
|
DNA ester Molecules Structural Archive and Gallery

151-32-6 Adimoll DN Adipic acid, dinonyl ester Bisoflex DNA Di-n-nonyl adipate Dinonyl adipate Hexanedioic acid, dinonyl ester NSC11041 Plastomoll Na
pdb file: 76093.pdb sdf file: 76093.sdf directory: 76093

151-32-6 Adimoll DN Adipic acid, dinonyl ester Adipic acid, dinonyl ester (8CI) Bisoflex DNA Bisoflex dinonyl adipate DI-N-NONYL ADIPATE Dinonyl adipate EINECS 205-789-7 HSDB 5653 Hexanedioic acid, dinonyl ester NSC 11041 Plastomoll Na
pdb file: 152211.pdb sdf file: 152211.sdf directory: 152211

1-Amino-2-methoxy-4-oxyanthraquinone [Russian] 1-Amino-4-hydroxy-2-methoxy-9,10-anthracenedione 1-Amino-4-hydroxy-2-methoxyanthraquinone 11116-41-9 1A-2MO-4OA [Russian] 2379-90-0 9,10-Anthracenedione, 1-amino-4-hydroxy-2-methoxy- ANTHRAQUINONE, 1-AMINO-4-HYDROXY-2-METHOXY- Acetoquinone Light Pink RLZ Artisil Brilliant Pink RFS BRN 2420171 C.I. 60755 C.I. Disperse Red 4 Celliton Fast Pink RF Celliton Fast Pink RFA-CF Cerven disperzni 4 [Czech] Cilla Fast Pink RF Dianix Fast Pink R Disperse Pink Zh Disperse Rose Zh Disperse red-4 EINECS 219-170-4 Esteroquinone Light Pink RLL Fenacet Fast Pink RF Interchem Acetate Fast Pink DNA Miketon Fast Pink RL Miketon Polyester Pink RL NSC 81265 Nyloquinone Pink B Palanil Pink RF Periliton Brilliant Pink R Perliton Brilliant Pink R Samaron Pink RFL Supracet
pdb file: 160141.pdb sdf file: 160141.sdf directory: 160141

1-Amino-2-methoxy-4-oxyanthraquinone 1-Amino-4-hydroxy-2-methoxy-9,10-anthracenedione 1-Amino-4-hydroxy-2-methoxyanthraquinone 1a-2Mo-4oa 2379-90-0 9,10-Anthracenedione, 1-amino-4-hydroxy-2-methoxy- Acetoquinone Light Pink RLZ Anthraquinone, 1-amino-4-hydroxy-2-methoxy- Artisil Brilliant Pink RFS C.I. 60755 C.I. Disperse Red 4 Celliton Fast Pink RF Celliton Fast Pink RFA-CF Cilla Fast Pink RF Dianix Fast Pink R Disperse Pink Zh Disperse Red-4 Disperse Rose Zh Esteroquinone Light Pink RLL Fenacet Fast Pink RF Interchem Acetate Fast Pink DNA Miketon Fast Pink RL Miketon Polyester Pink RL NSC81265 Nyloquinone Pink B Palanil Pink RF Perliton Brilliant Pink R Samaron Pink RFL Supracet Fast Pink 2R WLN: L C666 BV IVJ DZ EO1 GQ
pdb file: 551608.pdb sdf file: 551608.sdf directory: 551608

136088-27-2 AIDS-003064 AIDS003064 Cholestane, deoxyribonucleic acid deriv. Cholesteryl oligonucleotide Cholesteryl oligonucleotide(pTGGCGTACTCACCAGTCGCCGC) DNA, d(T-G-G-C-G-T-A-C-T-C-A-C-C-A-G-T-C-G-C-C-G-C), 5'-[(3.bETA.)-cholest-5-en-3-yl hydrogen phosphate]
pdb file: 597523.pdb sdf file: 597523.sdf directory: 597523

2'-Deoxy NAD 2'-Deoxyadenosine 5'-(trihydrogen diphosphate), 5'-5'-ester with 3-(aminocarbonyl)-1-beta- D-ribofuranosylpyridinium hydroxide, inner salt 2'-Deoxynicotinamide adenine dinucleotide 2'-Dnad 6697-37-6
pdb file: 766501.pdb sdf file: 766501.sdf directory: 766501

113849-17-5 9-(4-Chlorophenyl) 7,7-dimethyl-5,8-nonadienoic acid methyl ester Cdname
pdb file: 772334.pdb sdf file: 772334.sdf directory: 772334
|