600274


145902-00-7 2(1H)-Pyridinone, 5-ethyl-6-methyl-3-[[(5,6,7,8-tetrahydro-2-methoxy-3-quinolinyl)methyl]amino]- 3-[[(2-Methoxy-5,6,7,8-tetrahydro-3-quinolinyl)methyl]amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004610 AIDS004610 Pyridinone deriv.

pdb file: 600275.pdb
sdf file: 600275.sdf
directory: 600275


139548-12-2 2(1H)-Pyridinone, 5-ethyl-3-[[(2-methoxy-3-quinolinyl)methyl]amino]-6-methyl- 3-[[(2-Methoxy-3-quinolinyl)methyl]amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004611 AIDS004611 Pyridinone deriv.

pdb file: 600276.pdb
sdf file: 600276.sdf
directory: 600276


139548-46-2 2(1H)-Pyridinone, 5-ethyl-3-[[(6-ethyl-3-methoxy-5-methyl-2-pyridinyl)methyl]amino]-6-methyl- 3-[[(6-Ethyl-3-methoxy-5-methyl-2-pyridyl)methyl]amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004612 AIDS004612 Pyridinone deriv.

pdb file: 600277.pdb
sdf file: 600277.sdf
directory: 600277


145902-01-8 2(1H)-Pyridinone, 3-[[(6,7-dihydro-3-methoxy-5H-1-pyrindin-2-yl)methyl]amino]-5-ethyl-6-methyl- 2(1H)-Pyridinone, 3-[[(6,7-dihydro-3-methoxy-5H-cyclopenta[b]pyridin-2-yl)methyl]amino]-5-ethyl-6-methyl- 3-[[(3-Methoxy-2-pyrindin2-yl)methyl]amino]-5-ethyl-6-methylpyridin-2(1H)-one 5H-1-Pyrindine, 2(1H)-pyridinone deriv. AIDS-004613 AIDS004613 Pyridinone deriv.

pdb file: 600278.pdb
sdf file: 600278.sdf
directory: 600278


AIDS-004614 AIDS004614 N-{(1S)-2-({(1S,2R)-1-benzyl-3-[(3S,4aS,8aS)-3-[(tert-butylamino)carbonyl]octahydroisoquinolin-2(1H)-yl]-2-hydroxypropyl}amino)-2-oxo-1-[(3R)-tetrahydrofuran-3-yl]ethyl}quinoline-2-carboxamide Ro 31-8959 3'R-Thfg deriv.

pdb file: 600279.pdb
sdf file: 600279.sdf
directory: 600279


AIDS-004615 AIDS004615 N-{(1S)-2-({(1S,2R)-1-benzyl-3-[(3S,4aS,8aS)-3-[(tert-butylamino)carbonyl]octahydroisoquinolin-2(1H)-yl]-2-hydroxypropyl}amino)-2-oxo-1-[(3S)-tetrahydrofuran-3-yl]ethyl}quinoline-2-carboxamide Ro 31-8959 3'S-Thfg deriv.

pdb file: 600280.pdb
sdf file: 600280.sdf
directory: 600280


(2S,4S,5S)-2-[[(Phenylmethoxy)carbonyl]amino]-5-[[[(phenylmethoxy)carbonyl]-L-valinyl]-amino]-1,6-diphenyl-4-hydroxyhexane AIDS-004616 AIDS004616 Urethane dipeptide isostere Cbz deriv.

pdb file: 600281.pdb
sdf file: 600281.sdf
directory: 600281


(2S,4S,5S)-2-[[[(Phenylmethoxy)carbonyl]-L-valinyl]amino-5-[[(1,1-dimethylethoxy)carbonyl]-amino]-1,6-diphenyl-4-hydroxyhexane AIDS-004617 AIDS004617 Urethane dipeptide isostere Cbz deriv.

pdb file: 600282.pdb
sdf file: 600282.sdf
directory: 600282


(2S,4S,5S)-2,5-Bis[[(1,1-dimethylethoxy)carbonyl]amino]-1,6-diphenyl-4-hydroxyhexane AIDS-004618 AIDS004618 Urethane dipeptide isostere tBuOCO (S) deriv.

pdb file: 600283.pdb
sdf file: 600283.sdf
directory: 600283


(2S,4R,5S)-2,5-Bis[[(1,1-dimethylethoxy)carbonyl]amino]-1,6-diphenyl-4-hydroxyhexane AIDS-004619 AIDS004619 Urethane dipeptide isostere (R) deriv.

pdb file: 600284.pdb
sdf file: 600284.sdf
directory: 600284


143707-81-7 3-[[(4,5,6,7-Tetrahydro-2-benzoxazolyl)methyl]amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004620 AIDS004620 Pyridinone deriv.

pdb file: 600285.pdb
sdf file: 600285.sdf
directory: 600285


143707-83-9 2(1H)-Pyridinone, 3-[(benzo[b]thien-2-ylmethyl)amino]-5-ethyl-6-methyl- AIDS-004621 AIDS004621 Pyridinone deriv.

pdb file: 600286.pdb
sdf file: 600286.sdf
directory: 600286


143707-84-0 2(1H)-Pyridinone, 5-ethyl-6-methyl-3-[(2-quinolinylmethyl)amino]- AIDS-004622 AIDS004622 Pyridinone deriv.

pdb file: 600287.pdb
sdf file: 600287.sdf
directory: 600287


143707-85-1 2(1H)-Pyridinone, 5-ethyl-6-methyl-3-[[(4-oxo-4H-1-benzopyran-3-yl)methyl]amino]- AIDS-004623 AIDS004623 Pyridinone deriv.

pdb file: 600288.pdb
sdf file: 600288.sdf
directory: 600288


143707-86-2 2(1H)-Pyridinone, 5-ethyl-6-methyl-3-[(oxazolo[4,5-b]pyridin-2-ylmethyl)amino]- 3-[[(Oxazolo[4,5-d]pyridin-2-yl)methyl]amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004624 AIDS004624 Pyridinone deriv.

pdb file: 600289.pdb
sdf file: 600289.sdf
directory: 600289


143707-87-3 2(1H)-Pyridinone, 5-ethyl-6-methyl-3-[(1-naphthalenylmethyl)amino]- AIDS-004625 AIDS004625 Pyridinone deriv.

pdb file: 600290.pdb
sdf file: 600290.sdf
directory: 600290


143707-88-4 2(1H)-Pyridinone, 5-ethyl-6-methyl-3-[[(5-phenyl-2-oxazolyl)methyl]amino]- AIDS-004626 AIDS004626 Pyridinone deriv.

pdb file: 600291.pdb
sdf file: 600291.sdf
directory: 600291


143707-89-5 3-[[(4-Oxo-2-quinazolinyl)methyl]amino]-5-ethyl-6-methylpyridin-2(1H)-one 4(1H)-Quinazolinone, 2-[[(5-ethyl-1,2-dihydro-6-methyl-2-oxo-3-pyridinyl)amino]methyl]- AIDS-004627 AIDS004627 Pyridinone deriv.

pdb file: 600292.pdb
sdf file: 600292.sdf
directory: 600292


143707-90-8 2(1H)-Pyridinone, 5-ethyl-6-methyl-3-[(naphth[1,2-d]oxazol-2-ylmethyl)amino]- AIDS-004628 AIDS004628 Pyridinone deriv.

pdb file: 600293.pdb
sdf file: 600293.sdf
directory: 600293


143707-91-9 2(1H)-Pyridinone, 5-ethyl-3-[(1H-indol-2-ylmethyl)amino]-6-methyl- AIDS-004629 AIDS004629 Pyridinone deriv.

pdb file: 600294.pdb
sdf file: 600294.sdf
directory: 600294


143707-94-2 2(1H)-Pyridinone, 5-ethyl-6-methyl-3-[(naphth[2,3-d]oxazol-2-ylmethyl)amino]- AIDS-004631 AIDS004631 Pyridinone deriv.

pdb file: 600295.pdb
sdf file: 600295.sdf
directory: 600295


143707-95-3 2(1H)-Pyridinone, 5-ethyl-6-methyl-3-[(2-pyridinylmethyl)amino]- AIDS-004632 AIDS004632 Pyridinone deriv.

pdb file: 600296.pdb
sdf file: 600296.sdf
directory: 600296


143707-96-4 2(1H)-Pyridinone, 5-ethyl-3-[(1H-indol-3-ylmethyl)amino]-6-methyl- AIDS-004633 AIDS004633 Pyridinone deriv.

pdb file: 600297.pdb
sdf file: 600297.sdf
directory: 600297


143707-97-5 2(1H)-Pyridinone, 5-ethyl-3-[(2-furanylmethyl)amino]-6-methyl- AIDS-004634 AIDS004634 Pyridinone deriv.

pdb file: 600298.pdb
sdf file: 600298.sdf
directory: 600298


143707-98-6 2(1H)-Pyridinone, 5-ethyl-3-[(furo[3,2-c]pyridin-2-ylmethyl)amino]-6-methyl- AIDS-004635 AIDS004635 Pyridinone deriv.

pdb file: 600299.pdb
sdf file: 600299.sdf
directory: 600299


143707-99-7 2(1H)-Pyridinone, 5-ethyl-3-[(furo[2,3-c]pyridin-2-ylmethyl)amino]-6-methyl- AIDS-004636 AIDS004636 Pyridinone deriv.

pdb file: 600300.pdb
sdf file: 600300.sdf
directory: 600300


143708-00-3 2(1H)-Pyridinone, 5-ethyl-3-[(3-furanylmethyl)amino]-6-methyl- AIDS-004637 AIDS004637 Pyridinone deriv.

pdb file: 600301.pdb
sdf file: 600301.sdf
directory: 600301


143708-02-5 2(1H)-Pyridinone, 5-ethyl-6-methyl-3-[[(5-methyl-2-benzoxazolyl)methyl]amino]- AIDS-004638 AIDS004638 Pyridinone deriv.

pdb file: 600302.pdb
sdf file: 600302.sdf
directory: 600302


143708-03-6 3-[(6-Methyl-benzoxazol-2-ylmethyl)amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004639 AIDS004639 Pyridinone deriv.

pdb file: 600303.pdb
sdf file: 600303.sdf
directory: 600303


143708-04-7 2(1H)-Pyridinone, 5-ethyl-3-[[(7-ethyl-2-benzoxazolyl)methyl]amino]-6-methyl- AIDS-004640 AIDS004640 Pyridinone deriv.

pdb file: 600304.pdb
sdf file: 600304.sdf
directory: 600304


139548-50-8 2(1H)-Pyridinone, 3-[[(4-chloro-2-benzoxazolyl)methyl]amino]-5-ethyl-6-methyl- AIDS-004641 AIDS004641 Pyridinone deriv.

pdb file: 600305.pdb
sdf file: 600305.sdf
directory: 600305


139548-35-9 2(1H)-Pyridinone, 3-[[(7-chloro-2-benzoxazolyl)methyl]amino]-5-ethyl-6-methyl- AIDS-004642 AIDS004642 Pyridinone deriv.

pdb file: 600306.pdb
sdf file: 600306.sdf
directory: 600306


139571-98-5 2(1H)-Pyridinone, 5-ethyl-3-[[(4-fluoro-2-benzoxazolyl)methyl]amino]-6-methyl- AIDS-004643 AIDS004643 Pyridinone deriv.

pdb file: 600307.pdb
sdf file: 600307.sdf
directory: 600307


143708-05-8 2(1H)-Pyridinone, 5-ethyl-3-[[(5-fluoro-2-benzoxazolyl)methyl]amino]-6-methyl- AIDS-004644 AIDS004644 Pyridinone deriv.

pdb file: 600308.pdb
sdf file: 600308.sdf
directory: 600308


143708-06-9 2(1H)-Pyridinone, 5-ethyl-3-[[(6-fluoro-2-benzoxazolyl)methyl]amino]-6-methyl- AIDS-004645 AIDS004645 Pyridinone deriv.

pdb file: 600309.pdb
sdf file: 600309.sdf
directory: 600309


139548-49-5 2(1H)-Pyridinone, 5-ethyl-3-[[(7-fluoro-2-benzoxazolyl)methyl]amino]-6-methyl- AIDS-004646 AIDS004646 Pyridinone deriv.

pdb file: 600310.pdb
sdf file: 600310.sdf
directory: 600310


3-[(7-Chloro-4-fluoro-2-benzoxazolylmethyl)amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004647 AIDS004647 Pyridinone deriv.

pdb file: 600311.pdb
sdf file: 600311.sdf
directory: 600311


3-[(4,7-Difluoro-2-benzoxazolylmethyl)amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004648 AIDS004648 Pyridinone deriv.

pdb file: 600312.pdb
sdf file: 600312.sdf
directory: 600312


3-[(4-Methoxy-2-benzoxazolylmethyl)amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004649 AIDS004649 Pyridinone deriv.

pdb file: 600313.pdb
sdf file: 600313.sdf
directory: 600313


3-[(4-Hydroxy-2-benzoxazolylmethyl)amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004650 AIDS004650 Pyridinone deriv.

pdb file: 600314.pdb
sdf file: 600314.sdf
directory: 600314


3-[(4-Nitro-2-benzoxazolylmethyl)amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004651 AIDS004651 Pyridinone deriv.

pdb file: 600315.pdb
sdf file: 600315.sdf
directory: 600315


3-[(4-Amino-2-benzoxazolylmethyl)amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004652 AIDS004652 Pyridinone deriv.

pdb file: 600316.pdb
sdf file: 600316.sdf
directory: 600316


3-[(4,7-Dichloro-2-benzoxazolylmethyl)amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004653 AIDS004653 Pyridinone deriv.

pdb file: 600317.pdb
sdf file: 600317.sdf
directory: 600317


3-[(N-(4,7-Dichlorobenzoxazolyl)methyl)ethylamino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004654 AIDS004654 Pyridinone deriv.

pdb file: 600318.pdb
sdf file: 600318.sdf
directory: 600318


3-[N-(4,7-Dimethyl-2-benzoxazolylmethyl)amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004655 AIDS004655 Pyridinone deriv.

pdb file: 600319.pdb
sdf file: 600319.sdf
directory: 600319


3-[[1-(2-Benzofuranyl)ethyl]amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004656 AIDS004656 Pyridinone deriv.

pdb file: 600320.pdb
sdf file: 600320.sdf
directory: 600320


3-[[1-(4,7-Dichloro-2-benzofuranyl)methyl]methylamino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004657 AIDS004657 Pyridinone deriv.

pdb file: 600321.pdb
sdf file: 600321.sdf
directory: 600321


3-[(4,7-Dichloro-2-benzoxazolylmethyl)amino]-5-ethylene-6-methylpyridin-2(1H)-one AIDS-004658 AIDS004658 Pyridinone deriv.

pdb file: 600322.pdb
sdf file: 600322.sdf
directory: 600322


3-[(4,7-Dichloro-2-benzoxazolylmethyl)amino]-7-methyl-cyclopropa[c]pyridin-2(1H)-one AIDS-004659 AIDS004659 Pyridinone deriv.

pdb file: 600323.pdb
sdf file: 600323.sdf
directory: 600323


3-[(4,7-Dichloro-2-benzoxazolylmethyl)amino]-5-methoxy-6-methylpyridin-2(1H)-one AIDS-004660 AIDS004660 Pyridinone deriv.

pdb file: 600324.pdb
sdf file: 600324.sdf
directory: 600324


3-[(4,7-Dichloro-2-benzoxazolylmethyl)amino]-5-ethyl-6-methylpyridin-2(1H)-thione AIDS-004661 AIDS004661 Pyridinone deriv.

pdb file: 600325.pdb
sdf file: 600325.sdf
directory: 600325


3-[(4,7-Dichloro-2-benzoxazolylmethyl)amino]-5-methylthio-6-methylpyridin-2(1H)-one AIDS-004662 AIDS004662 Pyridinone deriv.

pdb file: 600326.pdb
sdf file: 600326.sdf
directory: 600326


3-[[(1-(2-Naphthyl)ethyl]amino]-5-ethyl-6-methlpyridin-2(1H)-one AIDS-004663 AIDS004663 Pyridinone deriv.

pdb file: 600327.pdb
sdf file: 600327.sdf
directory: 600327


3-[(4,7-Dichloro-2-benzoxazolylmethyl)amino]-5-acetyl-6-methylpyridin-2(1H)-one AIDS-004664 AIDS004664 Pyridinone deriv.

pdb file: 600328.pdb
sdf file: 600328.sdf
directory: 600328


3-[(4,7-Dichloro-2-Benzoxazolylmethyl)amino]-5-(1-hydroxyethyl)-6-methylpyridin-2(1H)-one AIDS-004665 AIDS004665 Pyridinone deriv.

pdb file: 600329.pdb
sdf file: 600329.sdf
directory: 600329


3-[(4,7-Dichloro-2-Benzoxazolylmethyl)amino]-4,6-dimethylpyridin-2(1H)-one AIDS-004666 AIDS004666 Pyridinone deriv.

pdb file: 600330.pdb
sdf file: 600330.sdf
directory: 600330


3-[(2-Benzoxazolylmethyl)amino]-5-methylthio-6-methylpyridin-2(1H)-one AIDS-004667 AIDS004667 Pyridinone deriv.

pdb file: 600331.pdb
sdf file: 600331.sdf
directory: 600331


3-[(2-Benzoxazolylmethyl)amino]-5-ethylthio-6-methylpyridin-2(1H)-one AIDS-004668 AIDS004668 Pyridinone deriv.

pdb file: 600332.pdb
sdf file: 600332.sdf
directory: 600332


3-[(2-Benzoxazolylmethyl)amino]-5-ethyl-4,6-dimethylpyridin-2(1H)-one AIDS-004669 AIDS004669 Pyridinone deriv.

pdb file: 600333.pdb
sdf file: 600333.sdf
directory: 600333


3-[(2-Benzoxazolylmethyl)amino]-6-methyl-5-(methylsulfonyl)pyridin-2(1H)-one AIDS-004670 AIDS004670 Pyridinone deriv.

pdb file: 600334.pdb
sdf file: 600334.sdf
directory: 600334


3-[(2-Benzoxazolylmethyl)amino]-6-methyl-5-(ethoxycarbonyl)pyridin-2(1H)-one AIDS-004671 AIDS004671 Pyridinone deriv.

pdb file: 600335.pdb
sdf file: 600335.sdf
directory: 600335


3-[(2-Benzoxazolylmethyl)amino]-6-methyl-5-(methylsulfinyl)pyridin-2(1H)-one AIDS-004672 AIDS004672 Pyridinone deriv.

pdb file: 600336.pdb
sdf file: 600336.sdf
directory: 600336


3-[(2-Naphthylmethyl)amino]-5-ethyl-6-methylpyridin-2(1H)-thione AIDS-004673 AIDS004673 Pyridinone deriv.

pdb file: 600337.pdb
sdf file: 600337.sdf
directory: 600337


3-[(2-Naphthylmethyl)amino]-5-ethyl-1,6-dimethylpyridin-2(1H)-one AIDS-004674 AIDS004674 Pyridinone deriv.

pdb file: 600338.pdb
sdf file: 600338.sdf
directory: 600338


2-Quinolinone deriv. 3-[(2-Naphthylmethyl)amino]quinolin-2-one AIDS-004675 AIDS004675

pdb file: 600339.pdb
sdf file: 600339.sdf
directory: 600339


2-Pyridinone 3Quinol3MeNH deriv. 3-[3-(Quinolinylmethyl)amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004676 AIDS004676

pdb file: 600340.pdb
sdf file: 600340.sdf
directory: 600340


(+/-)-4'-Phosphomethyl-3'-thia-2',3'-dideoxycytidine, .beta.-isomer AIDS-004683 AIDS004683 BCH-189 phosphonate deriv.

pdb file: 600347.pdb
sdf file: 600347.sdf
directory: 600347


(+/-)-4'-Phosphomethyl-3'-thia-2',3'-dideoxycytidine,.alpha.-isomer AIDS-004684 AIDS004684 BCH-189 phosphonate deriv.

pdb file: 600348.pdb
sdf file: 600348.sdf
directory: 600348


2-Pyridinone 3benzofuranMeNH deriv. 3-[(4,7-Dichloro-2-benzofuranylmethyl)amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004694 AIDS004694

pdb file: 600358.pdb
sdf file: 600358.sdf
directory: 600358


2-Pyridinone 3benzofuranMeNH deriv. 3-[(7-Chloro-2-benzofuranylmethyl)amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004695 AIDS004695

pdb file: 600359.pdb
sdf file: 600359.sdf
directory: 600359


2-Pyridinone 3benzofuranMeNH deriv. 3-[(3-Methyl-2-benzofuranylmethyl)amino]-5-ethyl-6-methylpyridin-2(1H)-one AIDS-004696 AIDS004696

pdb file: 600360.pdb
sdf file: 600360.sdf
directory: 600360


142102-75-8 5Et-2',5'SilylSpiroU AIDS-004709 AIDS004709 TSAO deriv. [1-[2',5'-Bis-O-(tert-butyldimethylsilyl)-.beta.-D-ribofuranosyl]-5- ethyluracil]-3'-spiro-5-(4-amino-1,2-oxathiole-2,2-dioxide)

pdb file: 600372.pdb
sdf file: 600372.sdf
directory: 600372


1-Benzyloxy-3-(4-methoxybenzyloxy)-2-propanol, (R,S)- 2PrOH bis(BzO) deriv. AIDS-004711 AIDS004711

pdb file: 600374.pdb
sdf file: 600374.sdf
directory: 600374


141684-49-3 5'-Silyl-2'dT TSAO deriv. AIDS-004712 AIDS004712 [1-[5'-O-(tert-Butyldimethylsilyl)-2'-deoxy-.beta.-D-erythropentofuranosyl]thymine]-3'-spiro-5-[4-amino-1,2-oxathiole-2,2-dioxide]

pdb file: 600375.pdb
sdf file: 600375.sdf
directory: 600375


1-[2',5'-Bis-O-(tert-butyldimethylsilyl)-3'-C-cyano-3'-O-mesyl-.beta.-D-ribofuranosyl]thymine 141684-44-8 AIDS-004713 AIDS004713 diSilyl-3'CN-3'MeSylT TSAO deriv.

pdb file: 600376.pdb
sdf file: 600376.sdf
directory: 600376


1-(.beta.-D-Xylofuranosyl]uracil]-3'-spiro-5-[4-amino-1,2-oxathiole 2,2-dioxide 141684-50-6 AIDS-004715 AIDS004715 XyloU TSAO deriv.

pdb file: 600377.pdb
sdf file: 600377.sdf
directory: 600377


141684-45-9 AIDS-004716 AIDS004716 [1-[2',5'-Bis-O-(tert-butyldimethylsilyl)-.beta.-D-xylofuranosyl]thymine]-3'-spiro-5-[4-amino-1,2-oxathiole 2,2-dioxide] diSilylxyloT TSAO deriv.

pdb file: 600378.pdb
sdf file: 600378.sdf
directory: 600378


AIDS-004717 AIDS004717 Butanediamide, N1-[(1S,2R)-3-[(3S,4aR,8aR)-3-[[(1,1-dimethylethyl)amino]carbonyl]octahydro-2(1H)-isoquinolinyl]-2-hydroxy-1-(phenylmethyl)propyl]-2-[(2-quinolinylcarbonyl)amino]-, (2S)- Hydroxyethylamine deriv. QC-Asn-Phe-psi [CH(OH)CH2N]DIQ-NH-tBu

pdb file: 600379.pdb
sdf file: 600379.sdf
directory: 600379


AIDS-004718 AIDS004718 Butanediamide, N1-[(1S,2R)-3-[(3S,4aS,8aR)-3-[[(1,1-dimethylethyl)amino]carbonyl]octahydro-2(1H)-isoquinolinyl]-2-hydroxy-1-(phenylmethyl)propyl]-2-[(2-quinolinylcarbonyl)amino]-, (2S)- Hydroxyethylamine deriv. QC-Asn-Phe-psi [CH(OH)CH2N]DIQ-NH-tBu

pdb file: 600380.pdb
sdf file: 600380.sdf
directory: 600380


1-Benzyloxy-3-(4-methoxybenzyloxy)-2-phenylthiomethoxypropane, (R,S)- 2OHPr bis(BZO) deriv. AIDS-004720 AIDS004720

pdb file: 600382.pdb
sdf file: 600382.sdf
directory: 600382


1-(3-Azido-2,3-dideoxy-.alpha.,.beta.-D-erythro-pentofuranosyl)5-(4-(2-hydroxethyl)piperazinomethyl)uracil 3'-Azido dd pentofuranU deriv AIDS-004732 AIDS004732

pdb file: 600394.pdb
sdf file: 600394.sdf
directory: 600394


(4R,5S,6S,7R)-Hexahydro-5,6-dihydroxy-1,3,4,7-tetrakis(phenylmethyl)-2H-1,3-diazapin-2-thione 1,3-Diazepin-2-thione deriv. AIDS-004766 AIDS004766

pdb file: 600428.pdb
sdf file: 600428.sdf
directory: 600428


(-)-(2R,5R)-9-[2-(Hydroxymethyl)-1,3-oxathiolan-5-yl]guanine 145986-44-3 2-OHMe 1,3-OxathiolanG deriv. 6H-Purin-6-one, 2-amino-1,9-dihydro-9-[2-(hydroxymethyl)-1,3-oxathiolan-5-yl]-, (2R-trans)- AIDS-004803 AIDS004803

pdb file: 600465.pdb
sdf file: 600465.sdf
directory: 600465


1-AmylOEtOMe-6PhS T 1-[[(2-Pentyloxy)ethoxy]methyl]-6-(phenylthio)thymine 136160-16-2 AIDS-004821 AIDS004821 HEPT deriv.

pdb file: 600483.pdb
sdf file: 600483.sdf
directory: 600483


1-MeOMe-6PhS T 1-Methoxymethyl-6-(phenylthio)thymine 136160-17-3 AIDS-004822 AIDS004822 HEPT deriv.

pdb file: 600484.pdb
sdf file: 600484.sdf
directory: 600484


1-BuOMe-6PhS T 1-Butoxymethyl-6-(phenylthio)thymine 136160-31-1 AIDS-004823 AIDS004823 HEPT deriv.

pdb file: 600485.pdb
sdf file: 600485.sdf
directory: 600485


1-Me3SiEtOMe-6PhS T 1-[2-[(TrimethylSilyl)ethoxy]methyl]-6-(phenylthio)thymine 144410-24-2 AIDS-004824 AIDS004824 HEPT deriv.

pdb file: 600486.pdb
sdf file: 600486.sdf
directory: 600486


1-EtOMe-6PhS-5Et2thio U 1-Ethoxymethyl-phenylthio-5-ethyl-2-thiouracil 136011-43-3 AIDS-004825 AIDS004825 E-EPU-S HEPT deriv.

pdb file: 600487.pdb
sdf file: 600487.sdf
directory: 600487


1-i-Bu-6PhS-5Et2thio U 136160-39-9 5-Ethyl-1-isobutyl-6-(phenylthio)-2-thiouracil AIDS-004826 AIDS004826 HEPT deriv.

pdb file: 600488.pdb
sdf file: 600488.sdf
directory: 600488


1-cyHexOMe-6PhS-5Et2thio U 136160-41-3 5-Ethyl-1-[(cyclohexyloxy)methyl]-6-(phenylthio)-2-thiouracil AIDS-004827 AIDS004827 HEPT deriv.

pdb file: 600489.pdb
sdf file: 600489.sdf
directory: 600489


1-cyHexMeOMe-6PhS-5Et2thio U 144410-26-4 5-Ethyl-1-[(cyclohexylmethoxy)methyl-6-(phenylthio)-2-thiouracil AIDS-004828 AIDS004828 HEPT deriv.

pdb file: 600490.pdb
sdf file: 600490.sdf
directory: 600490


1-BzOMe-6PhS-5Et2thio U 136160-24-2 5-Ethyl-1-[(benzyloxy)methyl]-6-(phenylthio)-2-thiouracil AIDS-004829 AIDS004829 E-BPU-S HEPT deriv.

pdb file: 600491.pdb
sdf file: 600491.sdf
directory: 600491


1-MeBzOMe-6PhS-5Et2thio U 136160-28-6 5-Ethyl-1-[(4-methylbenzyloxy)methyl]-6-(phenylthio)-2-thiouracil AIDS-004830 AIDS004830 HEPT deriv.

pdb file: 600492.pdb
sdf file: 600492.sdf
directory: 600492


1-ClBzOMe-6PhS-5Et2thio U 136160-43-5 5-Ethyl-1-[(4-chlorobenzyloxy)methyl]-6-(phenylthio)-2-thiouracil AIDS-004831 AIDS004831 HEPT deriv.

pdb file: 600493.pdb
sdf file: 600493.sdf
directory: 600493


1-PhEtOMe-6PhS-5Et2thio U 136160-45-7 5-Ethyl-1-[(phenethyloxy)methyl]-6-([phenylthio)-2-thiouracil AIDS-004832 AIDS004832 HEPT deriv.

pdb file: 600494.pdb
sdf file: 600494.sdf
directory: 600494


1-EtOMe-6PhS-5-i-Pr2thio U 136160-33-3 5-Isopropyl-1-ethoxymethyl-6-(phenylthio)-2-thiouracil AIDS-004833 AIDS004833 HEPT deriv. I-EPU-S

pdb file: 600495.pdb
sdf file: 600495.sdf
directory: 600495


1-BzOMe-6PhS-5-i-Pr2thio U 136160-35-5 5-Isopropyl-1-benzyloxymethyl-6-(phenylthio)-2-thiouracil AIDS-004834 AIDS004834 HEPT deriv. I-BPU-S

pdb file: 600496.pdb
sdf file: 600496.sdf
directory: 600496


1-EtOMe-6PhS-5cyPr2thio U 136160-37-7 5-Cyclopropyl-1-ethoxymethyl-6-(phenylthio)-2-thiouracil AIDS-004835 AIDS004835 HEPT deriv.

pdb file: 600497.pdb
sdf file: 600497.sdf
directory: 600497


1-i-PrOMe-6PhS-5Et U 136160-38-8 5-Ethyl-1-[(isopropyloxy)methyl]-6-(phenylthio)uracil AIDS-004836 AIDS004836 HEPT deriv.

pdb file: 600498.pdb
sdf file: 600498.sdf
directory: 600498


1-cyHexOMe-6PhS-5Et U 136160-40-2 5-Ethyl-1-[cyclohexyloxy)methyl]-6-(phenylthio)uracil AIDS-004837 AIDS004837 HEPT deriv.

pdb file: 600499.pdb
sdf file: 600499.sdf
directory: 600499


1-cyHexMeOMe-6PhS-5Et U 136160-42-4 6-Ethyl-1-[(cyclohexylmethoxy)methyl]-6-(phenylthio)uracil AIDS-004838 AIDS004838 HEPT deriv.

pdb file: 600500.pdb
sdf file: 600500.sdf
directory: 600500


1-EtOMe-6diClPhS-5Et U 144410-27-5 5-Ethyl-1-ethoxymethyl-6-[(3,5-dichlorophenyl)thio]uracil AIDS-004839 AIDS004839 HEPT deriv.

pdb file: 600501.pdb
sdf file: 600501.sdf
directory: 600501


1-PhEtOMe-6PhS-5Et U 136160-44-6 5-Ethyl-1-[(phenethyloxy)methyl]-6-(phenylthio)uracil AIDS-004840 AIDS004840 HEPT deriv.

pdb file: 600502.pdb
sdf file: 600502.sdf
directory: 600502


1-EtOMe-6PhS-5-i-Pr U 136160-32-2 5-Isopropyl-1-ethoxymethyl-6-(phenylthio)uracil AIDS-004841 AIDS004841 HEPT deriv. I-EPU, I-HEPU

pdb file: 600503.pdb
sdf file: 600503.sdf
directory: 600503


1-EtOMe-6PhS-5cyPr U 136160-36-6 5-Cyclopropyl-1-ethoxymethyl-6-(phenythio)uracil AIDS-004843 AIDS004843 HEPT deriv.

pdb file: 600505.pdb
sdf file: 600505.sdf
directory: 600505


1-EtOMe-6diClPhS-5Et2thio U 144410-25-3 5-Ethyl-1-ethoxymethyl-6-[(3,5-dichlorophenyl)thio]uracil AIDS-004847 AIDS004847 HEPT deriv.

pdb file: 600509.pdb
sdf file: 600509.sdf
directory: 600509


1-BzOMe-6PhS-5-i-Pr U 136160-34-4 5-Isopropyl-1-[(benzyloxy)methyl]-6-(phenylthio)uracil AIDS-004864 AIDS004864 HEPT deriv. I-BPU

pdb file: 600524.pdb
sdf file: 600524.sdf
directory: 600524


148797-15-3 AIDS-004905 AIDS004905 Carbamic acid, [3,3-difluoro-2,4-dioxo-1-(phenylmethyl)-4-[(phenylmethyl)amino]butyl]-, phenylmethyl ester Difluorostatone deriv.

pdb file: 600565.pdb
sdf file: 600565.sdf
directory: 600565


148797-16-4 AIDS-004906 AIDS004906 Carbamic acid, [1-[[[3,3-difluoro-2,4-dioxo-1-(phenylmethyl)-4-[(phenylmethyl)amino]butyl]amino]carbonyl]-2-methylpropyl]-, phenylmethyl ester Difluorostatone deriv.

pdb file: 600566.pdb
sdf file: 600566.sdf
directory: 600566


148797-23-3 AIDS-004907 AIDS004907 Carbamic acid, [3,3-difluoro-2,4-dioxo-1-(phenylmethyl)-4-[[(trimethylsilyl)methyl]amino]butyl]-, phenylmethyl ester Difluorostatone deriv.

pdb file: 600567.pdb
sdf file: 600567.sdf
directory: 600567


148797-18-6 AIDS-004908 AIDS004908 Carbamic acid, [3,3-difluoro-1-(1-naphthalenylmethyl)-2,4-dioxo-4-[(phenylmethyl)amino]butyl]-, phenylmethyl ester Difluorostatone deriv.

pdb file: 600568.pdb
sdf file: 600568.sdf
directory: 600568


148797-19-7 AIDS-004909 AIDS004909 Carbamic acid, [3,3-difluoro-2,4-dioxo-1-(phenylmethyl)-4-[(phenylmethyl)amino]butyl]-, 1,1-dimethylethyl ester Difluorostatone deriv.

pdb file: 600569.pdb
sdf file: 600569.sdf
directory: 600569


148797-20-0 AIDS-004910 AIDS004910 Carbamic acid, [3,3-difluoro-1-[(4-hydroxyphenyl)methyl]-2,4-dioxo-4-[(phenylmethyl)amino]butyl]-, 1,1-dimethylethyl ester Difluorostatone deriv.

pdb file: 600570.pdb
sdf file: 600570.sdf
directory: 600570


148797-21-1 AIDS-004911 AIDS004911 Carbamic acid, [3,3-difluoro-2,4-dioxo-4-[(phenylmethyl)amino]-1-[(trimethylsilyl)methyl]butyl]-, 1,1-dimethylethyl ester Difluorostatone deriv.

pdb file: 600571.pdb
sdf file: 600571.sdf
directory: 600571


148797-22-2 AIDS-004912 AIDS004912 Carbamic acid, [4-[(2,2-dimethylpropyl)amino]-3,3-difluoro-2,4-dioxo-1-(phenylmethyl)butyl]-, phenylmethyl ester Difluorostatone deriv.

pdb file: 600572.pdb
sdf file: 600572.sdf
directory: 600572


(4S)-N-(2,2-dimethyl-2-silapropyl)-2,2-difluoro-3-oxo-5-phenyl-4-[(phenylmethoxy)carbonylamino]pentanamide AIDS-004913 AIDS004913 Difluorostatone deriv.

pdb file: 600573.pdb
sdf file: 600573.sdf
directory: 600573


148797-24-4 AIDS-004914 AIDS004914 Carbamic acid, [4-amino-3,3-difluoro-2,4-dioxo-1-(phenylmethyl)butyl]-, phenylmethyl ester Difluorostatone deriv.

pdb file: 600574.pdb
sdf file: 600574.sdf
directory: 600574


(4S)-4-{(2S)-2-[(phenylmethoxy)carbonylamino]pentanoylamino}-2,2-difluoro-3-oxo-5-phenyl-N-benzylpentanamide AIDS-004915 AIDS004915 Difluorostatone deriv.

pdb file: 600575.pdb
sdf file: 600575.sdf
directory: 600575


148797-25-5 AIDS-004916 AIDS004916 Carbamic acid, [1-[[[3,3-difluoro-2,4-dioxo-1-(phenylmethyl)-4-[(phenylmethyl)amino]butyl]amino]carbonyl]-3-methylbutyl]-, phenylmethyl ester Difluorostatone deriv.

pdb file: 600576.pdb
sdf file: 600576.sdf
directory: 600576


(4S)-4-{(2S)-4-methyl-2-[(phenylmethoxy)carbonylamino]pentanoylamino}-2,2-difluoro-3-oxo-5-phenyl-N-benzylpentanamide AIDS-004917 AIDS004917 Difluorostatone deriv.

pdb file: 600577.pdb
sdf file: 600577.sdf
directory: 600577


148797-27-7 AIDS-004920 AIDS004920 Carbamic acid, [3,3-difluoro-2-oxo-4-[(phenylacetyl)amino]-1-(phenylmethyl)butyl]-, phenylmethyl ester Difluorostatone deriv.

pdb file: 600580.pdb
sdf file: 600580.sdf
directory: 600580


148797-28-8 AIDS-004921 AIDS004921 Carbamic acid, [1-[[[3,3-difluoro-2-hydroxy-4-oxo-1-(phenylmethyl)-4-[(phenylmethyl)amino]butyl]amino]carbonyl]-2-methylpropyl]-, phenylmethyl ester Difluorostatone deriv.

pdb file: 600581.pdb
sdf file: 600581.sdf
directory: 600581


(2S)-N-[(1S)-3,3-difluoro-2,4-dioxo-6-phenyl-1-benzylhexyl]-3-methyl-2-[(phenylmethoxy)carbonylamino]butanamide AIDS-004922 AIDS004922 Difluorostatone deriv.

pdb file: 600582.pdb
sdf file: 600582.sdf
directory: 600582


2-Indolinone 3,3bis(pyridMe)1Ph deriv. 3,3-Bis[4-(1-methyl-1,2,5,6-tetrahydropyridyl)methyl]-1-phenylindolin-2-one AIDS-004929 AIDS004929

pdb file: 600589.pdb
sdf file: 600589.sdf
directory: 600589


2-Indolinone 3(pyridMe)1Ph deriv. 3-[4-(1-Methyl-1,2,5,6-tetrahydropyridyl)methyl]-1-phenyl-indolin-2-one AIDS-004930 AIDS004930

pdb file: 600590.pdb
sdf file: 600590.sdf
directory: 600590


2-Indolinone 3,3bis(piperidMe)1Ph deriv. 3,3-Bis[4-(1-methylpiperidinyl)methyl]-1-phenylindolin-2-one AIDS-004931 AIDS004931

pdb file: 600591.pdb
sdf file: 600591.sdf
directory: 600591


2-Indolinone 3,3bis(PyridMe)1Ph deriv. 3,3-Bis[4-(1-ethyl-1,2,5,6-tetrahydropyridyl)methyl]-1-phenylindolin-2-one AIDS-004932 AIDS004932

pdb file: 600592.pdb
sdf file: 600592.sdf
directory: 600592


2-Indolinone 3,3bis(PyridMe)1Ph deriv. 3,3-Bis[4-(1-cyclopropylmethyl-1,2,5,6-tetrahydropyridyl)methyl]-1-phenylindolin-2-one AIDS-004933 AIDS004933

pdb file: 600593.pdb
sdf file: 600593.sdf
directory: 600593


2-Indolinone 3(PiperidMe)1Ph deriv. 3-[4-(1-Benzoylpiperidinyl)methyl]-1-phenylindolin-2-one AIDS-004934 AIDS004934

pdb file: 600594.pdb
sdf file: 600594.sdf
directory: 600594


2-Indolinone 3(PiperidMe)1Ph deriv. 3-[4-(1-Ethoxycarbonylpiperidinyl)methyl]-1-phenylindolin-2-one AIDS-004935 AIDS004935

pdb file: 600595.pdb
sdf file: 600595.sdf
directory: 600595


2-Indolinone 3(PiperidMe)1Ph deriv. 3-[[4-(Methylsulfonyl)-4-piperdinyl]methyl]-1,3-dihydro-1-phenyl-2H-indol-2-one AIDS-004936 AIDS004936

pdb file: 600596.pdb
sdf file: 600596.sdf
directory: 600596


2-Indolinone 3(PiperidMe)1Ph deriv. 2-[3-[4-[(2,3-Dihydro-2-oxo-1-phenyl-1H-indol-3-yl)methyl]-1-piperidinyl]-2-hydroxypropyl]-1H-isoindole-1,3-dione AIDS-004937 AIDS004937

pdb file: 600597.pdb
sdf file: 600597.sdf
directory: 600597


2-Indolinone 3,3bis(PyridEt)1Ph deriv. 3,3-Bis-[(2-(3-pyridinyl)ethyl)]-1,3-dihydro-1-phenyl-2H-indol-2-one AIDS-004938 AIDS004938

pdb file: 600598.pdb
sdf file: 600598.sdf
directory: 600598


2-Indolinone 3,3bis(PiperidEt)1Ph deriv. 3,3-Bis-[(2-(1-methyl-3-piperidinyl)ethyl)]-1,3-dihydro-1-phenyl-2H-indol-2-one AIDS-004939 AIDS004939

pdb file: 600599.pdb
sdf file: 600599.sdf
directory: 600599


2-Indolinone 3,3bis(PyridPr)1Ph deriv. 3,3-Bis-[(3-(3-pyridinyl)propyl)]-1,3-dihydro-1-phenyl-2H-indol-2-one AIDS-004940 AIDS004940

pdb file: 600600.pdb
sdf file: 600600.sdf
directory: 600600


1-Phenyl-2',3',5',6'-tetrahydro-spiro-3H-indole-3',4'-(1'H)-pyridin-2(1H)-one 2-Indolinone 3SpiroPiperid 1Ph deriv. AIDS-004941 AIDS004941

pdb file: 600601.pdb
sdf file: 600601.sdf
directory: 600601


1,3-Dihydro-1-phenyl-3-(phenylmethyl)-3-(4-pyridinylmethyl)-2H-indol-2-one 2-Indolinone 3,3Bz3(PyridMe)1Ph deriv. AIDS-004942 AIDS004942

pdb file: 600602.pdb
sdf file: 600602.sdf
directory: 600602


1,3-Dihydro-1-phenyl-3-(phenylmethyl)-3-[(1,2,3,6-tetrahydro-1-methyl-4-pyridinyl)methyl]-2H-indol-2-one 2-Indolinone 3Bz3(PyridMe)1Ph deriv. AIDS-004943 AIDS004943

pdb file: 600603.pdb
sdf file: 600603.sdf
directory: 600603


1,3-Dihydro-3-[(4-nitrophenyl)methyl]-1-phenyl-3-(4-pyridinylmethyl)-2H-indol-2-one 2-Indolinone 3Bz3(PyridMe)1Ph deriv. AIDS-004944 AIDS004944

pdb file: 600604.pdb
sdf file: 600604.sdf
directory: 600604


2-Indolinone 3Bz3(PyridMe)1Ph deriv. 3-[(4-Aminophenyl)methyl]-1,3-dihydro-1-phenyl-3-(4-pyridinylmethyl)-2H-indol-2-one AIDS-004945 AIDS004945

pdb file: 600605.pdb
sdf file: 600605.sdf
directory: 600605


2-Indolinone 3,3bis(ImidazMe)1Ph deriv. 3,3-Bis(2-imidazoylmethyl)-1-phenyl-2H-indolin-2-one AIDS-004946 AIDS004946

pdb file: 600606.pdb
sdf file: 600606.sdf
directory: 600606


2-Indolinone 3,3bis(BenzylimidMe)1Ph deriv. 3,3-Bis[2-(1-benzylimidazoyl)methyl]-1-phenyl-2H-indol-2-one AIDS-004947 AIDS004947

pdb file: 600607.pdb
sdf file: 600607.sdf
directory: 600607


2-Indolinone 3,3bis(ThiazolMe)1Ph deriv. 3,3-Bis-(2-methyl-4-thiazolylmethyl)-1,3-dihydro-1-phenyl-2H-indol-2-one AIDS-004948 AIDS004948

pdb file: 600608.pdb
sdf file: 600608.sdf
directory: 600608


1,3-Dihydro-1-(phenylmethyl)-3,3-bis-[(1,2,5,6-tetrahydro-1-methyl-4-pyridinyl)methyl]-2H-indol-2-one 2-Indolinone 3,3bis(PyridMe)1Bz deriv. AIDS-004949 AIDS004949

pdb file: 600609.pdb
sdf file: 600609.sdf
directory: 600609


1,3-Dihydro-1-n-octyl-3,3-bis[(1,2,5,6-tetrahydro-1-methyl-4-pyridinyl)methyl]-2H-indol-2-one 2-Indolinone 3,3bis(PyridMe)1oct deriv. AIDS-004950 AIDS004950

pdb file: 600610.pdb
sdf file: 600610.sdf
directory: 600610


1,3-Dihydro-1-phenyl-3,3-bis[(1,2,5,6-tetrahydro-1-methyl-4-pyridinyl)methyl]-2H-benz(f)indol-2-one 2-Benzindolinone 3,3bis(PyridMe)1Ph deriv. AIDS-004951 AIDS004951

pdb file: 600611.pdb
sdf file: 600611.sdf
directory: 600611


6,7-Dihydro-2,2-bis[(1,2,5,6-tetrahydro-1-methyl-4-pyridinyl)methyl]indolo-(1,7-AB)(1)benzazepin-1(2H)-one AIDS-004952 AIDS004952 Indolobenzazepin-1-one 3,3bis(PyridMe) deriv.

pdb file: 600612.pdb
sdf file: 600612.sdf
directory: 600612


2-Indolinone 3PyridMe 1Ph deriv. 3[(1,2,5,6-Tetrahydro-1-methyl-4-pyridinyl)methyl]-1-phenyl-1H-indole AIDS-004953 AIDS004953

pdb file: 600613.pdb
sdf file: 600613.sdf
directory: 600613


4,4'-[(9H-Fluorene-9,9-diylbis(methylene))]bis(1,2,5,6-tetrahydro-1-methyl)pyridine AIDS-004954 AIDS004954 Fluorene 9,9bis(PyridMe) deriv.

pdb file: 600614.pdb
sdf file: 600614.sdf
directory: 600614


4,4'-[(9H-Fluorene-9,9-diylbis(methylene))]-bis(1-methyl)piperidine AIDS-004955 AIDS004955 Fluorene 9,9bis(PiperidMe) deriv.

pdb file: 600615.pdb
sdf file: 600615.sdf
directory: 600615


4,4'-[(2-Methyl-9H-fluorene-9,9-diylbis(methylene))]-bis(1-methyl)piperidine AIDS-004956 AIDS004956 Fluorene 9,9bis(PiperidMe) deriv.

pdb file: 600616.pdb
sdf file: 600616.sdf
directory: 600616


1,2-Dihydro-2,2-bis-[(1,2,5,6-tetrahydro-1-methyl-4-pyridinyl)methyl]-1-acenaphthylenol 3-Acenaphthenol 3,3bis(PyridMe) deriv. AIDS-004957 AIDS004957

pdb file: 600617.pdb
sdf file: 600617.sdf
directory: 600617


AIDS-004966 AIDS004966 Penicillin 1,4-butylenediamide (dimer), benzylaminocarbonyl deriv. Penicillin Bu(NH)2 dimer

pdb file: 600626.pdb
sdf file: 600626.sdf
directory: 600626


AIDS-004968 AIDS004968 Penicillin, (R,S)-2,3-dihydroxy-1,4-butylenediamide (dimer), benzylaminocarbonyl deriv. Penicillin, 2,3-diOHBu(NH)2 dimer

pdb file: 600628.pdb
sdf file: 600628.sdf
directory: 600628


AIDS-004969 AIDS004969 Penicillin, (R,R)-2,3-dihydroxy-1,4-butylenediamide (dimer), benzylaminocarbonyl deriv. Penicillin, 2,3-diOHBu(NH)2 dimer

pdb file: 600629.pdb
sdf file: 600629.sdf
directory: 600629


AIDS-004970 AIDS004970 Penicillin, (S,S)-2,3-dihydroxy-1,4-butylenediamide (dimer), benzylaminocarbonyl deriv. Penicillin, 2,3-diOHBu(NH)2 dimer

pdb file: 600630.pdb
sdf file: 600630.sdf
directory: 600630


AIDS-004971 AIDS004971 Penicillin, 1,2-ethylene-(N,N'-dimethyl)diamide (dimer), benzylaminocarbonyl deriv. Penicillin, Et(MeN)2 dimer

pdb file: 600631.pdb
sdf file: 600631.sdf
directory: 600631


AIDS-004972 AIDS004972 Penicillin, 1-hydroxy-1,2-ethylenediamide (dimer), benzylaminocarbonyl deriv. Penicillin, OHEt(NH)2 dimer

pdb file: 600632.pdb
sdf file: 600632.sdf
directory: 600632


AIDS-005009 AIDS005009 L-AC2 L-Phosphatidyl choline, 12-methoxydodecanoyl deriv. Lecithin, 12MO deriv.

pdb file: 600669.pdb
sdf file: 600669.sdf
directory: 600669


AIDS-005010 AIDS005010 D-AC2 D-Phosphatidyl choline, 12-methoxydodecanoyl deriv. Lecithin, 12MO deriv.

pdb file: 600670.pdb
sdf file: 600670.sdf
directory: 600670


AIDS-005011 AIDS005011 Cepahalin, 12MO deriv. L-PE2 L-Phosphatidylethanolamine, 12-methoxydodecanoyl deriv.

pdb file: 600671.pdb
sdf file: 600671.sdf
directory: 600671


AIDS-005012 AIDS005012 Cephalin, 12MO deriv. D-PE2 D-Phosphatidylethanolamine, 12-methoxydodecanoyl deriv. DPE

pdb file: 600672.pdb
sdf file: 600672.sdf
directory: 600672


AIDS-005015 AIDS005015 L-PA2, 12MO deriv. L-Phosphatidic acid, 12-methoxydodecanoyl deriv. LPA

pdb file: 600675.pdb
sdf file: 600675.sdf
directory: 600675


AIDS-005016 AIDS005016 D-PA2, 12MO deriv. D-Phosphatidic acid, 12-methoxydodecanoyl deriv. DPA

pdb file: 600676.pdb
sdf file: 600676.sdf
directory: 600676


1-[3-(Ethylamino)-2-pyridinyl]-4-[(5-hydroxy-2-indolyl)carbonyl]piperazine 136816-96-1 AIDS-005053 AIDS005053 BHAP der Piperazine 1Pyrid 4Indolyl deriv. Piperazine, 1-[3-(ethylamino)-2-pyridinyl]-4-[(5-hydroxy-1H-indol-2-yl)carbonyl]-

pdb file: 600713.pdb
sdf file: 600713.sdf
directory: 600713


1-[(6-Hydroxy-2-indolyl)carbonyl]-4-[3-(isopropylamino)-2-pyridinyl]piperazine 147920-11-4 AIDS-005055 AIDS005055 Piperazine 1Pyrid 4Indolyl deriv.

pdb file: 600715.pdb
sdf file: 600715.sdf
directory: 600715


1-[(6-Cyano-2-indolyl)carbonyl]-4-[3-(isopropylamino)-2-pyridinyl]piperazine 147920-12-5 AIDS-005056 AIDS005056 BHAP der. Piperazine 1Pyrid 4Indolyl deriv.

pdb file: 600716.pdb
sdf file: 600716.sdf
directory: 600716


1-[(6-Formyl-2-indolyl)carbonyl]-4-[3-(isopropylamino)-2-pyridinyl]piperazine 136817-66-8 AIDS-005057 AIDS005057 BHAP der Piperazine 1Pyrid 4Indolyl deriv. Piperazine, 1-[(6-formyl-1H-indol-2-yl)carbonyl]-4-[3-[(1-methylethyl)amino]-2-pyridinyl]-

pdb file: 600717.pdb
sdf file: 600717.sdf
directory: 600717


1-[[5-(Methylsulfonyloxy)-2-indolyl]carbonyl]-4-[3-(isopropylamino)-2-pyridinyl]piperazine 147920-13-6 AIDS-005058 AIDS005058 BHAP der Piperazine 1Pyrid 4Indolyl deriv.

pdb file: 600718.pdb
sdf file: 600718.sdf
directory: 600718


1-[[5-[(Methoxycarbonyl)amino]-2-indolyl]carbonyl]-4-[3-(isopropylamino)-2-pyridinyl]piperazine 147920-14-7 AIDS-005060 AIDS005060 Piperazine 1Pyrid 4Indolyl deriv.

pdb file: 600720.pdb
sdf file: 600720.sdf
directory: 600720


1-[[5-(Trifluoroacetylamino)-2-indolyl]carbonyl]-4-[3-(isopropylamino)-2-pyridinyl]piperazine 147920-15-8 AIDS-005061 AIDS005061 Piperazine 1Pyrid 4Indolyl deriv.

pdb file: 600721.pdb
sdf file: 600721.sdf
directory: 600721


1-[[5-(Trifluoromethylsulfonylamino)-2-indolyl]carbonyl]-4-[3-(isopropylamino)-2-pyridinyl]piperazine 147920-16-9 AIDS-005062 AIDS005062 Piperazine 1Pyrid 4Indolyl deriv.

pdb file: 600722.pdb
sdf file: 600722.sdf
directory: 600722


1-[[6-(Methylsulfonylamino)-2-indolyl]carbonyl]-4-[3-(isopropylamino)-2-pyridinyl]piperazine 147920-17-0 AIDS-005063 AIDS005063 Piperazine 1Pyrid 4Indolyl deriv. Piperazine, 1-[3-[(1-methylethyl)amino]-2-pyridinyl]-4-[[5-[(methylsulfonyl)amino]-1H-indol-2-yl]carbonyl]-

pdb file: 600723.pdb
sdf file: 600723.sdf
directory: 600723


1-[[6-(Methylsulfonyloxy)-2-indolyl]carbonyl]-4-[3-(isopropylamino)-2-pyridinyl]piperazine 147920-18-1 AIDS-005064 AIDS005064 Piperazine 1Pyrid 4Indolyl deriv.

pdb file: 600724.pdb
sdf file: 600724.sdf
directory: 600724


1-[6-[(Hydroxymethyl)-2-indolyl]carbonyl]-4-[3-(isopropylamino)-2-pyridinyl]piperazine 136817-78-2 AIDS-005065 AIDS005065 Piperazine 1Pyrid 4Indolyl deriv. Piperazine, 1-[[6-(hydroxymethyl)-1H-indol-2-yl]carbonyl]-4-[3-[(1-methylethyl)amino]-2-pyridinyl]-

pdb file: 600725.pdb
sdf file: 600725.sdf
directory: 600725


1-[5-[[N-(methyl)methylsulfonylamino]-2-indolyl]carbonyl]-4-[3-(isopropylamino)-2-pyridinyl]piperazine 147920-19-2 AIDS-005066 AIDS005066 BHAP der. Piperazine, 1-Pyridine, 5-Indolyl deriv.

pdb file: 600726.pdb
sdf file: 600726.sdf
directory: 600726


2-[3[4-(4-Chlorophenyl)-4-hydroxy-piperidinyl]propyl]-2-(4-fluorophenyl)-1,3-dithiolane AIDS-005079 AIDS005079 Haloperidol, thioketal deriv. UCSF8

pdb file: 600738.pdb
sdf file: 600738.sdf
directory: 600738


.alpha.-T OHMe deriv. 2,2':5',2''-Terthien-5-ylmethanol AIDS-005099 AIDS005099

pdb file: 600758.pdb
sdf file: 600758.sdf
directory: 600758



2-Pyridinone deriv. 3-[2-(Benzoxazol-2-yl)ethyl]-5-(aminocarbonyl)-6-methylpyridin-2(1H)-one AIDS-005203 AIDS005203

pdb file: 600862.pdb
sdf file: 600862.sdf
directory: 600862


2-Pyridinone deriv. 3-[2-(Benzoxazol-2-yl)ethyl]-5-(hydroxymethyl)-6-methylpyridin-2(1H)-one AIDS-005204 AIDS005204

pdb file: 600863.pdb
sdf file: 600863.sdf
directory: 600863


2-Pyridinone deriv. 3-[2-(Benzoxazol-2-yl)ethyl]-5-(methoxymethyl)-6-methylpyridin-2(1H)-one AIDS-005205 AIDS005205

pdb file: 600864.pdb
sdf file: 600864.sdf
directory: 600864


2-Pyridinone deriv. 3-[2-(Benzoxazol-2-yl)ethyl]-5-(dimethylamino)-6-methylpyridin-2(1H)-one AIDS-005206 AIDS005206

pdb file: 600865.pdb
sdf file: 600865.sdf
directory: 600865


2-Pyridinone deriv. 3-[2-(Benzoxazol-2-yl)ethyl]-5-ethylpyridin-2(1H)-one AIDS-005207 AIDS005207

pdb file: 600866.pdb
sdf file: 600866.sdf
directory: 600866


2-Pyridinone deriv. 3-[2-(4,7-Dichlorobenzoxazol-2-yl)ethyl]-5,6-dimethylpyridin-2(1H)-one AIDS-005208 AIDS005208

pdb file: 600867.pdb
sdf file: 600867.sdf
directory: 600867


2-Pyridinone deriv. 3-[2-(4,7-Dichlorobenzoxazol-2-yl)ethyl]-5-n-propyl-6-methylpyridin-2(1H)-one AIDS-005209 AIDS005209

pdb file: 600868.pdb
sdf file: 600868.sdf
directory: 600868


158761-03-6 1H-Naphtho[1,8a-c]furan-4-carboxaldehyde, 3,3a,6,6a,7,8,9,10-octahydro-3,10-dihydroxy-7,7-dimethyl-1-oxo-, (3S,3aS,6aS,10S,10aR)- 3,3a,6,6a,7,8,9,10-octahydro-3,10-dihydroxy-7,7-dimethyl-1-oxo-1H-naptho[1,8-c]furan-4-carboxaldehyde, [3S-(3.alpha.,3a.alpha.,6a.alpha.,10.alpha.,10aS*)] AIDS-005242 AIDS005242 Mniopetal F Naphthofuran-CHO deriv.

pdb file: 600901.pdb
sdf file: 600901.sdf
directory: 600901


6-Amino-2-[(3-formylbenzylidene)hydrazinocarbonyl]amino]-2,3-dihydro-1,3-dioxo-1H-benz[de]isoquinoline-5,8-disulfonic acid ADSN deriv. AIDS-005261 AIDS005261 Lucifer Yellow CH deriv.

pdb file: 600920.pdb
sdf file: 600920.sdf
directory: 600920


6-Amino-2-[[[(4'-formyl-1'-1'-biphenyl)-4-yl-hydrazono]carbonyl]amino]-1,3-dioxo-1H-benzo[de]isoquinoline-5,8-disulfonic acid, disodium salt ADSN deriv. AIDS-005262 AIDS005262 Lucifer Yellow CH monohydrazone

pdb file: 600921.pdb
sdf file: 600921.sdf
directory: 600921


2'-2'-[(1,1'Biphenyl-4',4-diyl)bis[(hydrazonocarbonyl)amino]-6-amino-1,3-dioxo-1H-benzo[de]isoquinoline-5,8-disulfonic acid ADSN deriv. AIDS-005263 AIDS005263 Lucifer Yellow CH biphenylbis analog

pdb file: 600922.pdb
sdf file: 600922.sdf
directory: 600922


AIDS-005264 AIDS005264 Bis(phenethylamino-succinate) C60 Fullerene (C60) deriv.

pdb file: 600923.pdb
sdf file: 600923.sdf
directory: 600923


6,6',7,7'-Tetrahydroxy-3,3'-dimethyl-5,5'-bis(1-methylethyl)-8,8'-diformyl(2,2'-binaphthalene)-1,1'4,4'-tetrone AIDS-005265 AIDS005265 Glossypol tetrone deriv. NSC651924

pdb file: 600924.pdb
sdf file: 600924.sdf
directory: 600924


1,1',8,8',9,9'-Hexahydro-4,4'-dimethyl-6,6'-bis(1-methylethyl)-3,3'-bi[2H-naphtho[1,8-bc]furan]-, hexaacetate AIDS-005266 AIDS005266 Glossypol furan deriv.

pdb file: 600925.pdb
sdf file: 600925.sdf
directory: 600925


1,1',6,6',7,7'-Hexahydroxy-3,3'-dimethyl-5,5'-bis(1-methylethyl)-[2,2'-bis[(.alpha.-hydroxymethyl)methylimino]acetic acid AIDS-005267 AIDS005267 Gossypol deriv.

pdb file: 600926.pdb
sdf file: 600926.sdf
directory: 600926


8,8',9,9',-Tetramethoxy-4,4'-dimethyl-6,6'-bis(1-methylethyl)-[3,3'-bis[2H-naphtho[1,8-bc]furan-1,1'-dione AIDS-005268 AIDS005268 Glossypol furan deriv.

pdb file: 600927.pdb
sdf file: 600927.sdf
directory: 600927


1-Methyl-3,3'-biindolenyl-2,2'-dione AIDS-005270 AIDS005270 Biindolene deriv.

pdb file: 600929.pdb
sdf file: 600929.sdf
directory: 600929


1,1',6,6',7,7'-Hexahydroxy-3,3'-dimethyl-5,5'-bis(1-methylethyl)-[2,2'-binaphthalene]-, tetraacetate AIDS-005271 AIDS005271 Glossypol dinitrile deriv.

pdb file: 600930.pdb
sdf file: 600930.sdf
directory: 600930


1,1',6,6',7,7'-Hexahydroxy-3,3'-dimethyl-5,5'-bis(1-methylethyl)-dicarboxaldehyde, dioxime AIDS-005273 AIDS005273 Glossypol dioxime deriv. NSC89308

pdb file: 600932.pdb
sdf file: 600932.sdf
directory: 600932


1,1',6,6',7,7'-Hexahydroxy-3,3'-dimethyl-5,5'-bis(1-methylethyl)-8,8'-bis(phenyliminomethyl)-[2,2'-binaphthalene] AIDS-005274 AIDS005274 Glossypol PhNCH deriv.

pdb file: 600933.pdb
sdf file: 600933.sdf
directory: 600933


1,1',6,6',7,7'-Hexahydroxy-3,3'-dimethyl-5,5'-bis(1-methylethyl)-8,8'-bis(hydroxyethyl)methyl)-[2,2'-binaphthalene] AIDS-005275 AIDS005275 Glossypol di-OHEtNCHN deriv. NSC11979

pdb file: 600934.pdb
sdf file: 600934.sdf
directory: 600934


1,1',6,6',7,7'-Hexahydroxy-3,3'-dimethyl-5,5'-bis(1-methylethyl)-8,8'-bis(iminomethyl)[2,2'-binaphthalene] AIDS-005277 AIDS005277 Glossypol di-iminomethyl deriv.

pdb file: 600936.pdb
sdf file: 600936.sdf
directory: 600936


1,1',6,6',7,7'-Hexahydroxy-3,3'-dimethyl-5,5'-bis(1-methylethyl)-8,8'-bis[(4-carboxyphenyl)iminomethyl][2,2'-binaphthalene] AIDS-005278 AIDS005278 Glossypol di-HOCOPhNCH deriv.

pdb file: 600937.pdb
sdf file: 600937.sdf
directory: 600937


1,1',6,6',7,7'-Hexahydroxy-3,3'-dimethyl-5,5'-bis(1-methylethyl)-8,8'-bis[[(2-hydroxysulfonyl)ethyl]iminomethyl][2,2'-binaphthalene] AIDS-005279 AIDS005279 Glossypol di-OHSO2EtNCH deriv.

pdb file: 600938.pdb
sdf file: 600938.sdf
directory: 600938


144674-89-5 AIDS-005337 AIDS005337 Piperazine deriv. Piperazine, 1-[[5-[[(dimethylamino)methylene]amino]-1H-indol-2-yl]carbonyl]-4-[3-[(1-methylethyl)amino]-2-pyridinyl]- U-89674

pdb file: 600994.pdb
sdf file: 600994.sdf
directory: 600994


1,3-Diazepin-2-one deriv. 153223-21-3 2H-1,3-Diazepin-2-one, 1,3-bis(cyclopropylmethyl)hexahydro-5,6-dihydroxy-4,7-bis(phenylmethyl)-, (4R,5S,6S,7R)- AIDS-005338 AIDS005338 CU XK234 [4R-(4.alpha.,5.alpha.,6.beta.,7.beta.)]-Hexahydro-5,6-dihydroxy-1,3- bis(cyclopropylmethyl)-4,7-bis(phenylmethyl)-2H-1,3-diazepin-2-one

pdb file: 600995.pdb
sdf file: 600995.sdf
directory: 600995


1,3-Diazepin-2-one deriv. 153244-86-1 2H-1,3-Diazepin-2-one, hexahydro-5,6-dihydroxy-1,3-bis(2-naphthalenylmethyl)-4,7-bis(phenylmethyl)-, (4R,5S,6S,7R)- AIDS-005339 AIDS005339 CU XK263 [4R-(4.alpha.,5.alpha.,6.beta.,7.beta.)]-Hexahydro-1,3-bis(2-naphthylmethyl)-2H-5,6-dihydroxy-4,7-dibenzyl-2H-1,3-diazepin-2-one

pdb file: 600996.pdb
sdf file: 600996.sdf
directory: 600996


(3-5')-Cholesterylamino acetate conjugated oligonucleotide(pTGCCTGGAGCTGCTTGATGC) AIDS-005364 AIDS005364 MR-20 Oligonucleotide-cholesterol deriv.

pdb file: 601021.pdb
sdf file: 601021.sdf
directory: 601021


AIDS-005370 AIDS005370 C2-sym dimer Penicillin Et(NH)2 dimer Penicillin deriv. [2R-[2.alpha.(R*),4.beta.]]-4,4'-[1,2-Ethanediylbis[aminocarbonyl]]bis[N-(2,2,2-trifluoroethyl-5,5-dimethyl-.alpha.-[(phenylacetyl)amino]-2-thiazolidineacetamide]

pdb file: 601027.pdb
sdf file: 601027.sdf
directory: 601027


AIDS-005384 AIDS005384 C2-sym dimer Penicillin deriv. [2R-[2.alpha.(R*),4.beta.]]-4,4'-[1,2-Ethanediylbis[aminocarbonyl]]-bis[N-ethyl-5,5-dimethyl-.alpha.-benzylamino-2-thiazolidineacetamide]

pdb file: 601041.pdb
sdf file: 601041.sdf
directory: 601041


AIDS-005392 AIDS005392 C2-sym dimer Penicillin deriv. [2R-[2.alpha.(R*),4.beta.]]-4,4'-[1,2-Ethanediylbis(aminocarbonyl)]bis[N-ethyl-5,5-dimethyl-.alpha.-[[(5-methyl-3-phenyl-4-isoxazolyl)carbonyl]amino]-2-thiazolidineacetamide]

pdb file: 601049.pdb
sdf file: 601049.sdf
directory: 601049


AIDS-005393 AIDS005393 C2-sym dimer Penicillin deriv. [2R-[2.alpha.(R*),4.beta.]]-4,4'-[1,2-Ethanediylbis[aminocarbonyl]]bis[N-ethyl-5,5-dimethyl-.alpha.-[(phenylacetyl)amino]-2-thiazolidineacetamide]

pdb file: 601050.pdb
sdf file: 601050.sdf
directory: 601050


AIDS-005436 AIDS005436 N-[2-[5-[1(R/S)-[[(Serinylalaninyl)alaninyl]amino]-2-phenyl-1-ethyl]-2-oxo-2,3,6,7-tetrahydro-1H-azepin-1-yl]-3-methylbutyryl]valine, methyl ester Ser-Ala-Ala-NH-Azepin, Val deriv.

pdb file: 601092.pdb
sdf file: 601092.sdf
directory: 601092


AIDS-005437 AIDS005437 N-[2-[5-[1(R/S)-[[(Serinylalaninyl)alaninyl]amino]-2-phenyl-1-ethyl]-2-oxo-2,3,6,7-tetrahydro-1H-azepin-1-yl]-3-methylbutyryl]valine, methyl ester Ser-Ala-Ala-NH-Azepin, Val deriv.

pdb file: 601093.pdb
sdf file: 601093.sdf
directory: 601093


AIDS-005438 AIDS005438 Ala-NH-Azepin, Val-Val deriv. N-[2(S)-[2-Oxo-3(R,S)-benzyl-5-[1(S)-(alaninylamino)ethyl]-2,3,6,7-tetrahydro-1H-azepin-1-yl]-1-oxopropyl]valinylvaline, methyl ester

pdb file: 601094.pdb
sdf file: 601094.sdf
directory: 601094


AIDS-005439 AIDS005439 Ala-NH-Azepin, Val-Val deriv. N-[2(S)-[2-Oxo-3(R,S)-benzyl-5-[1(S)-(alaninylamino)ethyl]-2,3,6,7-tetrahydro-1H-azepin-1-yl]-1-oxopropyl]valinylvaline, methyl ester

pdb file: 601095.pdb
sdf file: 601095.sdf
directory: 601095


AIDS-005440 AIDS005440 N-[2-[2-oxo-5-[1(R,S)-(serinylamino)-1-ethyl]-2,3,6,7-tetrahydro-1H-azepin-1-yl]-1-oxo-3-phenylpropyl]prolylvalinylvaline, amide Ser-NH-Azepin, Pro-Val-Val deriv.

pdb file: 601096.pdb
sdf file: 601096.sdf
directory: 601096


AIDS-005441 AIDS005441 N-[2-[2-oxo-5-[1(R,S)-(serinylamino)-1-ethyl]-2,3,6,7-tetrahydro-1H-azepin-1-yl]-1-oxo-3-phenylpropyl]prolylvalinylvaline, amide Ser-NH-Azepin, Pro-Val-Val deriv.

pdb file: 601097.pdb
sdf file: 601097.sdf
directory: 601097


AIDS-005443 AIDS005443 Ala-NH-Azepin, Val-Val deriv. N-[2(S)-[3(R,S)-Benzyl-5-[1(S)-(alininylamino)-1-ethyl]-2,3,6,7-tetrahydro-1H-azepin-1-yl]-1-oxopropyl]valinylvaline, methyl ester

pdb file: 601099.pdb
sdf file: 601099.sdf
directory: 601099


AIDS-005444 AIDS005444 Ala-NH-Azepin, Val-Val deriv. N-[2(S)-[3(R,S)-Benzyl-5-[1(S)-(alininylamino)-1-ethyl]-2,3,6,7-tetrahydro-1H-azepin-1-yl]-1-oxopropyl]valinylvaline, methyl ester

pdb file: 601100.pdb
sdf file: 601100.sdf
directory: 601100


AIDS-005467 AIDS005467 Penicillin deriv. [2R-[2.alpha.(R*),4.beta.]]-4-Carbamoyl-5,5-dimethyl-.alpha.-[(phenylacetyl)amino]-N-(phenylmethyl)-2-thiazolidineacetamide

pdb file: 601123.pdb
sdf file: 601123.sdf
directory: 601123


AIDS-005468 AIDS005468 Penicillin deriv. [2R-[2.alpha.(R*),4.beta.]]-4-[[(2-Hydroxyethyl)amino]carbonyl]-5,5-dimethyl-.alpha.-[(phenylacetyl)amino]-N-(phenylmethyl)-2-thiazolidineacetamide

pdb file: 601124.pdb
sdf file: 601124.sdf
directory: 601124


(2RS,4S)-2-{(1R)-2-(benzylamino)-2-oxo-1-[(phenylacetyl)amino]ethyl}-N-[(1S)-1-benzyl-2-hydroxyethyl]-5,5-dimethyl-1,3-thiazolidine-4-carboxamide AIDS-005469 AIDS005469 Penicillin deriv.

pdb file: 601125.pdb
sdf file: 601125.sdf
directory: 601125


(2RS,4S)-2-{(1R)-2-(benzylamino)-2-oxo-1-[(phenylacetyl)amino]ethyl}-N-[(1R)-1-benzyl-2-hydroxyethyl]-5,5-dimethyl-1,3-thiazolidine-4-carboxamide AIDS-005470 AIDS005470 Penicillin deriv.

pdb file: 601126.pdb
sdf file: 601126.sdf
directory: 601126


AIDS-005471 AIDS005471 Penicillin deriv. [2R-[2.alpha.(R*),4.beta.(S)]]-5,5-Dimethyl-.alpha.-[(phenylacetyl)amino]-N-(phenylmethyl)-4-[[[-3-phenyl-1-(hydroxymethyl)propyl]amino]carbonyl]-2-thiazolidineacetamide

pdb file: 601127.pdb
sdf file: 601127.sdf
directory: 601127


AIDS-005472 AIDS005472 Penicillin deriv. [2R-[2.alpha.(R*),4.beta.(R)]]-5,5-Dimethyl-.alpha.-[(phenylacetyl)amino]-N-(phenylmethyl)-4-[[[1-(2-phenyl-1-(hydroxymethyl)propyl]amino]carbonyl]-2-thiazolidineacetamide

pdb file: 601128.pdb
sdf file: 601128.sdf
directory: 601128


AIDS-005473 AIDS005473 Penicillin deriv. [2R-[2.alpha.(R*),4.beta.(R)]]-5,5-Dimethyl-.alpha.-[(phenylacetyl)amino]-N-(phenylmethyl)-4-[[[1-(hydroxymethyl)-3-methylbutyl]amino]carbonyl]-2-thiazolidineacetamide

pdb file: 601129.pdb
sdf file: 601129.sdf
directory: 601129


AIDS-005474 AIDS005474 Penicillin deriv. [2R-[2.alpha.(R*),4.beta.(R)]]-5,5-Dimethyl-.alpha.-[(phenylacetyl)amino]-N-(phenylmethyl)-4-[[[1-(hydroxymethyl)-2-methylpropyl]amino]carbonyl]-2-thiazolidineacetamide

pdb file: 601130.pdb
sdf file: 601130.sdf
directory: 601130


AIDS-005475 AIDS005475 Penicillin deriv. [2R-[2.alpha.(R*),4.beta.]]-5,5-Dimethyl-.alpha.-[(phenylacetyl)amino]-N-(phenylmethyl)-4-[[[1-(hydroxymethyl)pentyl]amino]carbonyl]-2-thiazolidineacetamide

pdb file: 601131.pdb
sdf file: 601131.sdf
directory: 601131


AIDS-005477 AIDS005477 Penicillin deriv. [2R-[2.alpha.(R*),4.beta.(R)]]-5,5-Dimethyl-.alpha.-[(phenylacetyl)amino]-N-(phenylmethyl)-4-[[[1-(hydroxymethyl)-2-methylbutyl]amino]carbonyl]-2-thiazolidineacetamide

pdb file: 601133.pdb
sdf file: 601133.sdf
directory: 601133


AIDS-005479 AIDS005479 Penicillin deriv. [2R-[2.alpha.(R*),4.beta.(R)]]-5,5-Dimethyl-.alpha.-[(phenylacetyl)amino]-N-(phenylmethyl)-4-[[[1-(hydroxymethyl)ethyl]amino]carbonyl]-2-thiazolidineacetamide

pdb file: 601135.pdb
sdf file: 601135.sdf
directory: 601135


AIDS-005480 AIDS005480 Penicillin deriv. [2R-[2.alpha.(R*),4.beta.(R)]]-5,5-Dimethyl-.alpha.-[(phenylacetyl)amino]-N-(phenylmethyl)-4-[[[1-(2-phenyl-1-methyl)ethyl]amino]carbonyl]-2-thiazolidineacetamide

pdb file: 601136.pdb
sdf file: 601136.sdf
directory: 601136


AIDS-005481 AIDS005481 Penicillin deriv. [2R-[2.alpha.(R*),4.beta.(S)]]-5,5-Dimethyl-.alpha.-[(phenylacetyl)amino]-N-(phenylmethyl)-4-[[[1-(2-phenyl-1-(methyl)ethyl]amino]carbonyl]-2-thiazolidineacetamide

pdb file: 601137.pdb
sdf file: 601137.sdf
directory: 601137


(2R)-2-((4S)-4-{N-[(2S,1R)-3-Carbamoyl-2-hydroxy-1-benzylpropyl]carbamoyl}-5,5-dimethyl(1,3-thiazolidin-2-yl))-2-(2-phenylacetylamino)-N-benzylacetamide AIDS-005482 AIDS005482 Penicillin deriv.

pdb file: 601138.pdb
sdf file: 601138.sdf
directory: 601138


(2R)-2-(4-{N-[(1R,2R)-3-Carbamoyl-2-hydroxy-1-benzylpropyl]carbamoyl}(4S)-5,5-dimethyl(1,3-thiazolidin-2-yl))-2-(2-phenylacetylamino)-N-benzylacetamide AIDS-005483 AIDS005483 Penicillin deriv.

pdb file: 601139.pdb
sdf file: 601139.sdf
directory: 601139


4-[(2-{(1R)(2-Phenylacetylamino)[N-benzylcarbamoyl]methyl}(4S)-5,5-dimethyl(1,3-thiazolidin-4-yl))carbonylamino](3S,4R)-3-hydroxy-N-(2-methylpropyl)-5-phenylpentanamide AIDS-005484 AIDS005484 Penicillin deriv.

pdb file: 601140.pdb
sdf file: 601140.sdf
directory: 601140


4-[(2-{(1R)(2-Phenylacetylamino)[N-benzylcarbamoyl]methyl}(4S)-5,5-dimethyl(1,3-thiazolidin-4-yl))carbonylamino](3R,4R)-3-hydroxy-N-(2-methylpropyl)-5-phenylpentanamide AIDS-005485 AIDS005485 Penicillin deriv.

pdb file: 601141.pdb
sdf file: 601141.sdf
directory: 601141


4-[(2-{(1R)(2-Phenylacetylamino)[N-benzylcarbamoyl]methyl}(4S)-5,5-dimethyl(1,3-thiazolidin-4-yl))carbonylamino](3S,4R)-3-hydroxy-5-phenyl-N-benzylpentanamide AIDS-005486 AIDS005486 Penicillin deriv.

pdb file: 601142.pdb
sdf file: 601142.sdf
directory: 601142


4-[(2-{(1R)(2-Phenylacetylamino)[N-benzylcarbamoyl]methyl}(4S)-5,5-dimethyl(1,3-thiazolidin-4-yl))carbonylamino](3R,4R)-3-hydroxy-5-phenyl-N-benzylpentanamide AIDS-005487 AIDS005487 Penicillin deriv.

pdb file: 601143.pdb
sdf file: 601143.sdf
directory: 601143


4-[(2-{(1R)(2-Phenylacetylamino)[N-benzylcarbamoyl]methyl}(4S)-5,5-dimethyl(1,3-thiazolidin-4-yl))carbonylamino](3S,4R)-N-benzimidazol-2-yl-3-hydroxy-5-phenylpentanamide AIDS-005488 AIDS005488 Penicillin deriv.

pdb file: 601144.pdb
sdf file: 601144.sdf
directory: 601144


4-[(2-{(1R)(2-Phenylacetylamino)[N-benzylcarbamoyl]methyl}(4S)-5,5-dimethyl(1,3-thiazolidin-4-yl))carbonylamino](3R,4R)-N-benzimidazol-2-yl-3-hydroxy-5-phenylpentanamide AIDS-005489 AIDS005489 Penicillin deriv.

pdb file: 601145.pdb
sdf file: 601145.sdf
directory: 601145


AIDS-005490 AIDS005490 N-((1R)-2-Hydroxy-1-phenylethyl)-4-[(2-{(1R)(2-phenylacetylamino)[N-benzylcarbamoyl]methyl}(4S)-5,5-dimethyl(1,3-thiazolidin-4-yl))carbonylamino](3R,4R)-3-hydroxy-5-phenylpentanamide Penicillin deriv.

pdb file: 601146.pdb
sdf file: 601146.sdf
directory: 601146


4-[(2-{(1R)(2-Phenylacetylamino)[N-benzylcarbamoyl]methyl}(4S)-5,5-dimethyl(1,3-thiazolidin-4-yl))carbonylamino](3R,4R)-N-((1S)-2-hydroxy-1-phenylethyl)-3-hydroxy-5-phenylpentanamide AIDS-005491 AIDS005491 Penicillin deriv.

pdb file: 601147.pdb
sdf file: 601147.sdf
directory: 601147


AIDS-005492 AIDS005492 N-[(1R)-2-Hydroxy-1-benzylethyl]-4-[(2-{(1R)(2-phenylacetylamino)[N-benzylcarbamoyl]methyl}(4S)-5,5-dimethyl(1,3-thiazolidin-4-yl))carbonylamino](3R,4R)-3-hydroxy-5-phenylpentanamide Penicillin deriv.

pdb file: 601148.pdb
sdf file: 601148.sdf
directory: 601148


4-[(2-{(1R)(2-Phenylacetylamino)[N-benzylcarbamoyl]methyl}(4S)-5,5-dimethyl(1,3-thiazolidin-4-yl))carbonylamino](3R,4R)-N-[(1S)-2-hydroxy-1-benzylethyl]-3-hydroxy-5-phenylpentanamide AIDS-005493 AIDS005493 Penicillin deriv.

pdb file: 601149.pdb
sdf file: 601149.sdf
directory: 601149


4-[(2-{(1R)(2-Phenylacetylamino)[N-benzylcarbamoyl]methyl}(4S)-5,5-dimethyl(1,3-thiazolidin-4-yl))carbonylamino](3R,4R)-3-hydroxy-N-(2-imidazol-2-ylethyl)-5-phenylpentanamide AIDS-005494 AIDS005494 Penicillin deriv.

pdb file: 601150.pdb
sdf file: 601150.sdf
directory: 601150


4-[(2-{(1R)(2-phenylacetylamino)[N-benzylcarbamoyl]methyl}(4S)-5,5-dimethyl(1,3-thiazolidin-4-yl))carbonylamino](3R,4R)-3-hydroxy-N-(2-hydroxyethyl)-5-phenylpentanamide AIDS-005495 AIDS005495 Penicillin deriv.

pdb file: 601151.pdb
sdf file: 601151.sdf
directory: 601151


4-[(2-{(1R)(2-Phenylacetylamino)[N-benzylcarbamoyl]methyl}(4S)-5,5-dimethyl(1,3-thiazolidin-4-yl))carbonylamino](3R,4R)-N-(2,3-dihydroxypropyl)-3-hydroxy-5-phenylpentanamide AIDS-005496 AIDS005496 Penicillin deriv.

pdb file: 601152.pdb
sdf file: 601152.sdf
directory: 601152


4-[(2-{(1R)(2-Phenylacetylamino)[N-benzylcarbamoyl]methyl}(4S)-5,5-dimethyl(1,3-thiazolidin-4-yl))carbonylamino](3R,4R)-3-hydroxy-N-(3-hydroxypropyl)-5-phenylpentanamide AIDS-005497 AIDS005497 Penicillin deriv.

pdb file: 601153.pdb
sdf file: 601153.sdf
directory: 601153


(2R)-2-(4-{N-[(1R)-2-Hydroxy-3-(2-phenylacetylamino)-1-benzylpropyl]carbamoyl}(4S)-5,5-dimethyl(1,3-thiazolidin-2-yl))-2-(2-phenylacetylamino)-N-benzylacetamide AIDS-005498 AIDS005498 Penicillin deriv.

pdb file: 601154.pdb
sdf file: 601154.sdf
directory: 601154


2-Methyl-6-methoxy-4[[(4-methoxyphenyl)formimidoyl]amino]quinoline 2Me6MeO4Quinoline-NHN=CH deriv. AIDS-005513 AIDS005513

pdb file: 601169.pdb
sdf file: 601169.sdf
directory: 601169


2-Methyl-6-methoxy-4[[(3-methoxyphenyl)formimidoyl]amino]quinoline 2Me6MeO4Quinoline-NHN=CH deriv. AIDS-005514 AIDS005514

pdb file: 601170.pdb
sdf file: 601170.sdf
directory: 601170


2-Methyl-8-methoxy-4[[(4-methoxyphenyl)formimidoyl]amino]quinoline 2Me8MeO4Quinoline-NHN=CH deriv. AIDS-005515 AIDS005515

pdb file: 601171.pdb
sdf file: 601171.sdf
directory: 601171


2-Methyl-6-methoxy-4[[(3,4,5-trimethoxyphenyl)formimidoyl]amino]quinoline 2Me6MeO4Quinoline-NHN=CH deriv. AIDS-005517 AIDS005517

pdb file: 601172.pdb
sdf file: 601172.sdf
directory: 601172


2-Methyl-8-methoxy-4[[(2,4,5-trimethoxyphenyl)formimidoyl]amino]quinoline 2Me8MeO4Quinoline-NHN=CH deriv. AIDS-005518 AIDS005518

pdb file: 601173.pdb
sdf file: 601173.sdf
directory: 601173


2-Methyl-7-(trifluoromethyl)-4-[[(3,4,5-trimethoxyphenyl)formimidoyl]amino]quinoline 2Me7CF34Quinoline-NHN=CH deriv. AIDS-005520 AIDS005520

pdb file: 601174.pdb
sdf file: 601174.sdf
directory: 601174


2-Methyl-4-[[(9H-carbazol-9-yl)ethylformimidoyl]amino]quinoline 2Me4Quinoline-NHN=CH deriv. AIDS-005521 AIDS005521

pdb file: 601175.pdb
sdf file: 601175.sdf
directory: 601175


2-Methyl-7-methoxy-4-[[(3-nitrophenyl)formimidoyl]amino]quinoline 2Me7MeO4Quinoline-NHN=CH deriv. AIDS-005523 AIDS005523

pdb file: 601176.pdb
sdf file: 601176.sdf
directory: 601176


2-Methyl-7-ethoxy-4-[[[4-(dimethylamino)phenyl]formimidoyl]amino]quinoline 2Me7EtO4Quinoline-NHN=CH deriv. AIDS-005524 AIDS005524

pdb file: 601177.pdb
sdf file: 601177.sdf
directory: 601177


7-methoxy-4-[[(4-hydroxyphenyl)formimidoyl]amino]quinoline 7MeO4Quinoline-NHN=CH deriv. AIDS-005525 AIDS005525

pdb file: 601178.pdb
sdf file: 601178.sdf
directory: 601178


4-Methyl-6-methoxy-2-[[(4-fluorophenyl)formimidoyl]amino]quinoline 4Me6MeO2Quinoline-NHN=CH deriv. AIDS-005531 AIDS005531

pdb file: 601179.pdb
sdf file: 601179.sdf
directory: 601179


2-[[5-(Hydroxymethyl)-2-furanyl]formimidoyl]amino-4-methylquinoline 4Me4Quinoline-NHN=CH-R deriv. AIDS-005532 AIDS005532

pdb file: 601180.pdb
sdf file: 601180.sdf
directory: 601180


2-({7-[2-((3S,2R)-2,3,7,7-Tetramethylbicyclo[4.4.0]dec-1(10)-en-2-yl)ethyl](7S,2R,3R)-2,3,7-trimethylbicyclo[4.4.0]dec-5-en-2-yl}methyl)benzene-1,4-diol AIDS-005534 AIDS005534 Toxiusol, p-hydroquinone deriv.

pdb file: 601182.pdb
sdf file: 601182.sdf
directory: 601182


2-({(7S,1R)-7-[2-((7S,8R,9R)-8-Hydroxy-3,3,7,9-tetramethyl-2-oxabicyclo[5.4.0]undec-8-yl)ethyl]-1,3,7-trimethylbicyclo[4.4.0]dec-2-en-2-yl}methyl)benzene-1,4-diol AIDS-005537 AIDS005537 Shaagrockol C, p-hydroquinone deriv.

pdb file: 601185.pdb
sdf file: 601185.sdf
directory: 601185


(+-)R,S-9b-Phenyl-2,3-dihydrothiazolo[2,3-a]isoindol-5(9bH)-one 5218-08-6 AIDS-005557 AIDS005557 BM 21.1298 Thiazoloisoindolinone deriv.

pdb file: 601204.pdb
sdf file: 601204.sdf
directory: 601204


9b-Phenyl-2,3-dihydrothiazolo[2,3-a]isoindol-5(9bH)-thione AIDS-005558 AIDS005558 Thiazoloisoindol-5-thione Ph deriv.

pdb file: 601205.pdb
sdf file: 601205.sdf
directory: 601205


9b-(2-Thienyl)-2,3-dihydrothiazolo[2,3-a]isoindol-5(9bH)-one AIDS-005559 AIDS005559 Thiazoloisoindol-5-one, thienyl deriv.

pdb file: 601206.pdb
sdf file: 601206.sdf
directory: 601206


9b-(2-Furanyl)-2,3-dihydrothiazolo[2,3-a]isoindol-5(9bH)-one AIDS-005560 AIDS005560 Thiazoloisoindol-5-one, furanyl deriv

pdb file: 601207.pdb
sdf file: 601207.sdf
directory: 601207


9b-(1H-Pyrrol-2-yl)-2,3-dihydrothiazolo[2,3-a]isoindol-5(9bH)-one AIDS-005561 AIDS005561 Thiazoloisoindol-5-one, pyrrolyl deriv.

pdb file: 601208.pdb
sdf file: 601208.sdf
directory: 601208


(+-)R,S-9b-(1-Naphthyl)-2,3-Dihydrothiazolo[2,3-a]isoindol-5(9bH)-one AIDS-005562 AIDS005562 Thiazoloisoindol-5-one, C10H7 deriv.

pdb file: 601209.pdb
sdf file: 601209.sdf
directory: 601209


9b-(4-Chlorophenyl)-2,3-dihydrothiazolo[2,3-a]isoindol-5(9bH)-one AIDS-005564 AIDS005564 Thiazoloisoindol-5-one, Ph deriv.

pdb file: 601211.pdb
sdf file: 601211.sdf
directory: 601211


9b-(4-Methylphenyl)-2,3-dihydrothiazolo[2,3-a]isoindol-5(9bH)-one AIDS-005565 AIDS005565 Thiazoloisoindol-5-one, Ph deriv.

pdb file: 601212.pdb
sdf file: 601212.sdf
directory: 601212


9b-(4-Isopropylphenyl)-2,3-dihydrothiazolo[2,3-a]isoindol-5(9bH)-one AIDS-005566 AIDS005566 Thiazoloisoindol-5-one, Ph deriv.

pdb file: 601213.pdb
sdf file: 601213.sdf
directory: 601213


9b-(4-Methoxyphenyl)-2,3-dihydrothiazolo[2,3-a]isoindol-5(9bH)-one AIDS-005567 AIDS005567 Thiazoloisoindol-5-one, Ph deriv.

pdb file: 601214.pdb
sdf file: 601214.sdf
directory: 601214


9b-(3-Chlorophenyl)-2,3-dihydrothiazolo[2,3-a]isoindol-5(9bH)-one AIDS-005568 AIDS005568 Thiazoloisoindol-5-one, Ph deriv.

pdb file: 601215.pdb
sdf file: 601215.sdf
directory: 601215


9b-(3-Methylphenyl)-2,3-dihydrothiazolo[2,3-a]isoindol-5(9bH)-one AIDS-005569 AIDS005569 Thiazoloisoindol-5-one, Ph deriv.

pdb file: 601216.pdb
sdf file: 601216.sdf
directory: 601216


9b-(3-Methoxyphenyl)-2,3-Dihydrothiazolo[2,3-a]isoindol-5(9bH)-one AIDS-005570 AIDS005570 Thiazoloisoindol-5-one, Ph deriv.

pdb file: 601217.pdb
sdf file: 601217.sdf
directory: 601217


9b-(3-Ethylphenyl)-2,3-Dihydrothiazolo[2,3-a]isoindol-5(9bH)-one AIDS-005571 AIDS005571 Thiazoloisoindol-5-one, Ph deriv.

pdb file: 601218.pdb
sdf file: 601218.sdf
directory: 601218


9b-(3-Isopropylphenyl)-2,3-dihydrothiazolo[2,3-a]isoindol-5(9bH)-one AIDS-005572 AIDS005572 Thiazoloisoindol-5-one, Ph deriv.

pdb file: 601219.pdb
sdf file: 601219.sdf
directory: 601219


9b-(3-Trifluoromethylphenyl)-2,3-dihydrothiazolo[2,3-a]isoindol-5(9bH)-one AIDS-005573 AIDS005573 Thiazoloisoindol-5-one, Ph deriv.

pdb file: 601220.pdb
sdf file: 601220.sdf
directory: 601220


9b-(3-Hydroxyphenyl)-2,3-dihydrothiazolo[2,3-a]isoindol-5(9bH)-one AIDS-005574 AIDS005574 Thiazoloisoindol-5-one, Ph deriv.

pdb file: 601221.pdb
sdf file: 601221.sdf
directory: 601221


9b-(3-Aminophenyl)-2,3-dihydrothiazolo[2,3-a]isoindol-5(9bH)-one AIDS-005575 AIDS005575 Thiazoloisoindol-5-one, Ph deriv.

pdb file: 601222.pdb
sdf file: 601222.sdf
directory: 601222


9b-(3-Nitrophenyl)-2,3-dihydrothiazolo[2,3-a]isoindol-5(9bH)-one AIDS-005576 AIDS005576 Thiazoloisoindol-5-one, Ph deriv.

pdb file: 601223.pdb
sdf file: 601223.sdf
directory: 601223


9b-(3-Cyanophenyl)-2,3-dihydrothiazolo[2,3-a]isoindol-5(9bH)-one AIDS-005577 AIDS005577 Thiazoloisoindol-5-one, Ph deriv.

pdb file: 601224.pdb
sdf file: 601224.sdf
directory: 601224


9b-(2-Methylphenyl)-2,3-dihydrothiazolo[2,3-a]isoindol-5(9bH)-one AIDS-005578 AIDS005578 Thiazoloisoindol-5-one, Ph deriv.

pdb file: 601225.pdb
sdf file: 601225.sdf
directory: 601225


9b-(2,3-Dimethylphenyl)-2,3-dihydrothiazolo[2,3-a]isoindol-5(9bH)-one AIDS-005579 AIDS005579 Thiazoloisoindol-5-one, Ph deriv.

pdb file: 601226.pdb
sdf file: 601226.sdf
directory: 601226


9b-(2,5-Dimethylphenyl)-2,3-dihydrothiazolo[2,3-a]isoindol-5(9bH)-one AIDS-005580 AIDS005580 Thiazoloisoindol-5-one, Ph deriv.

pdb file: 601227.pdb
sdf file: 601227.sdf
directory: 601227


9b-(3,4-Dimethylphenyl)-2,3-dihydrothiazolo[2,3-a]isoindol-5(9bH)-one AIDS-005581 AIDS005581 Thiazoloisoindol-5-one, Ph deriv.

pdb file: 601228.pdb
sdf file: 601228.sdf
directory: 601228


(+)-(R)-9b-(3,5-Dimethylphenyl)-2,3-dihydrothiazolo[2,3-a]isoindol-5(9bH)-one AIDS-005582 AIDS005582 BM+51.0836 Thiazoloisoindol-5-one, Ph deriv.

pdb file: 601229.pdb
sdf file: 601229.sdf
directory: 601229


9b-(4-Indanyl)-2,3-dihydrothiazolo[2,3-a]isoindol-5(9bH)-one AIDS-005583 AIDS005583 Thiazoloisoindol-5-one, Indanyl deriv.

pdb file: 601230.pdb
sdf file: 601230.sdf
directory: 601230


9b-(3,5-Dichlorophenyl)-2,3-dihydrothiazolo[2,3-a]isoindol-5(9bH)-one AIDS-005584 AIDS005584 Thiazoloisoindol-5-one, Ph deriv.

pdb file: 601231.pdb
sdf file: 601231.sdf
directory: 601231


9b-(3,4-Dichlorophenyl)-2,3-dihydrothiazolo[2,3-a]isoindol-5(9bH)-one AIDS-005585 AIDS005585 Thiazoloisoindol-5-one, Ph deriv.

pdb file: 601232.pdb
sdf file: 601232.sdf
directory: 601232


9b-Phenyl-2,3-dihydrothiazolo[2,3-a]isoindol-5(9bH)-one, 1-oxide AIDS-005586 AIDS005586 Thiazoloisoindol-5-one, Ph deriv.

pdb file: 601233.pdb
sdf file: 601233.sdf
directory: 601233


9b-Phenyl-2,3-dihydrothiazolo[2,3-a]isoindol-5(9bH)-one, 1,1-dioxide AIDS-005587 AIDS005587 Thiazoloisoindol-5-one, Ph deriv.

pdb file: 601234.pdb
sdf file: 601234.sdf
directory: 601234


9b-Phenyl-2,3-dihydrooxazolo[2,3-a]isoindol-5(9bH)-one AIDS-005588 AIDS005588 Oxazoloisoindol-5-one, Ph deriv.

pdb file: 601235.pdb
sdf file: 601235.sdf
directory: 601235


9b-Phenyl-2,3-dihydrothiazolo[2,3-a]isoindol-5(9bH)-one AIDS-005589 AIDS005589 Imidazoloisoindol-5-one, Ph deriv.

pdb file: 601236.pdb
sdf file: 601236.sdf
directory: 601236


9b-Phenyl-1,2,3,9b-tetrahydro-5H-pyrrolo[2,1-a]isoindol-5-one AIDS-005590 AIDS005590 Pyrroloisoindol-5-one, Ph deriv.

pdb file: 601237.pdb
sdf file: 601237.sdf
directory: 601237


10b-Phenyl-2,3-dihydro-2H-[1,3]thiazino[2,3-a]isoindol-6(10bH)-one AIDS-005591 AIDS005591 Thiazinoisoindol-6-one, Ph deriv.

pdb file: 601238.pdb
sdf file: 601238.sdf
directory: 601238


10b-Phenyl-2,3-dihydro-2H-[1,3]oxazino[2,3-a]isoindol-6(10bH)-one AIDS-005592 AIDS005592 Oxazinoisoindol-6-one, Ph deriv.

pdb file: 601239.pdb
sdf file: 601239.sdf
directory: 601239


AIDS-005593 AIDS005593 Pyrimido[2,1-a]isoindol-6(2H)-one, 1,3,4,10b-tetrahydro-10b-phenyl- Pyrimidoloisoindol-6-one, Ph deriv.

pdb file: 601240.pdb
sdf file: 601240.sdf
directory: 601240


10b-Phenyl-1,2,3,10b-tetrahydropyrido-[2,1-a]isoindol-6(2H)-one AIDS-005594 AIDS005594 Pyridoisoindol-6-one, Ph deriv.

pdb file: 601241.pdb
sdf file: 601241.sdf
directory: 601241


9b(R)-Phenyl-2-methyl-2,3-dihydrooxazolo-[2,3-a]isoindol-5(9bH)-one AIDS-005595 AIDS005595 Oxazoloisoindol-5-one, Ph deriv.

pdb file: 601242.pdb
sdf file: 601242.sdf
directory: 601242


9b(S)-Phenyl-2-methyl-2,3-dihydrooxazolo-[2,3-a]isoindol-5(9bH)-one AIDS-005596 AIDS005596 Oxazoloisoindol-5-one, Ph deriv.

pdb file: 601243.pdb
sdf file: 601243.sdf
directory: 601243


9b-Phenyl-3-methyl-2,3-dihydrooxazolo[2,3-a]isoindol-5(9bH)-one AIDS-005597 AIDS005597 Oxazoloisoindol-5-one, Ph deriv.

pdb file: 601244.pdb
sdf file: 601244.sdf
directory: 601244


9b-Phenyl-3-methyl-2,3-dihydrooxazolo[2,3-a]isoindol-5(9bH)-one AIDS-005598 AIDS005598 Oxazoloisoindol-5-one, Ph deriv.

pdb file: 601245.pdb
sdf file: 601245.sdf
directory: 601245


9b-Phenyl-5-oxo-2,3,5,9b-tetrahydrothiazolo[2,3-a]isoindole-3-carboxylic acid methyl ester AIDS-005599 AIDS005599 Thiazoloisoindol-5-one, Ph deriv.

pdb file: 601246.pdb
sdf file: 601246.sdf
directory: 601246


9b-Phenyl-5-oxo-2,3,5,9b-tetrahydrothiazolo[2,3-a]-3-carboxylic acid AIDS-005600 AIDS005600 Thiazoloisoindol-5-one, Ph deriv.

pdb file: 601247.pdb
sdf file: 601247.sdf
directory: 601247


9b-Phenyl-5-oxo-2,3,5,9a-tetrahydrothiazolo[2,3-a]isoindole-3-carboxamide AIDS-005601 AIDS005601 Thiazoloisoindol-5-one, Ph deriv.

pdb file: 601248.pdb
sdf file: 601248.sdf
directory: 601248


5a-Phenylisoindolo[2,3-b][1,3]benzothiazin-10(5aH)-one AIDS-005602 AIDS005602 Indolobenzothiazin-10-one, Ph deriv.

pdb file: 601249.pdb
sdf file: 601249.sdf
directory: 601249


6-Methyl-9b-phenyl-2,3-dihydrothiazolo-[2,3-a]isoindol-5(9bH)-one AIDS-005603 AIDS005603 Thiazoloisoindol-5-one, Ph deriv.

pdb file: 601250.pdb
sdf file: 601250.sdf
directory: 601250


7-Methyl-9b-phenyl-2,3-dihydrothiazolo-[2,3-a]isoindol-5(9bH)-one AIDS-005604 AIDS005604 Thiazoloisoindol-5-one, Ph deriv.

pdb file: 601251.pdb
sdf file: 601251.sdf
directory: 601251


7-Chloro-9b-phenyl-2,3-dihydrothiazolo-[2,3-a]isoindol-5(9bH)-one AIDS-005605 AIDS005605 Thiazoloisoindol-5-one, Ph deriv.

pdb file: 601252.pdb
sdf file: 601252.sdf
directory: 601252


8-Methoxy-9b-phenyl-2,3-dihydrothiazolo-[2,3-a]isoindol-5(9bH)-one AIDS-005606 AIDS005606 Thiazoloisoindol-5-one, Ph deriv.

pdb file: 601253.pdb
sdf file: 601253.sdf
directory: 601253


7,8-Dichloro-9b-phenyl-2,3-dihydrothiazolo-[2,3-a]isoindol-5(9bH)-one AIDS-005607 AIDS005607 Thiazoloisoindol-5-one, Ph deriv.

pdb file: 601254.pdb
sdf file: 601254.sdf
directory: 601254


8-Methyl-9b-phenyl-2,3-dihydrothiazolo-[2,3-a]isoindol-5(9bH)-one AIDS-005608 AIDS005608 Thiazoloisoindol-5-one, Ph deriv.

pdb file: 601255.pdb
sdf file: 601255.sdf
directory: 601255


8-Chloro-9b-phenyl-2,3-dihydrothiazolo-[2,3-a]isoindol-5(9bH)-one AIDS-005609 AIDS005609 Thiazoloisoindol-5-one, Ph deriv.

pdb file: 601256.pdb
sdf file: 601256.sdf
directory: 601256


8-Methoxy-9b-phenyl-2,3-dihydrothiazolo-[2,3-a]isoindol-5(9bH)-one AIDS-005610 AIDS005610 Thiazoloisoindol-5-one, Ph deriv.

pdb file: 601257.pdb
sdf file: 601257.sdf
directory: 601257


8-Trifluoro-9b-phenyl-2,3-dihydrothiazolo-[2,3-a]isoindol-5(9bH)-one AIDS-005611 AIDS005611 Thiazoloisoindol-5-one, Ph deriv.

pdb file: 601258.pdb
sdf file: 601258.sdf
directory: 601258


8-Nitro-9b-phenyl-2,3-dihydrothiazolo-[2,3-a]isoindol-5(9bH)-one AIDS-005612 AIDS005612 Thiazoloisoindol-5-one, Ph deriv.

pdb file: 601259.pdb
sdf file: 601259.sdf
directory: 601259


8-Amino-9b-phenyl-2,3-dihydrothiazolo-[2,3-a]isoindol-5(9bH)-one AIDS-005613 AIDS005613 Thiazoloisoindol-5-one, Ph deriv.

pdb file: 601260.pdb
sdf file: 601260.sdf
directory: 601260


9-Chloro-9b-phenyl-2,3-dihydrothiazolo-[2,3-a]isoindol-5(9bH)-one AIDS-005614 AIDS005614 Thiazoloisoindol-5-one Ph deriv.

pdb file: 601261.pdb
sdf file: 601261.sdf
directory: 601261


6b-Phenyl-8,9-dihydronaphtho-[1,2-d]thiazolo-[5,1-b]pyrrol-9(6bH)-one AIDS-005615 AIDS005615 Naphthothiazolopyrrol-9-one, Ph deriv.

pdb file: 601262.pdb
sdf file: 601262.sdf
directory: 601262


11b-Phenyl-2,3-dihydronaphtho-[2,3-d]thiazolo-[5,1-b]pyrrol-5(11bH)-one AIDS-005616 AIDS005616 Naphthothiazolopyrrol-5-one, Ph deriv.

pdb file: 601263.pdb
sdf file: 601263.sdf
directory: 601263


11a-Phenyl-9,10-dihydronaphtho-[1,2-d]thiazolo-[5,1-b]pyrrol-7(11aH)-one AIDS-005617 AIDS005617 Naphthothiazolopyrrol-7-one, Ph deriv.

pdb file: 601264.pdb
sdf file: 601264.sdf
directory: 601264


9b-Phenyl-2,3-dihydrothiazolo-[3',2':1,5]pyrrolo[3,4-b]pyridin-5(9bH)-one AIDS-005618 AIDS005618 Thiazolopyrrolopyridin-5-one, Ph deriv.

pdb file: 601265.pdb
sdf file: 601265.sdf
directory: 601265


9b-Phenyl-2,3-dihydrothiazolo-[3',2':1,5]pyrrolo[3,4-c]pyridin-5(9bH)-one AIDS-005619 AIDS005619 Thiazolopyrrolopyridin-5-one, Ph deriv.

pdb file: 601266.pdb
sdf file: 601266.sdf
directory: 601266


9b-Phenyl-2,3-dihydrothiazolo-[3',2':1,5]pyrrolo[3,4-d]pyridin-5(9bH)-one AIDS-005620 AIDS005620 Thiazolopyrrolopyridin-5-one, Ph deriv.

pdb file: 601267.pdb
sdf file: 601267.sdf
directory: 601267


9b-Phenyl-2,3-dihydrothiazolo-[3',2':1,5]pyrrolo[3,4-e]pyridin-5(9bH)-one AIDS-005621 AIDS005621 Thiazolopyrrolopyridin-5-one, Ph deriv.

pdb file: 601268.pdb
sdf file: 601268.sdf
directory: 601268


9b-(2-Pyridyl)-2,3-dihydrothiazolo-[2,3-a]isoindol-5(9bH)-one AIDS-005622 AIDS005622 Thiazoloisoindol-5-one, Pyrid deriv.

pdb file: 601269.pdb
sdf file: 601269.sdf
directory: 601269


9b-(3-Pyridyl)-2,3-dihydrothiazolo-[2,3-a]isoindol-5(9bH)-one AIDS-005623 AIDS005623 Thiazoloisoindol-5-one, Pyrid deriv.

pdb file: 601270.pdb
sdf file: 601270.sdf
directory: 601270


9b-(4-Pyridyl)-2,3-dihydrothiazolo-[2,3-a]isoindol-5(9bH)-one AIDS-005624 AIDS005624 Thiazoloisoindol-5-one, Pyrid deriv.

pdb file: 601271.pdb
sdf file: 601271.sdf
directory: 601271


9b-(3-Methyl-2-pyridyl)-2,3-dihydrothiazolo-[2,3-a]isoindol-5(9bH)-one AIDS-005625 AIDS005625 Thiazoloisoindol-5-one, Pyrid deriv.

pdb file: 601272.pdb
sdf file: 601272.sdf
directory: 601272


9b-(5-Methyl-2-pyridyl)-2,3-dihydrothiazolo-[2,3-a]isoindol-5(9bH)-one AIDS-005626 AIDS005626 Thiazoloisoindol-5-one, Pyrid deriv.

pdb file: 601273.pdb
sdf file: 601273.sdf
directory: 601273


9b-(2-Pyridyl)-2,3-dihydrothiazolo-[3',2':1,2]pyrrolo[3,4-b]pyridin-5(9b)-one AIDS-005627 AIDS005627 Thiazolopyrrolopyridin-5-one, Pyrid deriv.

pdb file: 601274.pdb
sdf file: 601274.sdf
directory: 601274


9b-(3-Methyl-2-pyridyl)-2,3-dihydrothiazolo-[3',2':1,2]pyrrolo[3,4-b]pyridin-5(9b)-one AIDS-005628 AIDS005628 Thiazolopyrrolopyridin-5-one, Pyrid deriv.

pdb file: 601275.pdb
sdf file: 601275.sdf
directory: 601275


9b-(5-Methyl-2-pyridyl)-2,3-dihydrothiazolo-[3,2':1,2]pyrrolo[3,4-b]pyridin-5(9b)-one AIDS-005629 AIDS005629 Thiazolopyrrolopyridin-5-one, Pyrid deriv.

pdb file: 601276.pdb
sdf file: 601276.sdf
directory: 601276


(1-3)-.BETA.-D Glucan 115743-28-7 AIDS-005634 AIDS005634 Paramylon deriv. Paramylon sulfate

pdb file: 601281.pdb
sdf file: 601281.sdf
directory: 601281


.beta.-MAPI 83830-01-7 AIDS-005659 AIDS005659 N-[N-[N2-[[(1-Carboxy-2-phenylethyl)amino]carbonyl]-L-arginyl]-L-valyl]-D-phenylalanine, aldehyde deriv. Phe-CO-Arg-Val-D-Phe-H

pdb file: 601306.pdb
sdf file: 601306.sdf
directory: 601306


4-Hydroxy-3-(3-oxo-1-phenylbutyl)-2H-1-benzopyran-2-one 4OH-Coumarin deriv.;Coumadin 81-81-2 AIDS-005660 AIDS005660 Coumafen Coumafene NSC59813 Prothromadin Warfarin

pdb file: 601307.pdb
sdf file: 601307.sdf
directory: 601307


(+)-(R)-9b-(1-Naphthyl)-2,3-Dihydrothiazolo[2,3-a]isoindol-5(9bH)-one AIDS-005704 AIDS005704 Thiazoloisoindol-5-one, C10H7 deriv.

pdb file: 601351.pdb
sdf file: 601351.sdf
directory: 601351


(+)-(R)-9b-(3-Methylphenyl-2,3-Dihydrothiazolo[2,3-a]isoindol-5(9bH)-one AIDS-005705 AIDS005705 Thiazoloisoindol-5-one, Ph deriv.

pdb file: 601352.pdb
sdf file: 601352.sdf
directory: 601352


(+)-(R)-8-Chloro-9b-phenyl-2,3-dihydrothiazolo[2,3-a]isoindol-5(9bH)-one AIDS-005707 AIDS005707 Thiazoloisoindol-5-one, Ph deriv.

pdb file: 601354.pdb
sdf file: 601354.sdf
directory: 601354


(+)-2,6-Dichloro-.alpha.-[(2-nitrophenyl)amino]benzamide .alpha.-APA deriv. AIDS-005710 AIDS005710 PhNH-PhAcNH deriv. R 87231

pdb file: 601357.pdb
sdf file: 601357.sdf
directory: 601357


(-)-2,6-Dichloro-.alpha.-[(2-nitrophenyl)amino]benzamide AIDS-005711 AIDS005711 PhNH-PhAcNH deriv. R 87232 R87232 a.-APA deriv.

pdb file: 601358.pdb
sdf file: 601358.sdf
directory: 601358


(+/-)-2,6-Dichloro-.alpha.-[(2-acetylphenyl)amino]benzamide AIDS-005712 AIDS005712 PhNH-PhAcNH deriv. R 88703 a.-APA deriv.

pdb file: 601359.pdb
sdf file: 601359.sdf
directory: 601359


(+)-2,6-Dichloro-.alpha.-[(2-acetylphenyl)amino]benzamide .alpha.-APA deriv. AIDS-005713 AIDS005713 PhNH-PhAcNH deriv. R 88976

pdb file: 601360.pdb
sdf file: 601360.sdf
directory: 601360


(-)-2,6-Dichloro-.alpha.-[(2-acetylphenyl)amino]benzamide .alpha.-APA deriv. AIDS-005714 AIDS005714 PhNH-PhAcNH deriv. R 88977

pdb file: 601361.pdb
sdf file: 601361.sdf
directory: 601361


(+/-)-2,6-Dichloro-.alpha.-[(2-acetyl-5-methylphenyl)amino]benzamide .alpha.-APA 147362-57-0 AIDS-005715 AIDS005715 Loviride PhNH-PhAcNH deriv. R 89439 R89439

pdb file: 601362.pdb
sdf file: 601362.sdf
directory: 601362


(+)-2,6-Dichloro-.alpha.-[(2-acetyl-5-methylphenyl)amino]benzamide .alpha.-APA deriv. AIDS-005716 AIDS005716 PhNH-PhAcNH deriv. R 90384

pdb file: 601363.pdb
sdf file: 601363.sdf
directory: 601363


.alpha.-APA enantiomer 141030-55-9 AIDS-005717 AIDS005717 Benzeneacetamide, .alpha.-[(2-acetyl-5-methylphenyl)amino]-2,6-dichloro-, (-)- PhNH-PhAcNH deriv. R 90385

pdb file: 601364.pdb
sdf file: 601364.sdf
directory: 601364


AIDS-005777 AIDS005777 CD4 84-94 deriv. Tyr-Ile-Cys-Glu-Val-Glu-Asp-Gln-Lys-Glu-Glu (CD4 84-94 derivative) YIC(bzl)EVEDQKEE

pdb file: 601424.pdb
sdf file: 601424.sdf
directory: 601424


AIDS-005779 AIDS005779 CD4 83-91 deriv. TYIC(bzl)EVEDQ Tyr-Ile-Cys-Glu-Val-Glu-Asp-Gln(CD4 83-91 derivative)

pdb file: 601426.pdb
sdf file: 601426.sdf
directory: 601426


AIDS-005810 AIDS005810 TSAO-H deriv. [1,7-Bis-[2',5'-bis-O-(tert-butyldimethylsilyl)-.beta.-D-ribofuranosyl]hypoxanthine]-3'-spiro-5-(4-amino-1,2-oxathiole-2,2-dioxide)

pdb file: 601455.pdb
sdf file: 601455.sdf
directory: 601455


AIDS-005815 AIDS005815 TSAO-A deriv. [9-[2',5'-Bis-O-(tert-butyldimethylsilyl)-.beta.-D-ribofuranosyl]-6-N-methylpurine]-3'-spiro-5-(4-amino-1,2-oxathiole-2,2-dioxide)

pdb file: 601460.pdb
sdf file: 601460.sdf
directory: 601460


AIDS-005817 AIDS005817 TSAO-Pur deriv. [9-[2',5'-Bis-O-(tert-butyldimethylsilyl)-.beta.-D-ribofuranosyl]purine]-3'-spiro-5-(4-amino-1,2-oxathiole-2,2-dioxide)

pdb file: 601462.pdb
sdf file: 601462.sdf
directory: 601462


AIDS-005818 AIDS005818 TSAO-H deriv. [9-[2',5'-Bis-O-(tert-butyldimethylsilyl)-.beta.-D-ribofuranosyl]-N-methylhypoxanthine]-3'-spiro-5-(4-amino-1,2-oxathiole-2,2-dioxide)

pdb file: 601463.pdb
sdf file: 601463.sdf
directory: 601463


AIDS-005819 AIDS005819 TSAO-H deriv. [7-[2',5'-Bis-O-(tert-butyldimethylsilyl)-.beta.-D-ribofuranosyl]-N-methylhypoxanthine]-3'-spiro-5-(4-amino-1,2-oxathiole-2,2-dioxide)

pdb file: 601464.pdb
sdf file: 601464.sdf
directory: 601464


AIDS-005820 AIDS005820 TSAO-H deriv. [7-[2',5'-Bis-O-(tert-butyldimethylsilyl)-.beta.-D-ribofuranosyl]-N-ethylhypoxanthine]-3'-spiro-5-(4-amino-1,2-oxathiole-2,2-dioxide)

pdb file: 601465.pdb
sdf file: 601465.sdf
directory: 601465


150840-31-6 AIDS-005821 AIDS005821 Betulinic acid deriv. RP70034 Undecanoic acid, 11-[[(3.beta.)-3-hydroxy-28-oxolup-20(29)-en-28-yl]amino]-

pdb file: 601466.pdb
sdf file: 601466.sdf
directory: 601466


150840-36-1 AIDS-005822 AIDS005822 Betulinic acid deriv. RP72046 Undecanoic acid, 11-[[(3.beta.)-3,30-dihydroxy-28-oxolup-20(29)-en-28-yl]amino]-

pdb file: 601467.pdb
sdf file: 601467.sdf
directory: 601467


150840-75-8 AIDS-005823 AIDS005823 Betulinic acid deriv. Heptanoic acid, 3-hydroxy-4-[[8-[[(3.beta.)-3-hydroxy-28-oxolup-20(29)-en-28-yl]amino]-1-oxooctyl]amino]-6-methyl-, (3S,4S)- RPR 103611 RPR103611

pdb file: 601468.pdb
sdf file: 601468.sdf
directory: 601468


AIDS-005839 AIDS005839 Inophyllum P Ac deriv. Inophyllum P acetate

pdb file: 601484.pdb
sdf file: 601484.sdf
directory: 601484


3-Tetradecanoyl-4-hydroxy-5-(hydroxymethyl)-2-furanone, sodium salt AIDS-005868 AIDS005868 Tetronic acid, 4OH-3C13H27CO deriv.

pdb file: 601513.pdb
sdf file: 601513.sdf
directory: 601513


3-Pentadecanoyl-4-hydroxy-5-(hydroxymethyl)-2-furanone, sodium salt AIDS-005869 AIDS005869 Tetronic acid, 4OH-3C14H29CO deriv.

pdb file: 601514.pdb
sdf file: 601514.sdf
directory: 601514


3-(13-Methyltetradecanoyl)-4-hydroxy-5-(hydroxymethyl)-2-furanone, sodium salt AIDS-005870 AIDS005870 Tetronic acid, 4OH-iC14H29CO deriv.

pdb file: 601515.pdb
sdf file: 601515.sdf
directory: 601515


3-Hexadecanoyl-4-hydroxy-5-(hydroxymethyl)-2-furanone, sodium salt AIDS-005871 AIDS005871 Tetronic acid, 4OH-3C15H31CO deriv.

pdb file: 601516.pdb
sdf file: 601516.sdf
directory: 601516


3-(14-Methylpentadecanoyl)-4-hydroxy-5-(hydroxymethyl)-2-furanone, sodium salt AIDS-005872 AIDS005872 Tetronic acid, 4OH-3C15H31CO deriv.

pdb file: 601517.pdb
sdf file: 601517.sdf
directory: 601517


3-(14-Methylhexadecanoyl)-4-hydroxy-5-(hydroxymethyl)-2-furanone, sodium salt AIDS-005873 AIDS005873 Tetronic acid, 4OH-3C16H31CO deriv.

pdb file: 601518.pdb
sdf file: 601518.sdf
directory: 601518


5-(3-Hydroxy-1-butenyl)-4-[[4-(hydroxymethyl)phenyl]amino]tetrahydro-2-furanone AIDS-005875 AIDS005875 Tetronic acid deriv.

pdb file: 601520.pdb
sdf file: 601520.sdf
directory: 601520


5-(3-Hydroxy-1-butenyl)-4-[(4-formylphenyl)amino]tetrahydro-2-furanone AIDS-005876 AIDS005876 Tetronic acid deriv.

pdb file: 601521.pdb
sdf file: 601521.sdf
directory: 601521


3-Hydroxy-4-ethyl-2-(2-ethenyl-1-propenyl)-5-oxo-2-thiopheneacetamide AIDS-005877 AIDS005877 Tetronic acid deriv.

pdb file: 601522.pdb
sdf file: 601522.sdf
directory: 601522


3-Acetyl-3,4-dimethyl-5-octanoyloxytetrahydro-2-furanone AIDS-005878 AIDS005878 Desacetyl octanoyl acetamide Tetronic acid deriv.

pdb file: 601523.pdb
sdf file: 601523.sdf
directory: 601523


5-[(2,4-Dibromophenyl)amino]-4-(2-hydroxy-1-propenyl)tetrahydro-2-furanone AIDS-005879 AIDS005879 Dibromo-obscurolide Tetronic acid deriv.

pdb file: 601524.pdb
sdf file: 601524.sdf
directory: 601524


3'-O-Acetyl-4'-O-isopentanoyl-(+)-cis-khellactone 53023-17-9 AIDS-005880 AIDS005880 Pyranocoumarin iBuCOO deriv. Suksdorfin

pdb file: 601525.pdb
sdf file: 601525.sdf
directory: 601525


3',4'-Di-O-(-)-Camphanoyl-(+)-cis-khellactone AIDS-005881 AIDS005881 DCK NSC666863 Pyranocoumarin camphanoyl deriv.

pdb file: 601526.pdb
sdf file: 601526.sdf
directory: 601526


3',4'-Di-O-(-)-Camphanoyl-(-)-cis-khellactone AIDS-005882 AIDS005882 Pyranocoumarin camphanoyl deriv.

pdb file: 601527.pdb
sdf file: 601527.sdf
directory: 601527


3',4'-Di-O-(-)-Camphanoyl-(+)-trans-khellactone AIDS-005883 AIDS005883 Pyranocoumarin camphanoyl deriv.

pdb file: 601528.pdb
sdf file: 601528.sdf
directory: 601528


3',4'-Di-O-(-)-Camphanoyl-(-)-trans-khellactone AIDS-005884 AIDS005884 Pyranocoumarin deriv.

pdb file: 601529.pdb
sdf file: 601529.sdf
directory: 601529


5-Hydroxy-4H-1-benzopyran-4-one AIDS-005907 AIDS005907 Hydroxychromone deriv.

pdb file: 601552.pdb
sdf file: 601552.sdf
directory: 601552


7-Hydroxy-4-oxo-4H-1-benzopyran-2-carboxylic acid AIDS-005908 AIDS005908 Hydroxychromone deriv.

pdb file: 601553.pdb
sdf file: 601553.sdf
directory: 601553


7-Methoxy-4-oxo-4H-1-benzopyran-2-carboxylic acid AIDS-005909 AIDS005909 Hydroxychromone deriv.

pdb file: 601554.pdb
sdf file: 601554.sdf
directory: 601554


8-Methoxy-4-oxo-4H-1-benzopyran-2-carboxylic acid AIDS-005910 AIDS005910 Hydroxychromone deriv.

pdb file: 601555.pdb
sdf file: 601555.sdf
directory: 601555


8-Methoxy-4-oxo-4H-1-benzopyran-2,6-dicarboxylic acid AIDS-005911 AIDS005911 Hydroxychromone deriv.

pdb file: 601556.pdb
sdf file: 601556.sdf
directory: 601556


15826-37-6 (DISODIUM SALT) 16110-51-3 (FREE ACID) 4H-1-Benzopyran-2-carboxylic acid, 5, {5'-[(2-hydroxytrimethylene)dioxy]bis(4-oxo-,} 4H-1-Benzopyran-2-carboxylic acid, {5,5'-[(2-hydroxy-1,3-propanediyl)bis(oxy)]bis[4-oxo-,} 5-(3-((2-Carboxy-4-oxo-4H-chromen-5-yl)oxy)-2-hydroxypropoxy)-4-oxo-4H-chromene-2-carboxylic acid AIDS-005912 AIDS005912 Aarane Aararre Chromoglycate Chromolyn Cromo asma aerosol Cromoglycate Cromolyn Dinatrium cromoglicicum FPL 670 Frenasma Hydroxychromone deriv. Inostral Intal Lomudal Lomudas Lomusol NSC109500 (DISODIUM SALT) Nalcrom Nasmil Nebulasma Rynacrom

pdb file: 601557.pdb
sdf file: 601557.sdf
directory: 601557


4-Hydroxy-2,6-bis(phenylmethyl)-N,N'-bis[2-[(2-quinolinylcarbony)amino]cyclohexyl]heptanediamide, [1-S-[1.alpha.[2S*,6S*,7(1R*,2R*)]2.beta.]] AIDS-005962 AIDS005962 HepdiCO2N, Quin, c-Hex deriv.

pdb file: 601607.pdb
sdf file: 601607.sdf
directory: 601607


4-Hydroxy-2,6-bis(phenylmethyl)-N,N'-bis[2-[(2-pyridinylcarbonyl)amino]cyclohexyl]heptanediamide, [1-S-[1.alpha.[2S*,6S*,7(1R*,2R*)]2.beta.]] AIDS-005963 AIDS005963 HepdiCO2N, Pyrid, c-Hex deriv.

pdb file: 601608.pdb
sdf file: 601608.sdf
directory: 601608


4-Hydroxy-2,6-bis(phenylmethyl)-N,N'-bis[2-[(3-pyridinylcarbonyl)amino]cyclohexyl]heptanediamide, [1-S-[1.alpha.[2S*,6*,7(1R*,2R*)]2.beta.]] AIDS-005964 AIDS005964 HepdiCO2N Pyrid c-Hex deriv.

pdb file: 601609.pdb
sdf file: 601609.sdf
directory: 601609


4-Hydroxy-2,6-bis(phenylmethyl)-N,N'-bis[2-[(4-pyridinylcarbonyl)amino]cyclohexyl]heptanediamide, [1-S-[1.alpha.[2S*,6S*,7(1R*,2R*)]2.beta.]] AIDS-005965 AIDS005965 HepdiCO2N Pyrid c-Hex deriv.

pdb file: 601610.pdb
sdf file: 601610.sdf
directory: 601610


4-Hydroxy-2,6-bis(phenylmethyl)-N,N'-bis[2-[(2-acetylamino)cyclohexyl]heptanediamide, [1-S-[1.alpha.[2S*,6*,7(1R*,2R*)]2.beta.]] AIDS-005966 AIDS005966 HepdiCON, c-Hex deriv.

pdb file: 601611.pdb
sdf file: 601611.sdf
directory: 601611


4-Hydroxy-2,6-bis(phenylmethyl)-N,N'-bis[2-[2-[(1,1-dimethylethoxy)carbonyl]amino]cyclohexyl]heptanediamide, [1-S-[1.alpha.[2S*,6*,7(1R*,2R*)]2.beta.]] AIDS-005967 AIDS005967 HepdiCON, c-Hex deriv.

pdb file: 601612.pdb
sdf file: 601612.sdf
directory: 601612


4-Hydroxy-2,6-bis(phenylmethyl)-N,N'-bis[2-[(3-isoquinolinylcarbonyl)amino]cyclohexyl]heptanediamide, [1-S-[1.alpha.[2S*,6*,7(1R*,2R*)]2.beta.]] AIDS-005968 AIDS005968 HepdiCON, Isoquin c-Hex deriv.

pdb file: 601613.pdb
sdf file: 601613.sdf
directory: 601613


1-[(3,5-Dimethyl-4-methoxyphenyl)methyl]-4-(2-pyridinyl)piperazine AIDS-005969 AIDS005969 Arylpiperazine deriv.

pdb file: 601614.pdb
sdf file: 601614.sdf
directory: 601614


1-(3,5-Dimethyl-4-methoxybenzyl)-4-[3-[(1-methylethyl)amino]-2-pyridyl)piperazine AIDS-005970 AIDS005970 Arylpiperazine deriv.

pdb file: 601615.pdb
sdf file: 601615.sdf
directory: 601615


1-[(3,5-Dimethyl-4-methoxyphenyl)methyl]-4-(3-propylamino-2-pyridinyl)piperazine AIDS-005971 AIDS005971 Arylpiperazine deriv.

pdb file: 601616.pdb
sdf file: 601616.sdf
directory: 601616


1-(3,5-Dimethyl-4-methoxybenzoyl)-4-(3-ethylamino-2-pyridinyl)piperazine AIDS-005972 AIDS005972 Arylpiperazine deriv.

pdb file: 601617.pdb
sdf file: 601617.sdf
directory: 601617


1-(3,5-Dimethyl-4-methoxybenzoyl)-4-[3-[(1-methylethyl)amino]-2-pyridinyl]piperazine AIDS-005973 AIDS005973 Arylpiperazine deriv.

pdb file: 601618.pdb
sdf file: 601618.sdf
directory: 601618


1-(3,5-Dimethyl-4-methoxybenzoyl)-4-[3-(ethylamino)-2-phenyl]piperazine AIDS-005974 AIDS005974 Arylpiperazine deriv.

pdb file: 601619.pdb
sdf file: 601619.sdf
directory: 601619


1-(3,5-Dimethyl-4-methoxybenzoyl)-4-(2-ethoxyphenyl)piperazine AIDS-005975 AIDS005975 Arylpiperazine deriv.

pdb file: 601620.pdb
sdf file: 601620.sdf
directory: 601620


1-(3,5-Dimethyl-4-methoxybenzoyl)-4-(2-pyridinyl)piperazine AIDS-005976 AIDS005976 Arylpiperazine deriv.

pdb file: 601621.pdb
sdf file: 601621.sdf
directory: 601621


1-(5-Methoxy-4,6,7-trimethyl-2-indolyl)-4-[3-(ethylamino)-2-pyridinyl]piperazine AIDS-005977 AIDS005977 BHAP indolyl pyridyl deriv.

pdb file: 601622.pdb
sdf file: 601622.sdf
directory: 601622


1-(Indolyl-5-carbonyl)-4-[3-(ethylamino)-2-pyridyl]piperazine AIDS-005978 AIDS005978 BHAP indolyl pyridyl deriv.

pdb file: 601623.pdb
sdf file: 601623.sdf
directory: 601623


1-(Indolyl-7-carbonyl)-4-[3-(ethylamino)-2-pyridyl]piperazine AIDS-005979 AIDS005979 BHAP indolyl pyridyl deriv.

pdb file: 601624.pdb
sdf file: 601624.sdf
directory: 601624


1-(Pyrryl-2-carbonyl)-4-[3-(ethylamino)-2-pyridyl]piperazine AIDS-005980 AIDS005980 BHAP pyrryl pyridyl deriv.

pdb file: 601625.pdb
sdf file: 601625.sdf
directory: 601625


1-(Thienyl-2-carbonyl)-4-[3-(ethylamino)-2-pyridyl]piperazine AIDS-005981 AIDS005981 BHAP thienyl pyridyl deriv.

pdb file: 601626.pdb
sdf file: 601626.sdf
directory: 601626


1-(Furyl-2-carbonyl)-4-[3-(ethylamino)-2-pyridyl]piperazine AIDS-005982 AIDS005982 BHAP furyl pyridyl deriv.

pdb file: 601627.pdb
sdf file: 601627.sdf
directory: 601627


1-(Benzofuryl-2-carbonyl)-4-[3-(ethylamino)-2-pyridyl]piperazine AIDS-005983 AIDS005983 BHAP benzofuryl pyridyl deriv.

pdb file: 601628.pdb
sdf file: 601628.sdf
directory: 601628


1-(Benzimidazolyl-2-carbonyl)-4-[3-(ethylamino)-2-pyridyl]piperazine AIDS-005984 AIDS005984 BHAP benzimidazolyl pyridyl deriv.

pdb file: 601629.pdb
sdf file: 601629.sdf
directory: 601629


1-(Benzothienyl-2-carbonyl)-4-[3-(ethylamino)-2-pyridyl]piperazine AIDS-005985 AIDS005985 BHAP benzothienyl pyridyl deriv.

pdb file: 601630.pdb
sdf file: 601630.sdf
directory: 601630


1-(Naphthyl-2-carbonyl)-4-[3-(ethylamino)-2-pyridyl]piperazine AIDS-005986 AIDS005986 BHAP naphthyl pyridyl deriv.

pdb file: 601631.pdb
sdf file: 601631.sdf
directory: 601631


1-(Indolyl-2-carbonyl)-4-(2-ethoxyphenyl)piperazine AIDS-005987 AIDS005987 Arylpiperazine indolyl deriv.

pdb file: 601632.pdb
sdf file: 601632.sdf
directory: 601632


1-(Indolyl-2-carbonyl)-4-[2-(ethylamino)phenyl]piperazine AIDS-005988 AIDS005988 Arylpiperazine indolyl deriv.

pdb file: 601633.pdb
sdf file: 601633.sdf
directory: 601633


1-(Indolyl-2-carbonyl)-4-(3-cyano-2-pyridyl)piperazine AIDS-005989 AIDS005989 BHAP indolyl pyridyl deriv.

pdb file: 601634.pdb
sdf file: 601634.sdf
directory: 601634


1-(Indolyl-2-carbonyl)-4-[2-(1-methylethylamino)-4-(trifluoromethyl)phenyl]piperazine AIDS-005990 AIDS005990 Arylpiperazine indolyl deriv.

pdb file: 601635.pdb
sdf file: 601635.sdf
directory: 601635


1-(Indolyl-2-carbonyl)-4-[2-[(1-methylethyl)amino]-4-fluorophenyl]piperazine AIDS-005991 AIDS005991 Arylpiperazine indolyl deriv.

pdb file: 601636.pdb
sdf file: 601636.sdf
directory: 601636


1-(Indolyl-2-carbonyl)-4-[2-[(1-methylethyl)amino]-5-fluorophenyl]piperazine AIDS-005992 AIDS005992 Arylpiperazine indolyl deriv.

pdb file: 601637.pdb
sdf file: 601637.sdf
directory: 601637


1-(Indolyl-2-carbonyl)-4-[3-(methylamino)-2-pyridyl]piperazine AIDS-005993 AIDS005993 BHAP indolyl pyridyl deriv.

pdb file: 601638.pdb
sdf file: 601638.sdf
directory: 601638


1-(Indolyl-2-carbonyl)-4-[3-(propylamino)-2-pyridyl]piperazine AIDS-005994 AIDS005994 BHAP indolyl pyridyl deriv.

pdb file: 601639.pdb
sdf file: 601639.sdf
directory: 601639


1-(Indolyl-2-carbonyl)-4-[3-[(1-ethylpropyl)amino]-2-pyridyl]piperazine AIDS-005995 AIDS005995 BHAP indolyl pyridyl deriv.

pdb file: 601640.pdb
sdf file: 601640.sdf
directory: 601640


1-(Indolyl-2-carbonyl)-4-[3-(N-tert-butylcarbamoyl)-2-pyridyl]piperazine AIDS-005996 AIDS005996 BHAP indolyl pyridyl deriv.

pdb file: 601641.pdb
sdf file: 601641.sdf
directory: 601641


1-(Indolyl-2-carbonyl)-4-(3-acetyl-2-pyridyl)piperazine AIDS-005997 AIDS005997 BHAP indolyl pyridyl deriv.

pdb file: 601642.pdb
sdf file: 601642.sdf
directory: 601642


1-(Indolyl-2-carbonyl)-4-[3-(1-oxopropyl)-2-pyridyl]piperazine AIDS-005998 AIDS005998 BHAP indolyl pyridyl deriv.

pdb file: 601643.pdb
sdf file: 601643.sdf
directory: 601643


1-(Indolyl-2-carbonyl)-4-[(3-(2-methyl-1-oxopropyl)-2-pyridyl]piperazine AIDS-005999 AIDS005999 BHAP indolyl pyridyl deriv.

pdb file: 601644.pdb
sdf file: 601644.sdf
directory: 601644


1-(Indolyl-2-carbonyl)-4-[(3-(2,2-dimethyl-1-oxopropyl)-2-pyridyl]piperazine AIDS-006000 AIDS006000 BHAP indolyl pyridyl deriv.

pdb file: 601645.pdb
sdf file: 601645.sdf
directory: 601645


1-(Indolyl-2-carbonyl)-4-[3-(methoxycarbonyl)-2-pyridyl]piperazine AIDS-006001 AIDS006001 BHAP indolyl pyridyl deriv.

pdb file: 601646.pdb
sdf file: 601646.sdf
directory: 601646


1-(Indolyl-2-carbonyl)-4-[3-(ethoxycarbonyl)-2-pyridyl]piperazine AIDS-006002 AIDS006002 BHAP indolyl pyridyl deriv.

pdb file: 601647.pdb
sdf file: 601647.sdf
directory: 601647


1-(Indolyl-2-carbonyl)-4-[3-[[(1-methyethyl)amino]methyl]-2-pyridyl]piperazine AIDS-006003 AIDS006003 BHAP indolyl pyridyl deriv.

pdb file: 601648.pdb
sdf file: 601648.sdf
directory: 601648


1-[(5-Fluoroindol-2-yl)carbonyl]-4-[3-(ethylamino)-2-pyridyl]piperazine AIDS-006004 AIDS006004 BHAP indolyl pyridyl deriv.

pdb file: 601649.pdb
sdf file: 601649.sdf
directory: 601649


1-[(5-Fluoroindol-2-yl)carbonyl]-4-[3-[(1,1-dimethylethyl)amino]-2-pyridyl]piperazine AIDS-006005 AIDS006005 BHAP indolyl pyridyl deriv.

pdb file: 601650.pdb
sdf file: 601650.sdf
directory: 601650


1-[(5-Methoxyindol-2-yl)carbonyl]-4-[3-[(1,1-dimethylethyl)amino]-2-pyridyl]piperazine AIDS-006006 AIDS006006 BHAP indolyl pyridyl deriv.

pdb file: 601651.pdb
sdf file: 601651.sdf
directory: 601651


1-(2,3,5-Tri-O-benzoyl-.beta.D-ribofuranosyl)-2-mercapto-5,6-dichlorobenzimidazole AIDS-006013 AIDS006013 BzInd Nucl, deriv.

pdb file: 601658.pdb
sdf file: 601658.sdf
directory: 601658


AIDS-006014 AIDS006014 BzInd furan deriv. S 2-(2,3,5-Tri-O-benzoyl-.beta.D-ribofuranosyl)-2-mercapto-5,6-dichlorobenzimidazole

pdb file: 601659.pdb
sdf file: 601659.sdf
directory: 601659


1,3-Bis(.beta.-D-ribofuranosyl)-2-thio-5,6-dichlorobenzimidazole AIDS-006016 AIDS006016 BzInd Nucl, deriv.

pdb file: 601661.pdb
sdf