nucleotide Molecules Structural Archive and Gallery

53-84-9 C00003 DPN Diphosphopyridine nucleotide NAD NAD+ Nadide Nicotinamide adenine dinucleotide

53-59-8 C00006 NADP NADP+ Nicotinamide adenine dinucleotide phosphate TPN Triphosphopyridine nucleotide beta-Nicotinamide adenine dinucleotide phosphate
pdb file: 3255.pdb
sdf file: 3255.sdf
directory: 3255

146-14-5 C00016 FAD Flavin adenine dinucleotide
pdb file: 3265.pdb
sdf file: 3265.sdf
directory: 3265

(Deoxyribonucleotide)m (Deoxyribonucleotide)n (Deoxyribonucleotide)n+m 9007-49-2 C00039 DNA DNAn DNAn+1 Deoxyribonucleic acid
pdb file: 3288.pdb
sdf file: 3288.sdf
directory: 3288

(Ribonucleotide)m (Ribonucleotide)n (Ribonucleotide)n+m C00046 RNA RNA(linear) RNAn RNAn+1 Ribonucleic acid
pdb file: 3295.pdb
sdf file: 3295.sdf
directory: 3295

146-17-8 C00061 FMN Flavin mononucleotide Riboflavin-5-phosphate
pdb file: 3308.pdb
sdf file: 3308.sdf
directory: 3308

3'-Phosphomononucleotide C00142
pdb file: 3389.pdb
sdf file: 3389.sdf
directory: 3389

5'-Phosphomononucleotide C00171
pdb file: 3418.pdb
sdf file: 3418.sdf
directory: 3418

3'-Phosphooligonucleotide C00172
pdb file: 3419.pdb
sdf file: 3419.sdf
directory: 3419

5'-Phosphooligonucleotide C00351
pdb file: 3589.pdb
sdf file: 3589.sdf
directory: 3589

C00419 Polynucleotide
pdb file: 3654.pdb
sdf file: 3654.sdf
directory: 3654

5'-Phosphooligoribonucleotide C00444
pdb file: 3676.pdb
sdf file: 3676.sdf
directory: 3676

1094-61-7 C00455 NMN Nicotinamide D-ribonucleotide Nicotinamide mononucleotide Nicotinamide nucleotide Nicotinamide ribonucleotide beta-Nicotinamide D-ribonucleotide beta-Nicotinamide mononucleotide beta-Nicotinamide ribonucleotide
pdb file: 3685.pdb
sdf file: 3685.sdf
directory: 3685

C00608 Deoxyribonucleotide
pdb file: 3824.pdb
sdf file: 3824.sdf
directory: 3824

C00929 Oligonucleotide
pdb file: 4119.pdb
sdf file: 4119.sdf
directory: 4119

5'-Phosphomononucleotides C01150
pdb file: 4314.pdb
sdf file: 4314.sdf
directory: 4314

C01185 Nicotinate D-ribonucleotide Nicotinate ribonucleotide Nicotinic acid ribonucleotide beta-Nicotinate D-ribonucleotide
pdb file: 4344.pdb
sdf file: 4344.sdf
directory: 4344

3'-Hydroxyoligoribonucleotide C01196
pdb file: 4353.pdb
sdf file: 4353.sdf
directory: 4353

5'-Hydroxyoligoribonucleotide C01199
pdb file: 4356.pdb
sdf file: 4356.sdf
directory: 4356

2',3'-Cyclic nucleotide C01240 Nucleoside 2',3'-cyclic phosphate
pdb file: 4392.pdb
sdf file: 4392.sdf
directory: 4392

C01910 Dinucleotide
pdb file: 4936.pdb
sdf file: 4936.sdf
directory: 4936

5'-Nucleotide C01992
pdb file: 5004.pdb
sdf file: 5004.sdf
directory: 5004

C02171 Mononucleotide
pdb file: 5158.pdb
sdf file: 5158.sdf
directory: 5158

3'-Ribonucleotide C02508
pdb file: 5424.pdb
sdf file: 5424.sdf
directory: 5424

5'-Ribonucleotide C02520
pdb file: 5434.pdb
sdf file: 5434.sdf
directory: 5434

3'-Extranucleotides C02789
pdb file: 5637.pdb
sdf file: 5637.sdf
directory: 5637

C02867 Oligoribonucleotide
pdb file: 5699.pdb
sdf file: 5699.sdf
directory: 5699

5'-Phosphodinucleotide C03236
pdb file: 5996.pdb
sdf file: 5996.sdf
directory: 5996

C03312 Urate D-ribonucleotide
pdb file: 6052.pdb
sdf file: 6052.sdf
directory: 6052

3'-Phosphopolynucleotide C03463
pdb file: 6165.pdb
sdf file: 6165.sdf
directory: 6165

5'-Phosphopolynucleotide C03475
pdb file: 6172.pdb
sdf file: 6172.sdf
directory: 6172

C03536 Pyrimidine 5'-nucleotide
pdb file: 6219.pdb
sdf file: 6219.sdf
directory: 6219

3'-Phosphomononucleotides C03581
pdb file: 6250.pdb
sdf file: 6250.sdf
directory: 6250

C03730 Single-stranded nucleotide
pdb file: 6366.pdb
sdf file: 6366.sdf
directory: 6366

5'-Phosphoribosylglycinamide C03838 GAR Glycinamide ribonucleotide N1-(5-Phospho-D-ribosyl)glycinamide
pdb file: 6446.pdb
sdf file: 6446.sdf
directory: 6446

3'-Phosphooligoribonucleotide C03924
pdb file: 6516.pdb
sdf file: 6516.sdf
directory: 6516

3'-Hydroxyloligoribonucleotide C03983
pdb file: 6560.pdb
sdf file: 6560.sdf
directory: 6560

5'-Phospho-RNA 3'-mononucleotide C04117
pdb file: 6660.pdb
sdf file: 6660.sdf
directory: 6660

3',5'-Cyclic nucleotide C04212 Nucleoside 3',5'-cyclic phosphate
pdb file: 6731.pdb
sdf file: 6731.sdf
directory: 6731

5'-Dephospho-RNA 3'-mononucleotide C04239
pdb file: 6752.pdb
sdf file: 6752.sdf
directory: 6752

5'-Phosphomonoester oligonucleotides C04328
pdb file: 6822.pdb
sdf file: 6822.sdf
directory: 6822

3'-Hydroxy-terminated oligonucleotide C04365
pdb file: 6850.pdb
sdf file: 6850.sdf
directory: 6850

5'-Phosphoribosyl-N-formylglycinamide C04376 N-Formyl-GAR N-Formylglycinamide ribonucleotide N2-Formyl-N1-(5-phospho-D-ribosyl)glycinamide
pdb file: 6858.pdb
sdf file: 6858.sdf
directory: 6858

2',3'-Cyclic phosphooligoribonucleotide 2',3'-Cyclicphosphooligoribonucleotide C04408
pdb file: 6881.pdb
sdf file: 6881.sdf
directory: 6881

C04423 Nicotinamide hypoxanthine dinucleotide
pdb file: 6892.pdb
sdf file: 6892.sdf
directory: 6892

2,4-Dioxotetrahydropyrimidine D-ribonucleotide C04639
pdb file: 7059.pdb
sdf file: 7059.sdf
directory: 7059

7-Methylguanosine 5'-triphospho-5'-polynucleotide C04696
pdb file: 7105.pdb
sdf file: 7105.sdf
directory: 7105

(6S)-6-beta-Hydroxy-1,4,5,6-tetrahydronicotinamide-adeninedinucleotide C04856
pdb file: 7236.pdb
sdf file: 7236.sdf
directory: 7236

(6S)-6-beta-Hydroxy-1,4,5,6-tetrahydronicotinamide-adeninedinucleotide 2'-phosphate C04899
pdb file: 7270.pdb
sdf file: 7270.sdf
directory: 7270

C08249 Pyrimidine 5'-deoxynucleotide
pdb file: 9754.pdb
sdf file: 9754.sdf
directory: 9754

5'-AMP 5'-Adenylic acid 61-19-8 9H-Purine, 6-amino-9-.beta.-D-ribofuranosyl-, 5'-phosphate A 5MP ADENYLIC ACID, YEAST AMP AMP (nucleotide) Adenosine 5'-(dihydrogen phosphate) Adenosine 5'-monophosphate Adenosine 5'-monophosphoric acid Adenosine 5'-phosphate Adenosine 5'-phosphoric acid Adenosine Phosphate Adenosine monophosphate Adenosine, mono(dihydrogen phosphate) (ester) Adenovite Adenylic acid Cardiomone Lycedan Muscle adenylic acid My-B-Den NSC20264 Phosaden Phosphentaside
pdb file: 82892.pdb
sdf file: 82892.sdf
directory: 82892

1H-Imidazole-4-carboxamide, 5-amino-1-(5-O-phosphono-.beta.-D-ribofuranosyl)- 3031-94-5 5-Amino-4-imidazole carboxamide ribonucleotide 5-Amino-4-imidazolecarboxamide ribonucleoside 5'-monophosphate 5-Amino-4-imidazolecarboxamide ribotide AICAR Imidazole-4-carboxamide, 5-amino-1-.beta.-D-ribofuranosyl-, 5'-(dihydrogen phosphate) NSC283955
pdb file: 143918.pdb
sdf file: 143918.sdf
directory: 143918

1H-Imidazole-4-carboxamide, 5-amino-1-(5-O-phosphono-.beta.-D-ribofuranosyl)- 3031-94-5 5-Amino-4-imidazole carboxamide ribonucleotide 5-Amino-4-imidazolecarboxamide ribonucleoside 5'-monophosphate 5-Amino-4-imidazolecarboxamide ribotide AICAR Imidazole-4-carboxamide, 5-amino-1-.beta.-D-ribofuranosyl-, 5'-(dihydrogen phosphate) NSC292227
pdb file: 145663.pdb
sdf file: 145663.sdf
directory: 145663

22046-90-8 3545-01-5 53-57-6 Adenosine 5'-(trihydrogen diphosphate), 2'-(dihydrogen phosphate), P'-5'-ester with 1,4-dihydro-1-beta-D-ribofuranosyl-3-pyridinecarboxamide Dihydronicotinamide-adenine dinucleotide phosphate EINECS 200-177-6 NADPH Nicotinamide adenine dinucleotide phosphate
pdb file: 148687.pdb
sdf file: 148687.sdf
directory: 148687

159929-29-0 3-Carbamoyl-1-beta-D-ribofuranosylpyridinium hydroxide, 5'-ester with adenosine 5'-pyrophosphate, inner salt 30429-30-2 5-26-16-00399 (Beilstein Handbook Reference) 53-84-9 Adenine-nicotinamide dinucleotide Adenosine 5'-(trihydrogen diphosphate), P'-5'-ester with 3-(aminocarbonyl)-1-beta-D-ribofuranosylpyridinium hydroxide, inner salt Adenosine 5'-(trihydrogen diphosphate), P'-5'-ester with 3-(aminocarbonyl)-1-beta-D-ribofuranosylpyridinium, inner salt BRN 3584133 CO-1 Codehydrase I Codehydrogenase I Coenzyme I Cozymase I DPN Diphosphopyridine nucleotide EINECS 200-184-4 Enzopride NAD+ NADIDE NSC 20272 Nad Nadida [INN-Spanish] Nadide [USAN:BAN:INN:JAN] Nadidum [INN-Latin] Nicotinamide adenine dinucleotide Nicotinamide dinucleotide Nicotinamide-adenine dinucleotide Nicotineamide adenine dinucleotide Oxidized diphosphopyridine nucleotide Pyridine, nucleotide diphosphate Pyridinium, 3-carbamoyl-1-beta-D-ribofuranosyl-, hydroxide, 5'-ester with adenosine 5'-5'-(trihydrogen pyrophosphate), inner salt beta-Diphosphopyridine nucleotide beta-NAD beta-NAD+ beta-Nicotinamide adenine dinucleotide
pdb file: 148694.pdb
sdf file: 148694.sdf
directory: 148694

10168-83-9 16488-07-6 5'-Atp 51569-41-6 56-65-5 71800-44-7 84412-18-0 9-beta-D-Arabinofuranosyladenine 5'-triphosphate ADENOSINE-5'-PHOSPHATE ATP ATP (nucleotide) Adenosine 5'-(tetrahydrogen triphosphate) Adenosine 5'-triphosphate Adenosine 5'-triphosphoric acid Adenosine triphosphate Adenosine, 5'-(tetrahydrogen triphosphate) Adenosintriphosphorsaeure Adenylpyrophosphoric acid Adephos Adetol Ado-5'-P-P-P Adynol Ara-ATP Atipi Atriphos EINECS 200-283-2 Glucobasin Myotriphos Striadyne Triadenyl Triphosaden Triphosphaden Triphosphoric acid adenosine ester
pdb file: 148785.pdb
sdf file: 148785.sdf
directory: 148785

4-26-00-03629 (Beilstein Handbook Reference) 5'-Adenylphosphoric acid 5'-Adp 58-64-0 84412-16-8 ADENOSINE, 5'-(TRIHYDROGEN PYROPHOSPHATE) ADP ADP (nucleotide) Adenosindiphosphorsaeure Adenosine 5'-(trihydrogen diphosphate) Adenosine 5'-diphosphate Adenosine 5'-diphosphoric acid Adenosine 5'-pyrophosphate Adenosine 5'-pyrophosphoric acid Adenosine diphosphate Adenosine diphosphoric acid Adenosine pyrophosphate Adenosine-5'-diphosphat Adenosine-5'-diphosphate Ado-5'-P-P BRN 0067722 EINECS 200-392-5
pdb file: 148877.pdb
sdf file: 148877.sdf
directory: 148877

162756-82-3 4-26-00-03615 (Beilstein Handbook Reference) 47286-65-7 47287-97-8 5'-AMP 5'-Adenylic acid 53624-78-5 61-19-8 67583-85-1 A5MP ADENOSINE 5'-PHOSPHATE AMP AMP (VAN) AMP (nucleotide) Adenosine 5'-(dihydrogen phosphate) Adenosine 5'-monophosphate Adenosine 5'-monophosphoric acid Adenosine 5'-phosphoric acid Adenosine monophosphate Adenosine phosphate Adenosine phosphate [USAN:BAN:INN] Adenosine, mono(dihydrogen phosphate) (ester) Adenosine-5-monophosphoric acid Adenosini phosphas [INN-Latin] Adenovite Adenylic acid Adenylic acid (VAN) BRN 0054612 Cardiomone EINECS 200-500-0 Ergadenylic acid Fosfato de adenosina [INN-Spanish] HSDB 3281 Lycedan Monophosphadenine Muscle adenylic acid Muskeladenosin-phosphorsaeure Muskeladenylsaeure My-B-Den Myoston NSC 20264 NSC-20264 Phosaden Phosphaden Phosphate d'adenosine [INN-French] Phosphentaside Vitamin B8
pdb file: 148970.pdb
sdf file: 148970.sdf
directory: 148970

162756-87-8 1beta-Ribofuranosylcytosine 5'-phosphate, d- 293738-08-6 4-25-00-03673 (Beilstein Handbook Reference) 5'-CMP 5'-CYTIDYLIC ACID 55679-92-0 63-37-6 BRN 0046982 CMP (nucleotide) Cytidine 3'-(dihydrogen phosphate) Cytidine 5'-(dihydrogenphosphate) Cytidine 5'-monophosphate Cytidine 5'-monophosphoric acid Cytidine 5'-phosphate Cytidine 5'-phosphoric acid Cytidine monophosphate Cytidylic acid EINECS 200-556-6
pdb file: 149026.pdb
sdf file: 149026.sdf
directory: 149026

146-14-5 16426-55-4 1H-Purin-6-amine, flavin dinucleotide 1H-Purin-6-amine, flavine dinucleotide 4-26-00-03632 (Beilstein Handbook Reference) ADENOSINE 5'-(TRIHYDROGEN PYROPHOSPHATE), 5'-5'-ESTER with RIBOFLAVINE Adenine-flavin dinucleotide Adenine-flavine dinucleotide Adenine-riboflavin dinuceotide Adenine-riboflavin dinucleotide Adenine-riboflavine dinucleotide BRN 0078150 EINECS 205-663-1 FAD Flamitajin B Flanin F Flavin adenin dinucleotide Flavin adenin dinucleotide [JAN] Flavin adenine dinucleotide Flavin-adenine dinucleotide Flavinat Flavine adenosine diphosphate Flavine-adenine dinucleotide Flavitan Flaziren (free acid) Isoalloxazine-adenine dinucleotide NSC 112207 Riboflavin 5'-(trihydrogen diphosphate), 5'-5'-ester with adenosine Riboflavin 5'-(trihydrogen diphosphate), P'-5'-ester with adenosine Riboflavin 5'-adenosine diphosphate Riboflavin-adenine dinucleotide Riboflavine-adenine dinucleotide
pdb file: 152122.pdb
sdf file: 152122.sdf
directory: 152122

130-40-5 146-17-8 22251-85-0 4-26-00-02554 (Beilstein Handbook Reference) 6184-17-4 BRN 0068086 EINECS 205-664-7 FMN Flanin Flavin mononucleotide Flavine mononucleotide Flavol RIBOFLAVIN PHOSPHATE Riboflavin 5'-(dihydrogen phosphate) Riboflavin 5'-monophosphate Riboflavin 5'-phosphate Riboflavin mononucleotide Riboflavin monophosphate Riboflavin, 5'-(dihydrogenphosphate)- Riboflavine 5'-(dihydrogen phosphate) Riboflavine 5'-monophosphate Riboflavine 5'-phosphate Riboflavine dihydrogen phosphate Riboflavine monophosphate Riboflavine phosphate Vitamin B2 phosphate
pdb file: 152123.pdb
sdf file: 152123.sdf
directory: 152123

2'-Deoxythymidine 5'-monophosphate 365-07-1 5'-TMP 5'-Thymidylic acid 5'-dTMP 5-Methyl-dUMP Deoxy TMP Deoxyribosylthymine monophosphate Deoxythymidine 5'-monophosphate Deoxythymidine 5'-phosphate Deoxythymidine monophosphate Deoxythymydilic acid NSC 46713 THYMIDYLIC ACID TMP (VAN) TMP (nucleotide) Thymidine 5'-monophosphate Thymidine 5'-phosphate Thymidine 5'-phosphoric acid Thymidine mononucleotide Thymidine monophosphate Thymidine phosphate Thymidine, mono(dihydrogen phosphate) (ester) Thymidine-5'-monophosphoric acid dTMP
pdb file: 152914.pdb
sdf file: 152914.sdf
directory: 152914

1094-61-7 3-(Aminocarbonyl)-1-(5-O-phosphonato-beta-D-ribofuranosyl)pyridinium EINECS 214-136-5 NICOTINAMIDE MONONUCLEOTIDE NMN Pyridinium, 3-(aminocarbonyl)-1-(5-O-phosphono-beta-D-ribofuranosyl)-, inner salt
pdb file: 157468.pdb
sdf file: 157468.sdf
directory: 157468

10418-12-9 20762-30-5 21090-17-5 2140-57-0 26635-72-3 27576-48-3 28115-73-3 29352-45-2 5-(Adenosine 5'-pyrophosphoryl)-D-ribose 86-06-6 ADENOSINE DIPHOSPHATE RIBOSE ADP Ribose ADPR (nucleotide) Adenosine 5'-(trihydrogen diphosphate), P'-5-ester with D-ribose Adenosine 5'-(trihydrogen pyrophosphate), 5'-5-ester with D-ribofuranose Adenosine 5'-diphosphate, D-ribose ester Adenosine 5'-diphosphoribose Adenosine 5'-pyrophosphate, 5'-5-ester with D-ribofuranose Adenosine diphosphoribose Adenosine pyrophosphate-ribose Ribofuranose, 5-5'-ester with adenosine 5'-(trihydrogen pyrophosphate), D- Ribose adenosinediphosphate
pdb file: 172419.pdb
sdf file: 172419.sdf
directory: 172419

103106-41-8 103106-44-1 104714-92-3 104714-93-4 24937-83-5 5'-Adenylic acid, homopolymer 67583-86-2 75433-15-7 75433-16-8 75433-18-0 75433-21-5 75433-22-6 75433-24-8 75433-26-0 75433-27-1 Adenine polynucleotides POLY A Polyadenylic acid Polyadenylic acids
pdb file: 174663.pdb
sdf file: 174663.sdf
directory: 174663

25191-14-4 5'-Guanylic acid, homopolymer Guanine polynucleotides POLY G Polyguanylic acids
pdb file: 174769.pdb
sdf file: 174769.sdf
directory: 174769

26182-58-1 26966-61-0 39288-01-2 39466-04-1 5'-Adenylic acid, thymidylyl-(5'-3')-2'-deoxy-, homopolymer 90385-82-3 9054-18-6 POLY DA-DT Poly(deoxyadenylate-thymidylate) Polydeoxyadenine nucleotides-polythymine nucleotides
pdb file: 175501.pdb
sdf file: 175501.sdf
directory: 175501

25618-56-8 27416-86-0 5'-Uridylic acid, homopolymer 81795-93-9 POLY U Polyuridylic acid Polyuridylic acids Uracil polynucleotides
pdb file: 175642.pdb
sdf file: 175642.sdf
directory: 175642

30811-80-4 5'-Cytidylic acid, homopolymer (9CI) 5'-Cytidylic acid, polymers (8CI) NSC 120953 POLY C Poly(cytidylic acid) Poly(rC) Polyribocytidylic acid Polyribonucleotide complex C
pdb file: 177161.pdb
sdf file: 177161.sdf
directory: 177161

25249-22-3 30918-54-8 5'-Inosinic acid polymers 5'-Inosinic acid, homopolymer (9CI) 5'-Inosinic acid, polymers (8CI) Inosine polynucleotides NSC 120952 Oligoinosinic acid POLY I Poly(rI) PolyI Polyinosine Polyinosinic acid Polyinosinic acids Polyriboinosinic acid
pdb file: 177307.pdb
sdf file: 177307.sdf
directory: 177307

2'-Deoxythymidine triphosphate 27821-54-1 365-08-2 5'-TTP Deoxy-TTP Deoxythymidine 5'-triphosphate Deoxythymidine triphosphate EINECS 206-669-7 TTP TTP (nucleotide) Thymidine 5'-(tetrahydrogen triphosphate) Thymidine 5'-triphosphate dTTP
pdb file: 206907.pdb
sdf file: 206907.sdf
directory: 206907

1H-Imidazole-4-carboxamide, 5-amino-1-(5-O-phosphono-beta-D-ribofuranosyl)- (9CI) 3031-94-5 5-Amino-1-(5-O-phosphono-beta-D-ribofuranosyl)-1H-imidazole-4-carboxamide 5-Amino-4-imidazole carboxamide ribonucleotide 5-Amino-4-imidazolecarboxamide ribonucleoside 5'-monophosphate 5-Amino-4-imidazolecarboxamide ribotide AICA ribonucleotide AICAR EINECS 221-212-1 Imidazole-4-carboxamide, 5-amino-1-beta-D-ribofuranosyl-, 5'-(dihydrogen phosphate) (8CI) NSC 283955 NSC 292227
pdb file: 207070.pdb
sdf file: 207070.sdf
directory: 207070

83285-83-0 Adenosine 5'-(trihydrogen diphosphate), 5'-5'-ester with 2-beta-D-ribofuranosyl-4-thiazolecarboxamide NSC 358285 TCAD Thiazole-4-carboxamide adenine dinucleotide Tiazofurin adenine dinucleotide
pdb file: 215923.pdb
sdf file: 215923.sdf
directory: 215923

146-14-5 1H-Purin-6-amine, flavin dinucleotide 1H-Purin-6-amine, flavine dinucleotide Adenine-flavin dinucleotide Adenine-flavine dinucleotide Adenine-riboflavin dinuceotide Adenine-riboflavin dinucleotide Adenine-riboflavine dinucleotide Adenosine 5'-(trihydrogen pyrophosphate), 5'.fwdarw.5'-ester with riboflavine FAD Flamitajin B Flanin F Flavin adenine dinucleotide Flavin-adenine dinucleotide Flavine adenosine diphosphate Flavine-adenine dinucleotide Flavitan Flaziren (free acid) Isoalloxazine-adenine dinucleotide NSC112207 Riboflavin 5'-(trihydrogen diphosphate), 5'.fwdarw.5'-ester with adenosine Riboflavin 5'-adenosine diphosphate Riboflavin-adenine dinucleotide Riboflavine 5'-(trihydrogen diphosphate), 5'.fwdarw.5'-ester with adenosine Riboflavine-adenine dinucleotide
pdb file: 409914.pdb
sdf file: 409914.sdf
directory: 409914

5'-Inosinic acid, 6-thio- 53-83-8 6-Mercaptopurine ribonucleotide 6-Mercaptopurine riboside 5'-monophosphate 6-Mercaptopurine riboside 5'-phosphate 6-Mercaptopurine riboside-5-phosphate 6-Mercaptopurine ribotide 6-Thio-IMP 6-Thioinosine 5'-monophosphate 6-Thioinosine 5'-phosphate 9H-Purine-6-thiol, 9-.beta.-D-ribofuranosyl-, 5'-(dihydrogen phosphate) NSC520722 Thio-IMP Thioinosinic acid
pdb file: 480856.pdb
sdf file: 480856.sdf
directory: 480856

5'-Cytidylic acid, disodium salt 6757-06-8 CYTIDYLIC ACID Cytidine 5'MP, disodium salt Cytidine-5'-monophosphate disodium salt Disodium 5'-ribonucleotide NSC20259
pdb file: 541738.pdb
sdf file: 541738.sdf
directory: 541738

(Pyridine-3-aldehyde)AD 3-Formylpyridine-adenine dinucleotide 3-Pyridine aldehyde-DPN 3-Pyridinealdehyde adenine dinucleotide 3-Pyridinealdehyde-NAD 86-07-7 Adenine-nicotinaldehyde dinucleotide Adenosine 5'-(trihydrogen diphosphate), 5'.fwdarw.5'-ester with 3-formyl-1-.beta.-D-ribofuranosylpyridinium hydroxide, inner salt Diphosphopyridine nucleotide, 3-pyridinecarboxaldehyde analog Diphosphopyridine nucleotide, nicotinaldehyde analog NSC20270 Nicotinaldehyde-adenine dinucleotide Pyridine 3-aldehyde NAD Pyridine-3-aldehyde diphosphopyridine nucleotide Pyridine-3-aldehyde-adenine dinucleotide Pyridinecarbaldehyde adenine dinucleotide Pyridinium, 3-formyl-1-.beta.-D-ribofuranosyl-, hydroxide, 5'.fwdarw.5'-ester with adenosine 5'-(trihydrogen pyrophosphate), inner salt
pdb file: 541747.pdb
sdf file: 541747.sdf
directory: 541747

1851-07-6 Codehydrogenase I, deamino hydroxy analog Deamino DPN Deamino nicotinamide adenine dinucleotide Deamino-NAD Deaminocozymase Deaminodiphosphopyridine nucleotide Desamino-DPN Hypoxanthine-nicotinamide dinucleotide Inosine 5'-(trihydrogen diphosphate), 5'.fwdarw.5'-ester with 3-(aminocarbonyl)-1-.beta.-D-ribofuranosylpyridinium hydroxide, inner salt NHD NSC20271 Nicotinamide-adenine dinucleotide, desamino- Nicotinamide-hypoxanthine dinucleotide Pyridinium, 3-carbamoyl-1-.beta.-D-ribofuranosyl-, hydroxide, 5'.fwdarw.5'-ester with inosine 5'-(trihydrogen pyrophosphate), inner salt
pdb file: 541748.pdb
sdf file: 541748.sdf
directory: 541748

.beta.-NAD 3-Carbamoyl-1.beta.-D-ribofuranosylpyridinium hydroxide, 5'-ester with adenosine 5'-pyrophosphate, inner salt 53-84-9 Adenine-nicotinamide dinucleotide Adenosine 5'-(trihydrogen diphosphate), 5'.fwdarw.5'-ester with 3-(aminocarbonyl)-1-.beta.-D-ribofuranosylpyridinium hydroxide, inner salt Adenosine 5'-(trihydrogen diphosphate), 5'.fwdarw.5'-ester with 3-(aminocarbonyl)-1.beta.-D-ribofuranosylpyridinium, hydroxide, inner salt CO-1 CO-I COZYMASE Codehydrase I Codehydrogenase I Coenzyme I Cozymase I DPN Diphosphopyridine nucleotide Endopride Enzopride NAD NAD+ NSC20272 Nadide Nicotinamide adenine dinucleotide Nicotinamide-adenine dinucleotide Oxidized diphosphopyridine nucleotide Pyridine, nucleotide diphosphate Pyridinium, 3-carbamoyl-1-.beta.-D-ribofuranosyl-, hydroxide, 5'.fwdarw.5'-ester with adenosine 5'-(trihydrogen pyrophosphate), inner salt
pdb file: 541749.pdb
sdf file: 541749.sdf
directory: 541749

(3-Acetylpyridine)AD .beta.-DPN acetylpyridine analog 3-Acetyl NAD 3-Acetylpyridine NAD 3-Acetylpyridine adenine dinucleotide 3-Acetylpyridine analog ofDPN 3-Acetylpyridine diphosphopyridine nucleotide 3-Acetylpyridine-DPN 3-Acetylpyridine-adenine dinucleotide 3-Acetylpyridineadenine dinucleotide 86-08-8 AcPyAD Acetyl-3-pyridine adenine dinucleotide Acetylpyridine adenine dinucleotide Acetylpyridine-adenine dinucleotide Adenosine 5'-(trihydrogen diphosphate), 5'.fwdarw.5'-ester with 3-acetyl-1-.beta.-D-ribofuranosylpyridinium hydroxide, inner salt DPN 3-Acetylpyridine analog DPN, analogueol, 3-acetyl pyridine derivative Diphosphopyridine nucleotide, 1-(3-pyridinyl)ethanone analog Diphosphopyridine nucleotide, 3-acetylpyridine analog NSC20275 Nicotinamide acetylpyridine dinucleotide Nicotinamide-adenine dinucleotide, 3-acetyl analog Nicotinamide-hypoxanthine dinucleotide, 3-acetyl analog Pyridine, 3-acetyl-, derivative of DPN analogue Pyridinium, 3-acetyl-1-.beta.-D-ribofuranosyl-, hydroxide, 5'.fwdarw.5'-ester with adenosine 5'-(trihydrogen pyrophosphate), inner salt
pdb file: 541751.pdb
sdf file: 541751.sdf
directory: 541751

5502-96-5 C13051 NAADP Nicotinic acid adenine dinucleotide phosphate
pdb file: 583000.pdb
sdf file: 583000.sdf
directory: 583000

112720-95-3 (27 SODIUM IONS) AIDS-000144 AIDS000144 NSC613671 Oligophosphorothioate nucleotide S-dC28 Oligonucleotide Phosphorothioate S-dC28: Oligonucleotide Phosphorothioate
pdb file: 594848.pdb
sdf file: 594848.sdf
directory: 594848

5'-TCGTCGCTGTCTCCGCTTCTTCCTGCCA-3' Phosphorothioate oligonucleotide (28-mer) AIDS-000145 AIDS000145 NSC613672 S-.alpha.rev S-Anti-rev28
pdb file: 594849.pdb
sdf file: 594849.sdf
directory: 594849

104053-06-7 5'-ACACCCAATTCTGAAAATGG-3' ACACCCAATTCTGAAAATGG AIDS-000367 AIDS000367 ANTISENSE OLIGO TO HIV-1 5349-5368 Guanosine, 2'-deoxyadenylyl-(3'.5')-2'-deoxycytidylyl-(3'.5')-2'-deoxyadenylyl-(3'.5')-2'-deoxycytidylyl-(3'.5')-2'-deoxycytidylyl-(3'.5')-2'-deoxycytidylyl-(3'.5')-2'-deoxyadenylyl-(3'.5')-2'-deoxyadenylyl-(3'.5')-thymidylyl-(3'.5')-thymidylyl-(3'.5')-2'-deoxycytidylyl-(3'.5')-thymidylyl-(3'.5')-2'-deoxyguanylyl-(3'.5')-2'-deoxyadenylyl-(3'.5')-2'-deoxyadenylyl-(3'.5')-2'-deoxyadenylyl-(3'.5')-2'-deoxyadenylyl-(3'.5')-thymidylyl-(3'.5')-2'-deoxyguanylyl-(3'.5')-2'-deoxy- Oligonucleotide
pdb file: 595042.pdb
sdf file: 595042.sdf
directory: 595042

124630-96-2 5'-ACACCCAATTCTGAAAATGG-3' Oligonucleotide (mismatched) 5'-GCAGGCAAACCATTTGAATG-3' AIDS-000494 AIDS000494 Guanosine, 2'-deoxyguanylyl-(3'-5')-2'-deoxycytidylyl-(3'-5')-2'-deoxyadenylyl-(3'-5')-2'-deoxyguanylyl-(3'-5')-2'-deoxyguanylyl-(3'-5')-2'-deoxycytidylyl-(3'-5')-2'-deoxyadenylyl-(3'-5')-2'-deoxyadenylyl-(3'-5')-2'-deoxyadenylyl-(3'-5')-2'-deoxycytidylyl-(3'-5')-2'-deoxycytidylyl-(3'-5')-2'-deoxyadenylyl-(3'-5')-thymidylyl-(3'-5')-thymidylyl-(3'-5')-thymidylyl-(3'-5')-2'-deoxyguanylyl-(3'-5')-2'-deoxyadenylyl-(3'-5')-2'-deoxyadenylyl-(3'-5')-thymidylyl-(3'-5')-2'-deoxy- Phosphodiester Scrambled oligonucleotide
pdb file: 595136.pdb
sdf file: 595136.sdf
directory: 595136

124630-95-1 5'-GCAGGCAAACCATTTGAATG-3' 5'-GCAGGCAAACCATTTGAATG-3' Phosphorothioate (scrambled oligonucleotide) 5'-GCAGGCAAACCATTTGAATG-3' Phosphorothioate oligodeoxynucleotide (mismatched) AIDS-000496 AIDS000496 Guanosine, 2'-deoxy-P-thioguanylyl-(3'-5')-2'-deoxy-P-thiocytidylyl-(3'-5')-2'-deoxy-P-thioadenylyl-(3'-5')-2'-deoxy-P-thioguanylyl-(3'-5')-2'-deoxy-P-thioguanylyl-(3'-5')-2'-deoxy-P-thiocytidylyl-(3'-5')-2'-deoxy-P-thioadenylyl-(3'-5')-2'-deoxy-P-thioadenylyl-(3'-5')-2'-deoxy-P-thioadenylyl-(3'-5')-2'-deoxy-P-thiocytidylyl-(3'-5)-2'-deoxy-P-thiocytidylyl-(3'-5')-2'-deoxy-P-thioadenylyl-(3'-5')-P-thiothymidylyl-(3'-5')-P-thiothymidylyl-(3'-5')-P-thiothymidylyl-(3'-5')-2'-deoxy-P-thioguanylyl-(3'-5')-2'-deoxy-P-thioadenylyl-(3'-5')-2'-deoxy-P-thioadenylyl-(3'-5')-P-thiothymidylyl-(3'-5')-2'-deoxy
pdb file: 595137.pdb
sdf file: 595137.sdf
directory: 595137

117871-17-7 5'-GCGTACTCACCAGTCGCCGC-3' AIDS-000497 AIDS000497 GCGTACTCACCAGTCGCCGC Phosphorothioate oligodeoxynucleotide Guanosine, 2'-deoxy-P-thiocytidylyl-(5'-3')-2'-deoxy-P-thioguanylyl-(5'-3')-2'-deoxy-P-thiocytidylyl-(5'-3')-2'-deoxy-P-thiocytidylyl-(5'-3')-2'-deoxy-P-thioguanylyl-(5'-3')-2'-deoxy-P-thiocytidylyl-(5'-3')-P-thiothymidylyl-(5'-3')-2'-deoxy-P-thioguanylyl-(5'-3')-2'-deoxy-P-thioadenylyl-(5'-3')-2'-deoxy-P-thiocytidylyl-(5'-3')-2'-deoxy-P-thiocytidylyl-(5'-3')-2'-deoxy-P-thioadenylyl-(5'-3')-2'-deoxy-P-thiocytidylyl-(5'-3')-P-thiothymidylyl-(5'-3')-2'-deoxy-P-thiocytidylyl-(5'-3')-2'-deoxy-P-thioadenylyl-(5'-3')-P-thiothymidylyl-(5'-3')-2'-deoxy-P-thioguanylyl-(5'-3')-2'-deoxy-P-thiocytidylyl-(5'-3')-2'-deoxy- HIV-1 Binding Site 280-299
pdb file: 595138.pdb
sdf file: 595138.sdf
directory: 595138

-CGAGATAATGTTCACACAAC Phosphorothioate oligodeoxynucleotide 117871-20-2 5'-CGAGATAATGTTCACACAAC-3' 5'-CGAGATAATGTTCACACAAC-3' Phosphorothioate (mismatched/scrambled) AIDS-000498 AIDS000498 Cytidine, 2'-deoxy-P-thiocytidylyl-(3'-5')-2'-deoxy-P-thioguanylyl-(3'-5')-2'-deoxy-P-thioadenylyl-(3-5')-2'-deoxy-P-thioguanylyl-(3-5')-2'-deoxy-P-thioadenylyl-(3'-5')-P-thiothymidylyl-(3'-5')-2'-deoxy-P-thioadenylyl-(3'-5')-2'-deoxy-P-thioadenylyl-(3'-5')-P-thiothymidylyl-(3'-5')-2'-deoxy-P-thioguanylyl-(3'-5')-P-thiothymidylyl-(3'-5')-P-thiothymidylyl-(3'-5')-2'-deoxy-P-thiocytidylyl-(3'-5')-2'-deoxy-P-thioadenylyl-(3'-5')-2'-deoxy-P-thiocytidylyl-(3'-5')-2'-deoxy-P-thioadenylyl-(3'-5')-2'-deoxy-P-thiocytidylyl-(3'-5')-2'-deoxy-P-thioadenylyl-(3'-5')-2'-deoxy-P-thioadenylyl-(3'-5')-2'-deoxy
pdb file: 595139.pdb
sdf file: 595139.sdf
directory: 595139

117909-61-2 5'-TTTTTTTTTTTTTTTTTTTT-3' 5'-TTTTTTTTTTTTTTTTTTTT-3' Phosphorothioate oligonucleotide AIDS-000499 AIDS000499 S-dT20 Thymidine, P-thiothymidylyl-(3'.5')-P-thiothymidylyl-(3'.5')-P-thiothymidylyl-(3'.5')-P-thiothymidylyl-(3'.5')-P-thiothymidylyl-(3'.5')-P-thiothymidylyl-(3'.5')-P-thiothymidylyl-(3'.5')-P-thiothymidylyl-(3'.5')-P-thiothymidylyl-(3'.5')-P-thiothymidylyl-(3'.5')-P-thiothymidylyl-(3'.5')-P-thiothymidylyl-(3'.5')-P-thiothymidylyl-(3'.5')-P-thiothymidylyl-(3'.5')-P-thiothymidylyl-(3'.5')-P-thiothymidylyl-(3'.5')-P-thiothymidylyl-(3'.5')-P-thiothymidylyl-(3'.5')-P-thiothymidylyl-(3'.5')- dT20
pdb file: 595140.pdb
sdf file: 595140.sdf
directory: 595140

117909-59-8 5'-AAAAAAAAAAAAAAAAAAAA-3' 5'-AAAAAAAAAAAAAAAAAAAA-3' Phosphorothioate oligonucleotide AIDS-000500 AIDS000500 Adenosine, 2'-deoxy-P-thioadenylyl-(3'-5')-2'-deoxy-P-thioadenylyl-(3-5')-2'-deoxy-P-thioadenylyl-(3-5')-2'-deoxy-P-thioadenylyl-(3'-5')-2'-deoxy-P-thioadenylyl-(3'5')-2'-deoxy-P-thioadenylyl-(3'.5')-2'-deoxy-P-thioadenylyl-(3'-5')-2'-deoxy-P-thioadenylyl-(3'-5')-2'-deoxy-P-thioadenylyl-(3'-5')-2'-deoxy-P-thioadenylyl-(3'-5)-2'-deoxy-P-thioadenylyl-(3'-5')-2'-deoxy-P-thioadenylyl-(3'-5')-2'-deoxy-P-thioadenylyl-(3'-5')-2'-deoxy-P-thioadenylyl-(3'-5')-2'-deoxy-P-thioadenylyl-(3'-5')-2'-deoxy-P-thioadenylyl-(3'-5')-2'-deoxy-P-thioadenylyl-(3'-5')-2'-deoxy-P-thioadenylyl-(3-5')-2'-deoxy-P-thioadenylyl-(3'-5')-2'-deoxy- d(A20) S-Oligo
pdb file: 595141.pdb
sdf file: 595141.sdf
directory: 595141

2-5A Analog AIDS-000501 AIDS000501 Adenosine-2',5'-phosphorothioate-nucleotide-trimer
pdb file: 595142.pdb
sdf file: 595142.sdf
directory: 595142

5'-Cholesteryl phosphorothiocytidine AIDS-002463 AIDS002463 Chol-SdC10 Nucleotide deriv.
pdb file: 596947.pdb
sdf file: 596947.sdf
directory: 596947

136088-27-2 AIDS-003064 AIDS003064 Cholestane, deoxyribonucleic acid deriv. Cholesteryl oligonucleotide Cholesteryl oligonucleotide(pTGGCGTACTCACCAGTCGCCGC) DNA, d(T-G-G-C-G-T-A-C-T-C-A-C-C-A-G-T-C-G-C-C-G-C), 5'-[(3.bETA.)-cholest-5-en-3-yl hydrogen phosphate]
pdb file: 597523.pdb
sdf file: 597523.sdf
directory: 597523

130237-40-0 AIDS-003065 AIDS003065 DNA, d(T-G-G-C-G-T-A-C-T-C-A-C-C-A-G-T-C-G-C-C-G-C), 5'-(hydrogen octadecylphosphoramidate) Octadecamine oligonucleotide Octadecamine oligonucleotide(pTGGCGTACTCACCAGTCGCCGC)
pdb file: 597524.pdb
sdf file: 597524.sdf
directory: 597524

1,2-Diaminopropane oligonucleotide(pTGGCGTACTCACCAGTCGCCGC) 130237-37-5 2NH2(C3) oligonucleotide AIDS-003066 AIDS003066 DNA, d(T-G-G-C-G-T-A-C-T-C-A-C-C-A-G-T-C-G-C-C-G-C), 5'-[hydrogen (2-aminopropyl)phosphoramidate]
pdb file: 597525.pdb
sdf file: 597525.sdf
directory: 597525

130237-39-7 4-(N-Methyl-N-(2-chloroethyl)amino)-benzylamine oligonucleotide(pTGGCGTACTCACCAGTCGCCGC) AIDS-003067 AIDS003067 DNA, d(T-G-G-C-G-T-A-C-T-C-A-C-C-A-G-T-C-G-C-C-G-C), 5'-[hydrogen [[4-[(2-chloroethyl)methylamino]phenyl]methyl]phosphoramidate] MeClEtNBzNH2 oligonucleotide
pdb file: 597526.pdb
sdf file: 597526.sdf
directory: 597526

-Rev 7811 - 7828 18-mer Oligonucleotides complementary to HIV-1 SF-2 Rev Response element(Bases 7811-7828) 5'-CACTGCGCCCATAGTGCT-3' AIDS-003629 AIDS003629
pdb file: 598061.pdb
sdf file: 598061.sdf
directory: 598061

-Rev 7813-7830 5'-GACACTGCGCCCATAGTG-3' 5'-GACACTGCGCCCATAGTG-3';18-mer Oligonucleotides complementary to HIV-1 SF-2 Rev Response element (Bases 7813-7830) AIDS-003630 AIDS003630
pdb file: 598062.pdb
sdf file: 598062.sdf
directory: 598062

-Rev 7815-7832 18-mer Oligonucleotides complementary to HIV-1 SF-2 Rev Response element (Bases 7815-7832) 5'-ATAGACACTGCGCCCATAG-3' AIDS-003631 AIDS003631
pdb file: 598063.pdb
sdf file: 598063.sdf
directory: 598063

-Rev 7817-7834 5'CAATGACACTGCGCCCAT-3' 5'CAATGACACTGCGCCCAT-3';18-mer Oligonucleotides complementary to HIV-1 SF-2 Rev Response element (Bases 7817-7834) AIDS-003632 AIDS003632
pdb file: 598064.pdb
sdf file: 598064.sdf
directory: 598064

-Rev 7819-7836 18-mer Oligonucleotides complementary to HIV-1 SF-2 Rev Response element (Bases 7819-7836) 5'-GTCAATGACACTGCGCCC-3' AIDS-003633 AIDS003633
pdb file: 598065.pdb
sdf file: 598065.sdf
directory: 598065

-Rev 7821-7838 18-mer Oligonucleotides complementary to HIV-1 SF-2 Rev Response element (Bases 7821-7838) 5'-AGCGTCAATGACACTGCGC-3' 5'AGCGTCAATGACACTGCGC-3' AIDS-003634 AIDS003634
pdb file: 598066.pdb
sdf file: 598066.sdf
directory: 598066

-Rev 7823-7840 5'-CAGCGTCAATGACACTGC-3' 5'-CAGCGTCAATGACACTGC-3';18-mer Oligonucleotides complementary to HIV-1 SF-2 Rev Response element (Bases 7823-7840) AIDS-003635 AIDS003635
pdb file: 598067.pdb
sdf file: 598067.sdf
directory: 598067

-Rev 7824-7841 5'-TCAGCGTCAATGACACTG-3' 5'-TCAGCGTCAATGACACTG-3';18-mer Oligonucleotides complementary to HIV-1 SF-2 Rev Response element (Bases 7824-7841) AIDS-003636 AIDS003636
pdb file: 598068.pdb
sdf file: 598068.sdf
directory: 598068

-Rev 7828-7845 18-mer Oligonucleotides complementary to HIV-1 SF-2 Rev Response element (Bases 7828-7845) 5'-ACCGTCAGCGTCAATGAC-3' AIDS-003637 AIDS003637
pdb file: 598069.pdb
sdf file: 598069.sdf
directory: 598069

-Rev 7832-7849 18-mer Oligonucleotides complementary to HIV-1 SF-2 Rev Response element (Bases 7832-7849) 5'-TGTACCGTCAGCGTCAA-3' AIDS-003638 AIDS003638
pdb file: 598070.pdb
sdf file: 598070.sdf
directory: 598070

-Rev 7793-7810 5'-TCCTGCTGCTCCCAAGAA-3' 5'-TCCTGCTGCTCCCAAGAA-3';18-mer Oligonucleotides complementary to HIV-1 SF-2 Rev Response element (Bases 7793-7810) AIDS-003639 AIDS003639
pdb file: 598071.pdb
sdf file: 598071.sdf
directory: 598071

-Rev 7849-7866 5'-GACAATAATTGTCTGGCC-3' 5'-GACAATAATTGTCTGGCC-3';18-mer Oligonucleotides complementary to HIV-1 SF-2 Rev Response element (Bases 7849-7866) AIDS-003640 AIDS003640
pdb file: 598072.pdb
sdf file: 598072.sdf
directory: 598072

-Rev 7867-7884 18-mer Oligonucleotides complementary to HIV-1 SF-2 Rev Response element (Bases 7867-7884) 5'-TGCTGTTGCACTATACCA-3' AIDS-003641 AIDS003641
pdb file: 598073.pdb
sdf file: 598073.sdf
directory: 598073

-Rev 7877-7894 18-mer Oligonucleotides complementary to HIV-1 SF-2 Rev Response element(Bases 7877-7894) 5'-CAAATTGTTCTGCTGTTG-3' AIDS-003642 AIDS003642
pdb file: 598074.pdb
sdf file: 598074.sdf
directory: 598074

-Rev 7907-7924 18-mer Oligonucleotides complementary to HIV-1 SF-2 Rev Response element(Bases 7907-7924) 5'-CAGATGTTGTTGCGCCTC-3' AIDS-003643 AIDS003643
pdb file: 598075.pdb
sdf file: 598075.sdf
directory: 598075

-Rev 7934-7951 18-mer Oligonucleotides complementary to HIV-1 SF-2 Rev Response element(Bases 7934-7951) 5'-CTTGATGCCCCAGACTGT-3' AIDS-003644 AIDS003644
pdb file: 598076.pdb
sdf file: 598076.sdf
directory: 598076

-Rev 7954-7971 18-mer Oligonucleotides complementary to HIV-1 SF-2 Rev Response element(Bases 7954-7971) 5'-ACTCTTGCCTGGAGCTGC-3' AIDS-003645 AIDS003645
pdb file: 598077.pdb
sdf file: 598077.sdf
directory: 598077

-Rev 7972-7989 18-mer Oligonucleotides complementary to HIV-1 SF-2 Rev Response element(Bases 7972-7989) 5'-AGGTATCTTTCCACAGCC-3' AIDS-003646 AIDS003646
pdb file: 598078.pdb
sdf file: 598078.sdf
directory: 598078

-Rev 7991-8008 18-mer Oligonucleotides complementary to HIV-1 SF-2 Rev Response element(Bases 7991-8008) 5'-AGGGAGCTGTTGATCCCT-3' AIDS-003647 AIDS003647
pdb file: 598079.pdb
sdf file: 598079.sdf
directory: 598079

AIDS-003757 AIDS003757 DNA deriv. Synthetic polynucleotide d(C - C - C - C - C - C - C - C - C - C - C - C - C - C - C)
pdb file: 598182.pdb
sdf file: 598182.sdf
directory: 598182

AIDS-003758 AIDS003758 Dithioate DNA deriv. Synthetic polynucleotide d(CxCxCxCxCxCxCxCxCxCxCxCxCxC)
pdb file: 598183.pdb
sdf file: 598183.sdf
directory: 598183

AIDS-003759 AIDS003759 Dithioate DNA deriv. Synthetic polynucleotide d(CxCpCxCpCxCpCxCpCxCpCxCpCxCpC)
pdb file: 598184.pdb
sdf file: 598184.sdf
directory: 598184

AIDS-003760 AIDS003760 Dithioate DNA deriv. Synthetic polynucleotide d(TxTxTxTxTxTxTxTxTxTxTxTxTxT)
pdb file: 598185.pdb
sdf file: 598185.sdf
directory: 598185

AIDS-003761 AIDS003761 Dithioate DNA deriv. Synthetic polynucleotide d(AxAxAxAxAxAxAxAxAxAxAxAxAxA)
pdb file: 598186.pdb
sdf file: 598186.sdf
directory: 598186

AIDS-003762 AIDS003762 Dithioate DNA deriv. Synthetic polynucleotide d(CxCxCxCxCxCxCxCxCxCxCxCxCxCxCxCxCxCxCxC)
pdb file: 598187.pdb
sdf file: 598187.sdf
directory: 598187

5'-dC dC dC dC dC dC dC dC dC dC dC dCdC dC-3' and 3'-rI rI rI rI rI rI rI rI rI rI rI rI rI rI rI rI rI rI rI rI rI rI rI rI I rI rI rI -5' AIDS-004811 AIDS004811 Deoxycytidine 14 mer oligonucleotide [(dC)14], duplex with polyriboinosine [Poly(rl)] Poly(rl):(dC)14
pdb file: 600473.pdb
sdf file: 600473.sdf
directory: 600473

.beta.-D-Deoxycytidine phosphorothioate 14 mer oligonucleotide [S(dC)14], duplex with Poly(rl) 5'-dC sC sC sC sC sC sC sC sC sC sC sC sC sC-3' and 3'-rI rI rI rI rI rI rI rI rI rI rI rI rI rI rI rI rI rI rI rI rI rI rI rI Ir rI rI rI-5' AIDS-004812 AIDS004812 Poly(rl).S(dC)14
pdb file: 600474.pdb
sdf file: 600474.sdf
directory: 600474

.alpha.-D-Deoxycytidine phosphorothioate 14-mer oligonucleotide [[S(d.alpha.C)14], duplex with Poly(rl) 5'-xC xC xC xC xC xC xC xC xC xC xC xC xC xC-3' and 3' rI rI rI rI rI rI rI rI rI rI rI rI rI rI rI rI rI rI rI rI rI rI rI rI rI rI rI rI -5' AIDS-004813 AIDS004813 Poly(rl).S(d.alpha.C)14
pdb file: 600475.pdb
sdf file: 600475.sdf
directory: 600475

5'-dC sC sC sC sC sC sC sC sC sC sC sC sC sC-3' AIDS-004818 AIDS004818 Deoxycytidine phosphorothioate 14 mer oligonucleotide, [S(dC)14] S(dC)14 S-dC14
pdb file: 600480.pdb
sdf file: 600480.sdf
directory: 600480

.alpha.-Deoxycytidine phosphorothioate 14 mers oligonucleotide, S(d.alpha.C)14 5'-xC xC xC xC xC xC xC xC xC xC xC xC xC xC-3' AIDS-004819 AIDS004819 S(d.alpha.C)14
pdb file: 600481.pdb
sdf file: 600481.sdf
directory: 600481

5'-rC sC sC sC sC sC sC sC sC sC sC sC-3' AIDS-004820 AIDS004820 Cytidine phosphorothioate 14 mer oligonucleotide, S(rC)14 S(rC)14
pdb file: 600482.pdb
sdf file: 600482.sdf
directory: 600482

20 mers Oligoribonucleotide, Phosphodiester 5'-ACA CCC AAU UCU GAA AAU GG-3' AIDS-005072 AIDS005072 Oligoribonucleotide complementary to tat splice acceptor site 5358
pdb file: 600731.pdb
sdf file: 600731.sdf
directory: 600731

5'-A sC sA sC sC sC sA sA sU sU sC sU sG sA sA sA sA sU sG sG-3' ACA CCC AAU UCU GAA AAU GG ACA CCC AAU UCU GAA AAU GG 20 mer Oligoribonucleotide, Phosphorothioate AIDS-005073 AIDS005073 Oligoribonucleotide complementary to tat splice acceptor site 5358
pdb file: 600732.pdb
sdf file: 600732.sdf
directory: 600732

5'-CCA UUU UCA GAA UUG GGU GU-3- AIDS-005074 AIDS005074 CCA UUU UCA GAA UUG GGU GU 20 mers Oligoribonucleotide, Phosphodiester Oligoribonucleotide homologous to tat splice acceptor site 5358 (sense strand control)
pdb file: 600733.pdb
sdf file: 600733.sdf
directory: 600733

5'-C sC sA sU sU sU sU sC sA sG sA sA sU sU sG sG sG sU sG sU-3' AIDS-005075 AIDS005075 CCA UUU UCA GAA UUG GGU GU CCA UUU UCA GAA UUG GGU GU 20-mer Oligoribonucleotide, Phosphorothioate Oligoribonucleotide homologous to tat splice acceptor site 5358 (sense strand control)
pdb file: 600734.pdb
sdf file: 600734.sdf
directory: 600734

5'-CGA UAC GAU ACG AUA CGA UU-3' 20 mers Oligoribonucleotide, Phosphodiester 5'CGA UAC GAU ACG AUA CGA UU-3' mismatched control oligoribonucleotide AIDS-005076 AIDS005076
pdb file: 600735.pdb
sdf file: 600735.sdf
directory: 600735

5-C sG sA sU sA sC sG sA sU sA sC sG sA sU sA sC sG sA sU sU-3' AIDS-005077 AIDS005077 CGA UAC GAU ACG AUA CGA UU 20 mers Oligoribonucleotide, Phosphorothioate CGA UAC GAU ACG AUA CGA UU mismatched control oligoribonucleotide
pdb file: 600736.pdb
sdf file: 600736.sdf
directory: 600736

(3-5)-Octadecylamine conjugated oligonucleotide(pTGCCTGGAGCTGCTTGATGC) AIDS-005361 AIDS005361 MR-20 Oligonucleotide-lipophilic group
pdb file: 601018.pdb
sdf file: 601018.sdf
directory: 601018

(3-5)-Hexadecylaminoacetate conjugated oligonucleotide(pTGCCTGGAGCTGCTTGATGC) AIDS-005362 AIDS005362 MR-20 Oligonucleotide-lipophilic group
pdb file: 601019.pdb
sdf file: 601019.sdf
directory: 601019

AIDS-005363 AIDS005363 MR-20 Oligonucleotide-lipophilic group Monopalmitoyl propylene diamine conjugated oligonucleotide(pTGCCTGGAGCTGCTTGATGC)
pdb file: 601020.pdb
sdf file: 601020.sdf
directory: 601020

(3-5')-Cholesterylamino acetate conjugated oligonucleotide(pTGCCTGGAGCTGCTTGATGC) AIDS-005364 AIDS005364 MR-20 Oligonucleotide-cholesterol deriv.
pdb file: 601021.pdb
sdf file: 601021.sdf
directory: 601021

5'-d[ASp(CTCCGCTTCTTCCTGCCAT)]-3' phosphorothioate oligonucleotide AIDS-005452 AIDS005452 S-ODNs-tat S-ODNs-tat-sa
pdb file: 601108.pdb
sdf file: 601108.sdf
directory: 601108

5'-d[TSp(CTCCGCTTCTTCCTGCCAT)]-3' phosphorothioate oligodeoxynucleotide AIDS-005458 AIDS005458 S-ODNs-rev S-ODNs-rev-ts
pdb file: 601114.pdb
sdf file: 601114.sdf
directory: 601114

AIDS-006047 AIDS006047 S1-5-S2 Tethered Oligonucleotide Probe (TOP), S1-5-S2
pdb file: 601692.pdb
sdf file: 601692.sdf
directory: 601692

AIDS-006048 AIDS006048 S2-5-S1 Tethered Oligonucleotide Probe (TOP), S2-5-S1
pdb file: 601693.pdb
sdf file: 601693.sdf
directory: 601693

AIDS-006049 AIDS006049 S1-1-S2 Tethered Oligonucleotide Probe (TOP), S1-1-S2
pdb file: 601694.pdb
sdf file: 601694.sdf
directory: 601694

AIDS-006050 AIDS006050 S3-5-S1 Tethered Oligonucleotide Probe (TOP), S3-5-S1
pdb file: 601695.pdb
sdf file: 601695.sdf
directory: 601695

18-Mer Oligonucleotide, S1EXT AIDS-006051 AIDS006051 CTGTACCGTCAGCGTCAT S1EXT
pdb file: 601696.pdb
sdf file: 601696.sdf
directory: 601696

18-Mer Oligonucleotide, S2EXT AIDS-006052 AIDS006052 GACGCTGCGCCCATAGTG S2EXT
pdb file: 601697.pdb
sdf file: 601697.sdf
directory: 601697

5'-d[TTGGGGTT]-3' Phosphorothioate oligonucleotide AIDS-025503 AIDS025503 DBM-2246 ISIS 5320 Oligonucleotide 5320 T2G4T2 TTGGGGTT
pdb file: 611155.pdb
sdf file: 611155.sdf
directory: 611155

5'-ACA CCC AAT TCT GAA AAT GG-3' 5'-ACA CCC AAT TCT GAA AAT GG-3' Phosphorothiate oligonucleotide AIDS-052040 AIDS052040
pdb file: 621098.pdb
sdf file: 621098.sdf
directory: 621098

5'-dTTTGGGTT-3', phosphorothioate oligodeoxynucleotide AIDS-058965 AIDS058965 TTTGGGTT, phosphorothioate
pdb file: 623048.pdb
sdf file: 623048.sdf
directory: 623048

5'-d[GGGGTT]-3', phosphorothioate oligodeoxynucleotide AIDS-058966 AIDS058966 ISIS 5952 dGGGGTT, phosphorothioate
pdb file: 623049.pdb
sdf file: 623049.sdf
directory: 623049

5'-d[GGGGT]-3', phosphorothioate oligodeoxynucleotide AIDS-058967 AIDS058967 ISIS 4943 dGGGGT, phosphorothioate
pdb file: 623050.pdb
sdf file: 623050.sdf
directory: 623050

5'-d[GGGG]-3', phosphorothioate oligodeoxynucleotide AIDS-058968 AIDS058968 ISIS 4803 dGGGG, phosphorothioate
pdb file: 623051.pdb
sdf file: 623051.sdf
directory: 623051

5'-d[TTGGGG]-3', phosphorothioate oligodeoxynucleotide AIDS-058969 AIDS058969 ISIS 5739 dTTGGGG, phosphorothioate
pdb file: 623052.pdb
sdf file: 623052.sdf
directory: 623052

5'-d[TGGGG]-3', phosphorothioate oligodeoxynucleotide AIDS-058970 AIDS058970 ISIS 5544 dTGGGG, phosphorothioate
pdb file: 623053.pdb
sdf file: 623053.sdf
directory: 623053

5'-dTGGGGT-3', phosphorothioate oligodeoxynucleotide AIDS-058971 AIDS058971 ISIS 5804 TGGGGT, phosphorothioate
pdb file: 623054.pdb
sdf file: 623054.sdf
directory: 623054

5'-d[TGTGTGTG]-3', phosphorothioate oligodeoxynucleotide AIDS-058972 AIDS058972 ISIS 6071 dTGTGTGTG, phosphorothioate
pdb file: 623055.pdb
sdf file: 623055.sdf
directory: 623055

5'-d[TTGGGGTT]-3', phosphorothioate oligodeoxynucleotide (,alpha.) AIDS-058974 AIDS058974 ISIS 7282 dTTGGGGTT (.alpha.), phosphorothioate
pdb file: 623057.pdb
sdf file: 623057.sdf
directory: 623057

5'-dTTGGGGTT-3' 5'-dTTGGGGTT-3', phosphorothioate oligodeoxynucleotide & Thymidine, 3'-azido-3'-deoxy- AIDS-058975 AIDS058975 ISIS 5320 & AZT
pdb file: 623058.pdb
sdf file: 623058.sdf
directory: 623058

3'-TGGCGTACTCACCAGTCGCCGC-5' AIDS-059474 AIDS059474 HIV-1 donor splice site, Nucleotides 278-290
pdb file: 623529.pdb
sdf file: 623529.sdf
directory: 623529

1,2-Diaminopropane-oligonucleotides AIDS-059479 AIDS059479 Targeted to Poly-A and Donor splice site
pdb file: 623534.pdb
sdf file: 623534.sdf
directory: 623534

AIDS-059480 AIDS059480 Control Oligonucleotide, may form 10 bp with 7388-7403 Octyldecylamino-TGACCCTCTTCCCATT
pdb file: 623535.pdb
sdf file: 623535.sdf
directory: 623535

1,2-Diaminopropane-GAGACCGAGA AIDS-059481 AIDS059481 Control oligonucleotide
pdb file: 623536.pdb
sdf file: 623536.sdf
directory: 623536

AIDS-059496 AIDS059496 Dithioate DNA deriv. Synthetic polynucleotide d(CxCxCxCxCxCxCxCxCxC)
pdb file: 623549.pdb
sdf file: 623549.sdf
directory: 623549

AIDS-059497 AIDS059497 Dithioate DNA deriv. Synthetic polynucleotide d(CxCxCxCxCxCxCxC)
pdb file: 623550.pdb
sdf file: 623550.sdf
directory: 623550

AIDS-059498 AIDS059498 Dithioate DNA deriv. Synthetic polynucleotide d(CxCxCxC)
pdb file: 623551.pdb
sdf file: 623551.sdf
directory: 623551

AIDS-059992 AIDS059992 Deoxyadenosine phosphorothioate 5 mers oligonucleotide, [S(dA)5] S-(dA)5
pdb file: 624011.pdb
sdf file: 624011.sdf
directory: 624011

AIDS-059993 AIDS059993 Deoxyadenosine phosphorothioate 14 mers oligonucleotide, [S(dA)14] S-(dA)14
pdb file: 624012.pdb
sdf file: 624012.sdf
directory: 624012

AIDS-059994 AIDS059994 Deoxyadenosine phosphorothioate 28 mers oligonucleotide, [S(dA)28] S-(dA)28
pdb file: 624013.pdb
sdf file: 624013.sdf
directory: 624013

AIDS-059996 AIDS059996 Deoxycytidine phosphorothioate 18 mers oligonucleotide, [S(dC)18] S-(dC)18 S-dC18
pdb file: 624015.pdb
sdf file: 624015.sdf
directory: 624015

AIDS-059997 AIDS059997 Deoxycytidine phosphorothioate 21 mers oligonucleotide, [S(dC)21] S-(dC)21 S-dC21
pdb file: 624016.pdb
sdf file: 624016.sdf
directory: 624016

AIDS-061007 AIDS061007 Cholesteryl-conjugated oligonucleotide d(AsCsAsCsCsCsAsAsTsTsCsTsGsAsAsAsAsTsG^G) (^= cholesteryl conjugate)
pdb file: 624878.pdb
sdf file: 624878.sdf
directory: 624878

5'-GCTCCCGGGCTCGACC-3' AIDS-070597 AIDS070597 Anti-TAR oligonucleotide d(5'-GCTCCCGGGCTCGACC-3')
pdb file: 625950.pdb
sdf file: 625950.sdf
directory: 625950

.Alpha.-d(5'-CCAGCTCGGGCCCTCG-3') 5'-aC aC AA aG aC aT aC aG aG aG aC aC aC aT aC aG-3' AIDS-070598 AIDS070598 Alpha-anomeric parallel-binding analog of d(5'-GCTCCCGGGCTCGACC-3') Anti-TAR oligonucleotide
pdb file: 625951.pdb
sdf file: 625951.sdf
directory: 625951

5'-G sC sT sC sC sC sG sG sG sC sT sC sG sA sC sC-3' AIDS-070599 AIDS070599 Anti-TAR oligonucleotide d(5'-GCTCCCGGGCTCGACC-3') phosphorothioate oligonucleotide
pdb file: 625952.pdb
sdf file: 625952.sdf
directory: 625952

5'-pnG pnC pnT pnC pnC pnC pnG pnG pnG pnC pnT pnC pnG pnA pnC pnC-3' AIDS-070600 AIDS070600 Anti-TAR peptide nucleic acid oligonucleotide PNA Peptide Nucleic Acid (5'-GCTCCCGGGCTCGACC-3')
pdb file: 625953.pdb
sdf file: 625953.sdf
directory: 625953

2'-O-Methyl (5'-GCTCCCGGGCTCGACC-3') 5'-omG omC omT omC omC omC omG omG omG omC omT omC omG omA omC omC-3' AIDS-070601 AIDS070601 Anti-TAR 2'-O-methyl oligonucleotide
pdb file: 625954.pdb
sdf file: 625954.sdf
directory: 625954

5'-G npC npT npC npC npC npG npG npG npC npT npC npG npA npC npC-3' AIDS-070602 AIDS070602 Anti-TAR oligonucleotide d(5'-GCTCCCGGGCTCGACC-3') phosphoramidate oligonucleotide
pdb file: 625955.pdb
sdf file: 625955.sdf
directory: 625955

5'-G mpC mpT mpC mpC mpC mpG mpG mpG mpC mpT mpC mpG mpA mpC mpC 3' AIDS-070603 AIDS070603 Anti-TAR oligonucleotide d(5'-GCTCCCGGGCTCGACC-3') methylphosphonate oligonucleotide
pdb file: 625956.pdb
sdf file: 625956.sdf
directory: 625956

5'-A sC sG sT sA SC sG sT sA sC sG sT sA sC sG sT sA sC sG sT sA sC sG sT sA-3' 5'-d(N25)-3' Random sequence phophorothioate oligonucleotide AIDS-071308 AIDS071308 Mismatched oligo
pdb file: 626630.pdb
sdf file: 626630.sdf
directory: 626630

5'-G sT GGTTGGTGGGTTGG sT-3' AIDS-071358 AIDS071358 T30677 Oligonucleotide d(GTGGTTGGTGGGTTGGT) Oligonucleotide (phosphorothioate first/last linkages)
pdb file: 626679.pdb
sdf file: 626679.sdf
directory: 626679

5'-G sG GTGGGTGGGTGGG sT-3' AIDS-071359 AIDS071359 T30695 d(GGGTGGGTGGGTGGGT) Oligonucleotide (phosphorothioate first/last linkages)
pdb file: 626680.pdb
sdf file: 626680.sdf
directory: 626680

5'-CTGTACCG-3' AIDS-071968 AIDS071968 CTGTACCG S1 Tethered Oligonucleotide Probe (TOP), S1
pdb file: 627235.pdb
sdf file: 627235.sdf
directory: 627235

5'-GCGCCCA-3' AIDS-071969 AIDS071969 GCGCCCA, S2 Tethered Oligonucleotide Probe (TOP), S2
pdb file: 627236.pdb
sdf file: 627236.sdf
directory: 627236

5'-ATAGCCCT-3' AIDS-071970 AIDS071970 ATAGCCCT S3 Tethered Oligonucleotide Probe (TOP), S3
pdb file: 627237.pdb
sdf file: 627237.sdf
directory: 627237

5'-CTGTACCG-3' and 5'-ATAGCCCT-3' AIDS-071971 AIDS071971 S1 & S3 Tethered Oligonucleotide Probe (TOP), S1+S3
pdb file: 627238.pdb
sdf file: 627238.sdf
directory: 627238

5'-CTGTACCG-3' and 5'-GCGCCCA-3' AIDS-071972 AIDS071972 S1 & S2 Tethered Oligonucleotide Probe (TOP), S1+S2
pdb file: 627239.pdb
sdf file: 627239.sdf
directory: 627239

146-14-5 AIDS-073164 AIDS073164 Adenine-flavindinucleotide Adenosine 5'-(trihydrogenpyrophosphate), 5'.fwdarw.5'-ester with riboflavine FAD Flamitajin B Flavineadenosine diphosphate Flavitan NSC112207 Riboflavin 5'-adenosinediphosphate
pdb file: 628336.pdb
sdf file: 628336.sdf
directory: 628336

5'-GCATCAAGCAGCTCCAGGCA-3' AIDS-080318 AIDS080318 RM-20 Oligonucleotide group Unmodified oligonucleotide group(p-GCATCAAGCAGCTCCAGGCA)
pdb file: 629053.pdb
sdf file: 629053.sdf
directory: 629053

(3-5)Octadecylamide conjugated oligonucleotide(p-GCATCAAGCAGCTCCAGGCA) AIDS-080319 AIDS080319 RM-20 Ologonucleotide-lipophilic group
pdb file: 629054.pdb
sdf file: 629054.sdf
directory: 629054

(3-5)Hexadecylaminoacetate conjugated oligonucleotide(p-GCATCAAGCAGCTCCAGGCA) AIDS-080320 AIDS080320 RM-20 Oligonucleotide-lipophlic group
pdb file: 629055.pdb
sdf file: 629055.sdf
directory: 629055

AIDS-080321 AIDS080321 Monopalmitoyl propylene diamine conjugated disonucleotide(p-GCATCAAGCAGCTCCAGGCA) RM-20 Oligonucleotide-lipophilic group
pdb file: 629056.pdb
sdf file: 629056.sdf
directory: 629056

(3-5')-Cholesterylamino acetate compound oligonucleotide(p-GCATCAACAGCTCCAGGCA) AIDS-080322 AIDS080322 RM-20 Oligonucleotide-cholesterol deriv.
pdb file: 629057.pdb
sdf file: 629057.sdf
directory: 629057

AIDS-080323 AIDS080323 GCATCAAGCAGCTCCAGGCA MR-20 Oligonucleotide group Unmodified oligonucleotide group (p-GCATCAAGCAGCTCCAGGCA)
pdb file: 629058.pdb
sdf file: 629058.sdf
directory: 629058

(3-5)Hexadecylaminoacetate conjugated oligonucleotide (p-TTTTTTTTTTTTTTTT) 16T Oligonucleotide group AIDS-080324 AIDS080324
pdb file: 629059.pdb
sdf file: 629059.sdf
directory: 629059

16T Oligonucleotide-lipophilic group AIDS-080325 AIDS080325 Monopalmitoyl propylene diamine conjugated oligonucleotide (p-TTTTTTTTTTTTTTTT)
pdb file: 629060.pdb
sdf file: 629060.sdf
directory: 629060

(3-5')-Cholesterylamino acetate compound oligonucleotide (p-TTTTTTTTTTTTTTTT) 16T Oligonucleotide-cholesterol deriv. AIDS-080326 AIDS080326
pdb file: 629061.pdb
sdf file: 629061.sdf
directory: 629061

AIDS-080327 AIDS080327 FOS-20 Oligonucleotide group TTGAAACCCGAGAACATCAT Unmodified oligonucleotide group (p-TTGAAACCCGAGAACATCAT)
pdb file: 629062.pdb
sdf file: 629062.sdf
directory: 629062

(3-5)Octadecylamide conjugated oligonucleotide(p-TTGAAACCCGAGAACATCAT) AIDS-080328 AIDS080328 FOS-20 Oligonucleotide-lipophilic group
pdb file: 629063.pdb
sdf file: 629063.sdf
directory: 629063

(3-5)Hexadecylaminoacetate conjugated oligonucleotide(p-TTGAAACCCGAGAACATCAT) AIDS-080329 AIDS080329 FOS-20 Oligonucleotide-lipophilic group
pdb file: 629064.pdb
sdf file: 629064.sdf
directory: 629064

AIDS-080330 AIDS080330 FOS-20 Oligonucleotide-lipophilic group Monopalmitoyl propylene diamine conjugated disonucleotide(p-TTGAAACCCGAGAACATCAT)
pdb file: 629065.pdb
sdf file: 629065.sdf
directory: 629065

(3-5')-Cholesterylamino acetate conjugated oligonucleotide(p-TTGAAACCCGAGAACATCAT) AIDS-080331 AIDS080331 FOS-20 Oligonucleotide-cholesterol deriv.
pdb file: 629066.pdb
sdf file: 629066.sdf
directory: 629066

AIDS-080332 AIDS080332 CTCCGCTTCT REV-10 Oligonucleotide group Unmodified ologonucleotide (p-CTCCGCTTCT)
pdb file: 629067.pdb
sdf file: 629067.sdf
directory: 629067

(3-5)Octadecylamide conjugated oligonucleotide (p-CTCCGCTTCT) AIDS-080333 AIDS080333 REV-10 Oligonucleotide-lipophilic group
pdb file: 629068.pdb
sdf file: 629068.sdf
directory: 629068

(3-5)Hexadecylaminoacetate conjugated oligonucleotide (p-CTCCGCTTCT) AIDS-080334 AIDS080334 REV-10 Oligonucleotide-lipophilic group
pdb file: 629069.pdb
sdf file: 629069.sdf
directory: 629069

AIDS-080335 AIDS080335 Monopalmitoyl propylene diamine conjugated disonucleotide(p-CTCCGCTTCT) REV-10 Oligonucleotide-lipophilic group
pdb file: 629070.pdb
sdf file: 629070.sdf
directory: 629070

(3-5')-Cholesterylamino acetate conjugated oligonucleotide(p-CTCCGCTTCT) AIDS-080336 AIDS080336 REV-10 Oligonucleotide-cholesterol deriv.
pdb file: 629071.pdb
sdf file: 629071.sdf
directory: 629071

5'-d[TTGGGGTG]-3' Phosphorothioate oligonucleotide 5'-d[TTGGGGTG]-3', (Phosphorothioate) AIDS-080413 AIDS080413
pdb file: 629148.pdb
sdf file: 629148.sdf
directory: 629148

5'-d[TTGGGGTC]-3' Phosphorothioate oligonucleotide 5'-d[TTGGGGTC]-3', (Phosphorothioate) AIDS-080415 AIDS080415
pdb file: 629150.pdb
sdf file: 629150.sdf
directory: 629150

198155-93-0 5'-C sC sC sT sG St St Sc Sg Sg Sg Sc Sg Sc Sc A-3' AIDS-081443 AIDS081443 AS(Lys) Antisense to primer tRNA(lys3) Phosphorothioate oligonucleotide CCC TGT TCG GGC GCC A
pdb file: 630074.pdb
sdf file: 630074.sdf
directory: 630074

198155-94-1 5'-C sA sG sA sC sT sT sT sT sA sA sT sC sT sG-3' AIDS-081444 AIDS081444 Anticodon Antisense to anticodon of primer tRNA(lys3) Phosphorothioate oligonucleotide CAG ACT TTT AAT CTG
pdb file: 630075.pdb
sdf file: 630075.sdf
directory: 630075

198155-95-2 5'-C sT sC sA sG sT sC sG sG sT sA sG sA sG-3' AIDS-081445 AIDS081445 Antisense to diHU of primer tRNA(lys3) Phosphorothioate oligonucleotide CTC AGT CGG TAG AG diHU
pdb file: 630076.pdb
sdf file: 630076.sdf
directory: 630076

198155-96-3 5'-A sG sG sG sT sT sC sA sA sG sT sC sC sC sT-3' AIDS-081446 AIDS081446 Antisense to Pseudo-U of primer tRNA(lys3) Phosphorothioate oligonucleotide AGG GTT CAA GTC CCT Pseudo-U
pdb file: 630077.pdb
sdf file: 630077.sdf
directory: 630077

198155-97-4 5'-C sC sC sT sG sT sT sC sA sA sA sC sG sC sC sA-3' AIDS-081447 AIDS081447 Mismatched AS(Lys) (101) Phosphorothioate oligonucleotide CCC TGT TCA AAC GCC A mismatched antisense to primer tRNA(lys3)
pdb file: 630078.pdb
sdf file: 630078.sdf
directory: 630078

198155-98-5 5'-T sT sT sT sG sT sT sC sG sG sG sC sG sC sC sA-3' AIDS-081652 AIDS081652 Mismatched AS(Lys) (103) Phosphorothioate oligonucleotide TTT TGT TCG GGC GCC A mismatched antisense to primer tRNA(lys3)
pdb file: 630283.pdb
sdf file: 630283.sdf
directory: 630283

.delta.CCA (104) 198155-99-6 5'-C sC sC sT sG sT sT sC sG sG sG sC sG-3' AIDS-081653 AIDS081653 Phosphorothioate oligonucleotide CCC TGT TCG GGC G mismatched antisense to primer tRNA(lys3)
pdb file: 630284.pdb
sdf file: 630284.sdf
directory: 630284

198156-00-2 5'-A sC sC sG sC sG sG sG sC sT sT sG sT sC sC sC-3' AIDS-081654 AIDS081654 INV-AS(Lys) Phosphorothioate oligonucleotide A CCG CGG GCT TGT CCC inverted sequence antisense control oligo to primer tRNA(lys3)
pdb file: 630285.pdb
sdf file: 630285.sdf
directory: 630285

198156-01-3 5'-C sT sC sG sC sT sG sC sG sA sC sC sG sT sG sC-3' AIDS-081655 AIDS081655 Phosphorothioate oligonucleotide CTC GCT GCG ACC GTG C Scrambled AS(Lys) (106) scrambled antisense to primer tRNA(lys3)
pdb file: 630286.pdb
sdf file: 630286.sdf
directory: 630286

198156-02-4 5'-C sC sG sG sG sC sG sG sA sA sA sC sA sC sC sA-3' AIDS-081656 AIDS081656 AS(Val) Antisense to bovine tRNA(val) Phosphorothioate oligonucleotide CCG GGC GGA AAC ACC A antisense oligo to primer domain of bovine tRNA(val)
pdb file: 630287.pdb
sdf file: 630287.sdf
directory: 630287

17-mer Oliginucleotide 5'-GTGGTGGGTGGGTGGGT-3' AIDS-084979 AIDS084979 I 100-15 T30175
pdb file: 631333.pdb
sdf file: 631333.sdf
directory: 631333

9-((R)-2-Phosphonomethoxypropyl)adenine)-Acyclovir monophosphate dinucleotide ACVpPMPA AIDS-085623 AIDS085623 Acyclovir-PMPA heterodinucleotide
pdb file: 631967.pdb
sdf file: 631967.sdf
directory: 631967

5'-(3,4-Dibenzyloxybenzyl-d(TGGGAG)-3'-phosphate, hydroxyethyl ester AIDS-086239 AIDS086239 Phospphodiester hexadeoxyribonucleotide R-95288
pdb file: 632553.pdb
sdf file: 632553.sdf
directory: 632553

5'-CTCTCGCACCCATCTCTCTCCTTCTGGAG-3' AIDS-086803 AIDS086803 CTCTCGCACCCATCTCTCTCCTTCTGGAG Phosphorothioate oligonucleotide
pdb file: 633068.pdb
sdf file: 633068.sdf
directory: 633068

5'-CTCTCGCACCCATCTCTCTCCTTCTGGAGAG-3' AIDS-086804 AIDS086804 CTCTCGCACCCATCTCTCTCCTTCTGGAGAG Phosphorothioate oligonucleotide
pdb file: 633069.pdb
sdf file: 633069.sdf
directory: 633069

5'-CTCTCGCACCCATCTCTCTCCTTCTGGAGAGAG-3' AIDS-086805 AIDS086805 CTCTCGCACCCATCTCTCTCCTTCTGGAGAGAG Phosphorothioate oligonucleotide
pdb file: 633070.pdb
sdf file: 633070.sdf
directory: 633070

5'-CTCTCGCACCCATCTCTCTCCTTCTGGAGAGAGAT-3' AIDS-086806 AIDS086806 CTCTCGCACCCATCTCTCTCCTTCTGGAGAGAGAT Phosphorothioate oligonucleotide
pdb file: 633071.pdb
sdf file: 633071.sdf
directory: 633071

5'-CTCTCGCACCCATCTCTCTCCTTCTGGGTGCGAGAG-3' AIDS-086807 AIDS086807 CTCTCGCACCCATCTCTCTCCTTCTGGGTGCGAGAG Phosphorothioate oligonucleotide
pdb file: 633072.pdb
sdf file: 633072.sdf
directory: 633072

5'-CTCTCGCACCCATCTCTCTCCTTCTAGCCTCCGCT-3' AIDS-087122 AIDS087122 CTCTCGCACCCATCTCTCTCCTTCTAGCCTCCGCT Phosphorothioate oligonucleotide
pdb file: 633376.pdb
sdf file: 633376.sdf
directory: 633376

5'-CTCTCGCACCCATCTCTCTCCTTCTTTTTTTTTTT-3' AIDS-087125 AIDS087125 CTCTCGCACCCATCTCTCTCCTTCTTTTTTTTTTT Phosphorothioate oligonucleotide
pdb file: 633379.pdb
sdf file: 633379.sdf
directory: 633379

5'-TTGTCCTCCTTGCGGGA-3' AIDS-087140 AIDS087140 TTGTCCTCCTTGCGGGA Phosphorothioate oligonucleotide
pdb file: 633394.pdb
sdf file: 633394.sdf
directory: 633394

5'-d[C-Sp(CCCCCCCCCCCCCCCCCCCC)]-3' Phosphorothioate oligonucleotide AIDS-087141 AIDS087141 S-dC20
pdb file: 633395.pdb
sdf file: 633395.sdf
directory: 633395

5'-GCGTCTTCATTGTGCGAGCA -3' AIDS-087142 AIDS087142 GCGTCTTCATTGTGCGAGCA Phosphorothioate oligonucleotide
pdb file: 633396.pdb
sdf file: 633396.sdf
directory: 633396

5'-TCCGGCCCGCGGCGGAAGCA-3' AIDS-087143 AIDS087143 TCCGGCCCGCGGCGGAAGCA Phosphorothioate oligonucleotide
pdb file: 633397.pdb
sdf file: 633397.sdf
directory: 633397

5'-GAAGCACCTGCCCTGTGGTA-3' AIDS-087144 AIDS087144 GAAGCACCTGCCCTGTGGTA Phosphorothioate oligonucleotide
pdb file: 633398.pdb
sdf file: 633398.sdf
directory: 633398

5'-GCGTCCTCCTTGCAGGAGCA-3' AIDS-087145 AIDS087145 GCGTCCTCCTTGCAGGAGCA Phosphorothioate oligonucleotide
pdb file: 633399.pdb
sdf file: 633399.sdf
directory: 633399

5'-TCCTCCTTGCAGGAGCAGCT-3' AIDS-087146 AIDS087146 TCCTCCTTGCAGGAGCAGCT Phosphorothioate oligonucleotide
pdb file: 633400.pdb
sdf file: 633400.sdf
directory: 633400

5'-TCCTTGCAGGAGCAGCTCCG-3' AIDS-087147 AIDS087147 TCCTTGCAGGAGCAGCTCCG Phosphorothioate oligonucleotide
pdb file: 633401.pdb
sdf file: 633401.sdf
directory: 633401

5'-CTTTCCCCGAGTAAGCACAA-3' AIDS-087148 AIDS087148 CTTTCCCCGAGTAAGCACAA Phosphorothioate oligonucleotide
pdb file: 633402.pdb
sdf file: 633402.sdf
directory: 633402

5'-CCCCGGGACTAGGGTTGTAG-3' AIDS-087149 AIDS087149 CCCCGGGACTAGGGTTGTAG Phosphorothioate oligonucleotide
pdb file: 633403.pdb
sdf file: 633403.sdf
directory: 633403

5'-AGCCGCGTACCGTCGGCTACG-3' AGCCGCGTACCGTCGGCTACG Phosphorothioate oligonucleotide AIDS-087150 AIDS087150
pdb file: 633404.pdb
sdf file: 633404.sdf
directory: 633404

5'-GGGCGTGGGCGTGGGCG-3' AIDS-087151 AIDS087151 GGGCGTGGGCGTGGGCG Phosphorothioate oligonucleotide
pdb file: 633405.pdb
sdf file: 633405.sdf
directory: 633405

5'-CCTCCTCCTTGCGGGAG-3' AIDS-087152 AIDS087152 CCTCCTCCTTGCGGGAG Phosphorothioate oligonucleotide
pdb file: 633406.pdb
sdf file: 633406.sdf
directory: 633406

5'-CACGGAAGGGCGTCCTCCTT-3' AIDS-087153 AIDS087153 CACGGAAGGGCGTCCTCCTT Phosphorothioate oligonucleotide
pdb file: 633407.pdb
sdf file: 633407.sdf
directory: 633407

5'-TTGCGGGAGCAGCTCCGCTG-3' AIDS-087154 AIDS087154 TTGCGGGAGCAGCTCCGCTG Phosphorothioate oligonucleotide
pdb file: 633408.pdb
sdf file: 633408.sdf
directory: 633408

5'-AGGGCGTCCTCCTTGCAGGA-3' AGGGCGTCCTCCTTGCAGGA Phosphorothioate oligonucleotide AIDS-087155 AIDS087155
pdb file: 633409.pdb
sdf file: 633409.sdf
directory: 633409

5'-TTGCGCCCACTCGGGGGAGG-3' AIDS-087156 AIDS087156 TTGCGCCCACTCGGGGGAGG Phosphorothioate oligonucleotide
pdb file: 633410.pdb
sdf file: 633410.sdf
directory: 633410

5'-TGGGCA-3' AIDS-087161 AIDS087161 TGGGCA Phosphorothioate oligonucleotide
pdb file: 633415.pdb
sdf file: 633415.sdf
directory: 633415

5'-TGGACG-3' AIDS-087162 AIDS087162 TGGACG Phosphorothioate oligonucleotide
pdb file: 633416.pdb
sdf file: 633416.sdf
directory: 633416

5'-TGAGCG-3' AIDS-087163 AIDS087163 TGAGCG Phosphorothioate oligonucleotide
pdb file: 633417.pdb
sdf file: 633417.sdf
directory: 633417

5'-TAGGCG-3' AIDS-087164 AIDS087164 TAGGCG Phosphorothioate oligonucleotide
pdb file: 633418.pdb
sdf file: 633418.sdf
directory: 633418

AIDS-087165 AIDS087165 CGCCCA Phosphorothioate oligonucleotide
pdb file: 633419.pdb
sdf file: 633419.sdf
directory: 633419

AIDS-087166 AIDS087166 CTCCCG Phosphorothioate oligonucleotide
pdb file: 633420.pdb
sdf file: 633420.sdf
directory: 633420

5'-GAGGGT-3' AIDS-087167 AIDS087167 GAGGGT Phosphorothioate oligonucleotide
pdb file: 633421.pdb
sdf file: 633421.sdf
directory: 633421

5'-ATGGAGCG-3' AIDS-087168 AIDS087168 ATGGAGCG Phosphorothioate oligonucleotide
pdb file: 633422.pdb
sdf file: 633422.sdf
directory: 633422

5'-ATGAGGCG-3' AIDS-087169 AIDS087169 ATGAGGCG Phosphorothioate oligonucleotide
pdb file: 633423.pdb
sdf file: 633423.sdf
directory: 633423

5'-TCCTCCTGG-3' AIDS-087170 AIDS087170 TCCTCCTGG Phosphorothioate oligonucleotide
pdb file: 633424.pdb
sdf file: 633424.sdf
directory: 633424

5'-GAGTGGGCA-3' AIDS-087171 AIDS087171 GAGTGGGCA Phosphorothioate oligonucleotide
pdb file: 633425.pdb
sdf file: 633425.sdf
directory: 633425

5'-GAGTGAGCG-3' AIDS-087172 AIDS087172 GAGTGAGCG Phosphorothioate oligonucleotide
pdb file: 633426.pdb
sdf file: 633426.sdf
directory: 633426

5'-GAGTGGACG-3' AIDS-087173 AIDS087173 GAGTGGACG Phosphorothioate oligonucleotide
pdb file: 633427.pdb
sdf file: 633427.sdf
directory: 633427

5'-GAGTGGTCG-3' AIDS-087174 AIDS087174 GAGTGGTCG Phosphorothioate oligonucleotide
pdb file: 633428.pdb
sdf file: 633428.sdf
directory: 633428

5'-GAGTAGGCG-3' AIDS-087175 AIDS087175 GAGTAGGCG Phosphorothioate oligonucleotide
pdb file: 633429.pdb
sdf file: 633429.sdf
directory: 633429

5'-GAGTGGTTG-3' AIDS-087176 AIDS087176 GAGTGGTTG Phosphorothioate oligonucleotide
pdb file: 633430.pdb
sdf file: 633430.sdf
directory: 633430

5'-TTCCTCCTGCGG-3' AIDS-087177 AIDS087177 TTCCTCCTGCGG Phosphorothioate oligonucleotide
pdb file: 633431.pdb
sdf file: 633431.sdf
directory: 633431

5'-CCCCGAGTGGACG-3' AIDS-087178 AIDS087178 CCCCGAGTGGACG Phosphorothioate oligonucleotide
pdb file: 633432.pdb
sdf file: 633432.sdf
directory: 633432

5'-CGGGCG-3' AIDS-087179 AIDS087179 CGGGCG Phosphorothioate oligonucleotide
pdb file: 633433.pdb
sdf file: 633433.sdf
directory: 633433

5'-GTGGGAG-3' AIDS-087180 AIDS087180 GTGGGAG Phosphorothioate oligonucleotide
pdb file: 633434.pdb
sdf file: 633434.sdf
directory: 633434

5'-GCGGGCG-3' AIDS-087181 AIDS087181 GCGGGCG Phosphorothioate oligonucleotide
pdb file: 633435.pdb
sdf file: 633435.sdf
directory: 633435

5'-ATTGGGCG-3' AIDS-087182 AIDS087182 ATTGGGCG Phosphorothioate oligonucleotide
pdb file: 633436.pdb
sdf file: 633436.sdf
directory: 633436

5'-ATCGGGCG-3' AIDS-087183 AIDS087183 ATCGGGCG Phosphorothioate oligonucleotide
pdb file: 633437.pdb
sdf file: 633437.sdf
directory: 633437

5'-AGTGGGAG-3' AGTGGGAG Phosphorothioate oligonucleotide AIDS-087184 AIDS087184
pdb file: 633438.pdb
sdf file: 633438.sdf
directory: 633438

5'-TGCGGGCG-3' AIDS-087185 AIDS087185 TGCGGGCG Phosphorothioate oligonucleotide
pdb file: 633439.pdb
sdf file: 633439.sdf
directory: 633439

5'-AGCGGGCG-3' AGCGGGCG Phosphorothioate oligonucleotide AIDS-087186 AIDS087186
pdb file: 633440.pdb
sdf file: 633440.sdf
directory: 633440

5'-TGTGGGAG-3' AIDS-087187 AIDS087187 TGTGGGAG Phosphorothioate oligonucleotide
pdb file: 633441.pdb
sdf file: 633441.sdf
directory: 633441

5'-GAGTGGGTG-3' AIDS-087193 AIDS087193 GAGTGGGTG Phosphorothioate oligonucleotide
pdb file: 633447.pdb
sdf file: 633447.sdf
directory: 633447

5'-CTAGGGGCG-3' AIDS-087194 AIDS087194 CTAGGGGCG Phosphorothioate oligonucleotide
pdb file: 633448.pdb
sdf file: 633448.sdf
directory: 633448

5'-TTTTGGGCG-3' AIDS-087195 AIDS087195 TTTTGGGCG Phosphorothioate oligonucleotide
pdb file: 633449.pdb
sdf file: 633449.sdf
directory: 633449

5'-GGGTGGGCG-3' AIDS-087196 AIDS087196 GGGTGGGCG Phosphorothioate oligonucleotide
pdb file: 633450.pdb
sdf file: 633450.sdf
directory: 633450

5'-TGGTGGGCG-3' AIDS-087197 AIDS087197 TGGTGGGCG Phosphorothioate oligonucleotide
pdb file: 633451.pdb
sdf file: 633451.sdf
directory: 633451

5'-GTGTGGGCG-3' AIDS-087198 AIDS087198 GTGTGGGCG Phosphorothioate oligonucleotide
pdb file: 633452.pdb
sdf file: 633452.sdf
directory: 633452

5'-TTGTGGGCG-3' AIDS-087199 AIDS087199 TTGTGGGCG Phosphorothioate oligonucleotide
pdb file: 633453.pdb
sdf file: 633453.sdf
directory: 633453

5'-TAGCGGGCG-3' AIDS-087200 AIDS087200 TAGCGGGCG Phosphorothioate oligonucleotide
pdb file: 633454.pdb
sdf file: 633454.sdf
directory: 633454

5'-GTGAGGGCG-3' AIDS-087201 AIDS087201 GTGAGGGCG Phosphorothioate oligonucleotide
pdb file: 633455.pdb
sdf file: 633455.sdf
directory: 633455

5'-TAGTGGGCG-3' AIDS-087202 AIDS087202 TAGTGGGCG Phosphorothioate oligonucleotide
pdb file: 633456.pdb
sdf file: 633456.sdf
directory: 633456

5'-GGGCGTGGGCG-3' AIDS-087203 AIDS087203 GGGCGTGGGCG Phosphorothioate oligonucleotide
pdb file: 633457.pdb
sdf file: 633457.sdf
directory: 633457

5'-GGGCGTTGGGCG-3' AIDS-087204 AIDS087204 GGGCGTTGGGCG Phosphorothioate oligonucleotide
pdb file: 633458.pdb
sdf file: 633458.sdf
directory: 633458

5'-GGGCGTTTGGGCG-3' AIDS-087205 AIDS087205 GGGCGTTTGGGCG Phosphorothioate oligonucleotide
pdb file: 633459.pdb
sdf file: 633459.sdf
directory: 633459

5'-GGGCGTGTGGGCG-3' AIDS-087206 AIDS087206 GGGCGTGTGGGCG Phosphorothioate oligonucleotide
pdb file: 633460.pdb
sdf file: 633460.sdf
directory: 633460

5'-TTTTTTTTGGGCG-3' AIDS-087207 AIDS087207 TTTTTTTTGGGCG Phosphorothioate oligonucleotide
pdb file: 633461.pdb
sdf file: 633461.sdf
directory: 633461

5'-TTTTTTTTTTGGGCG-3' AIDS-087208 AIDS087208 TTTTTTTTTTGGGCG Phosphorothioate oligonucleotide
pdb file: 633462.pdb
sdf file: 633462.sdf
directory: 633462

5'-TCCTCCTTGCGGGAG-3' AIDS-087209 AIDS087209 TCCTCCTTGCGGGAG Phosphorothioate oligonucleotide
pdb file: 633463.pdb
sdf file: 633463.sdf
directory: 633463

AIDS-087935 AIDS087935 Antisense oligonucleotide (5'-TCTCCGCTTCTTCCTGCCAT-3'), 5550-5569 O-ODN-rev
pdb file: 634164.pdb
sdf file: 634164.sdf
directory: 634164

AIDS-087936 AIDS087936 Phosphorothioate oligonucleotide (5'-TsCsTsCsCsGsCsTsTsCsTsTsCsCsTsGsCsCsAsT-3') S-ODN-rev
pdb file: 634165.pdb
sdf file: 634165.sdf
directory: 634165

AIDS-087937 AIDS087937 Phosphorothioate oligonucleotide (5'-TsCsTCCGCTTCTTCCTGCCsAsT-3') SO-ODN-rev
pdb file: 634166.pdb
sdf file: 634166.sdf
directory: 634166

AIDS-087938 AIDS087938 Phosphorothioate modified antisense oligonucleotide (5'-GsGsAsGsAsTsGsCsCsTsAsAsGsGsCsTsTsTsTsG-3'), 5529-5548 S-ODN-rev-sa
pdb file: 634167.pdb
sdf file: 634167.sdf
directory: 634167

AIDS-087939 AIDS087939 Phosphorothioate modified oligonucleotide(5'-CsCsTsCsTsAsCsGsGsAsTsTsCsCsGsAsAsAsAsC-3') S-ODN-rev-sa-sense
pdb file: 634168.pdb
sdf file: 634168.sdf
directory: 634168

AIDS-087940 AIDS087940 Phosphorothioate modified mismatched oligonucleotide(5'-CsCsTsGsTsAsCsGsCsAsTsTsCsCsCsAsAsTsAsC-3') S-ODN-rev-sa-mis
pdb file: 634169.pdb
sdf file: 634169.sdf
directory: 634169

AIDS-087959 AIDS087959 Antisense phosphorothioate oligonucleotides(5'-sAsCsAsCsCsCsAsAsTsTsCsTsGsAsAsAsAsTsGsG-3') SA-20
pdb file: 634183.pdb
sdf file: 634183.sdf
directory: 634183

AIDS-087960 AIDS087960 Antisense phosphorothioate oligonucleotides(5'-sGsCsTsAsTsGsTsCsGsAsCsAsCsCsCsAsAsTsTsCsTsGsAsAsA-3') SA-25
pdb file: 634184.pdb
sdf file: 634184.sdf
directory: 634184

AIDS-087961 AIDS087961 Antisense phosphorothioate oligonucleotides(5'-sGsTsCsGsAsCsAsCsCsCsAsAsTsTsCsTsGsAsAsAsAsTsGsGsAsTsAsA-3') SA-28
pdb file: 634185.pdb
sdf file: 634185.sdf
directory: 634185

AIDS-087962 AIDS087962 Antisense phosphorothioate oligonucleotides(5'-sCsGsCsTsCsTsCsGsCsAsCsCsCsAsTsCsTsCsTsCsCsCsTsTsCsTsA-3') gag-28
pdb file: 634186.pdb
sdf file: 634186.sdf
directory: 634186

AIDS-087963 AIDS087963 Antisense phosphorothioate oligonucleotides(5'-sCsTsCsTsCsGsCsAsCsCsCsAsTsCsTsCsTsCsCsCsTsTsC-3') gag-24
pdb file: 634187.pdb
sdf file: 634187.sdf
directory: 634187

AIDS-087964 AIDS087964 Antisense phosphorothioate oligonucleotides(5'-sTsCsGsTsCsGsCsTsGsTsCsTsCsCsGsCsTsTsCsTsTsCsCsTsGsCsCsA-3') rev1-28
pdb file: 634188.pdb
sdf file: 634188.sdf
directory: 634188

AIDS-087965 AIDS087965 Antisense phosphorothioate oligonucleotides(5'-sCsTsGsTsCsTsCsCsGsCsTsTsCsTsTsCsCsTsGsCsCsAsTsAsGsGsAsG-3') rev2-28
pdb file: 634189.pdb
sdf file: 634189.sdf
directory: 634189

AIDS-087971 AIDS087971 Antisense phosphorothioate oligonucleotide with 1-propynyl at 5th position(5'-TCGTCGCTGTCTCCGCTTCTTCCTGCCA-3')
pdb file: 634195.pdb
sdf file: 634195.sdf
directory: 634195

5'-dCTCTCGCACCCATATCTCTCCTTCT-3', phosphorothioate oligodeoxynucleotide AIDS-093359 AIDS093359 GEM 91-1 mis
pdb file: 636650.pdb
sdf file: 636650.sdf
directory: 636650

5'-dCTCTCGCTCCCATATCTCACCTTCT-3', phosphorothioate oligodeoxynucleotide AIDS-093360 AIDS093360 GEM 91-3 mis
pdb file: 636651.pdb
sdf file: 636651.sdf
directory: 636651

5'-dCTATCGCTCCCATATCTCACCTGCT-3', phosphorothioate oligodeoxynucleotide AIDS-093361 AIDS093361
pdb file: 636652.pdb
sdf file: 636652.sdf
directory: 636652

5'-dCGCACCCATCTCTCTCC-3', phosphorothioate oligodeoxynucleotide AIDS-093362 AIDS093362 End-modified MBO
pdb file: 636653.pdb
sdf file: 636653.sdf
directory: 636653

2',3'-Dideoxycytidine & 5'-dCTCTCGCACCCATCTCTCTCCTTCT-3', phosphorothioate oligodeoxynucleotide AIDS-093363 AIDS093363 ddC & GEM 91
pdb file: 636654.pdb
sdf file: 636654.sdf
directory: 636654

2',3'-Dideoxycytidine & 5'-dCTCTCGCACCCATATCTCTCCTTCT-3', phosphorothioate oligodeoxynucleotide AIDS-093364 AIDS093364 ddC & GEM 91-1 mis
pdb file: 636655.pdb
sdf file: 636655.sdf
directory: 636655

2',3'-Dideoxycytidine & 5'-dCTCTCGCTCCCATATCTCACCTTCT-3', phosphorothioate oligodeoxynucleotide AIDS-093365 AIDS093365 ddC & GEM 91-3 mis
pdb file: 636656.pdb
sdf file: 636656.sdf
directory: 636656

2',3'-Dideoxycytidine & 5'-dCTATCGCTCCCATATCTCACCTGCT-3', phosphorothioate oligodeoxynucleotide AIDS-093366 AIDS093366 ddC & GEM 91-5 mis
pdb file: 636657.pdb
sdf file: 636657.sdf
directory: 636657

2',3'-Dideoxycytidine & 5'-dCGCACCCATCTCTCTCC-3', phosphorothioate oligodeoxynucleotide AIDS-093367 AIDS093367 ddC & End-modified MBO
pdb file: 636658.pdb
sdf file: 636658.sdf
directory: 636658

AIDS-093368 AIDS093368 AZT & GEM 91 Thymidine, 3'-azido-3'-deoxy & 5'-dCTCTCGCACCCATCTCTCTCCTTCT-3', phosphorothioate oligodeoxynucleotide
pdb file: 636659.pdb
sdf file: 636659.sdf
directory: 636659

3'-Deoxy-2',3'-didehydrothymidine & 5'-dCTCTCGCACCCATCTCTCTCCTTCT-3', phosphorothioate oligodeoxynucleotide AIDS-093369 AIDS093369 d4t & GEM 91
pdb file: 636660.pdb
sdf file: 636660.sdf
directory: 636660

5'-AA-3' AIDS-097587 AIDS097587 Dinucleotides
pdb file: 640436.pdb
sdf file: 640436.sdf
directory: 640436

5'-AG-3' AIDS-097589 AIDS097589 Dinucleotides
pdb file: 640438.pdb
sdf file: 640438.sdf
directory: 640438

5'-AT-3' AIDS-097590 AIDS097590 Dinucleotides
pdb file: 640439.pdb
sdf file: 640439.sdf
directory: 640439

5'-CA-3' AIDS-097591 AIDS097591 Dinucleotides
pdb file: 640440.pdb
sdf file: 640440.sdf
directory: 640440

5'-CC-3' AIDS-097592 AIDS097592 Dinucleotides
pdb file: 640441.pdb
sdf file: 640441.sdf
directory: 640441

5'-CG-3' AIDS-097593 AIDS097593 Dinucleotides
pdb file: 640442.pdb
sdf file: 640442.sdf
directory: 640442

5'-CT-3' AIDS-097594 AIDS097594 Dinucleotides
pdb file: 640443.pdb
sdf file: 640443.sdf
directory: 640443

5'-GA-3' AIDS-097595 AIDS097595 Dinucleotides
pdb file: 640444.pdb
sdf file: 640444.sdf
directory: 640444

5'-GC-3' AIDS-097596 AIDS097596 Dinucleotides
pdb file: 640445.pdb
sdf file: 640445.sdf
directory: 640445

5'-GG-3' AIDS-097597 AIDS097597 Dinucleotides
pdb file: 640446.pdb
sdf file: 640446.sdf
directory: 640446

5'-GT-3' AIDS-097598 AIDS097598 Dinucleotides
pdb file: 640447.pdb
sdf file: 640447.sdf
directory: 640447

5'-TA-3' AIDS-097599 AIDS097599 Dinucleotides
pdb file: 640448.pdb
sdf file: 640448.sdf
directory: 640448

5'-TC-3' AIDS-097600 AIDS097600 Dinucleotides
pdb file: 640449.pdb
sdf file: 640449.sdf
directory: 640449

5'-TG-3' AIDS-097601 AIDS097601 Dinucleotides
pdb file: 640450.pdb
sdf file: 640450.sdf
directory: 640450

5'-TT-3' AIDS-097602 AIDS097602 Dinucleotides
pdb file: 640451.pdb
sdf file: 640451.sdf
directory: 640451

5'-CAG-3' AIDS-097603 AIDS097603 Unphosphorylated trinucleotide
pdb file: 640452.pdb
sdf file: 640452.sdf
directory: 640452

5'-CTA-3' 5'-Unphosphorylated trinucleotides AIDS-097604 AIDS097604
pdb file: 640453.pdb
sdf file: 640453.sdf
directory: 640453

5'-pCTA-3' AIDS-097605 AIDS097605 Trinucleotides
pdb file: 640454.pdb
sdf file: 640454.sdf
directory: 640454

5'-pCAT-3' AIDS-097606 AIDS097606 Trinucleotides
pdb file: 640455.pdb
sdf file: 640455.sdf
directory: 640455

5'-pCAC-3' AIDS-097607 AIDS097607 Trinucleotides
pdb file: 640456.pdb
sdf file: 640456.sdf
directory: 640456

5'-pCAA-3' AIDS-097608 AIDS097608 Trinucleotides
pdb file: 640457.pdb
sdf file: 640457.sdf
directory: 640457

5'-CAG-3' 5'-pCAG-3' AIDS-097609 AIDS097609 Trinucleotides
pdb file: 640458.pdb
sdf file: 640458.sdf
directory: 640458

5'-pGTC-3' AIDS-097610 AIDS097610 Trinucleotides
pdb file: 640459.pdb
sdf file: 640459.sdf
directory: 640459

5'-pGTCA-3' AIDS-097611 AIDS097611 Tetranucleotides
pdb file: 640460.pdb
sdf file: 640460.sdf
directory: 640460

5'-pCAGT-3' AIDS-097612 AIDS097612 Tetranucleotides
pdb file: 640461.pdb
sdf file: 640461.sdf
directory: 640461

5'-pCTT-3' AIDS-097613 AIDS097613 Trinucleotides
pdb file: 640462.pdb
sdf file: 640462.sdf
directory: 640462

9-((R)-2-Phosphonomethoxypropyl)adenine)-Acyclovir monophosphate dinucleotide in red blood cells ACVpPMPA AIDS-108254 AIDS108254 Acyclovir-PMPA heterodinucleotide
pdb file: 645266.pdb
sdf file: 645266.sdf
directory: 645266

1,4-Dihydronicotinamide adenine dinucleotide 443892-10-2 58-68-4 Adenosine 5'-(trihydrogen diphosphate), 5'-
pdb file: 668167.pdb
sdf file: 668167.sdf
directory: 668167

13015-61-7 1674-85-7 2133-82-6 5'-Inosinic acid, 6-thio- (9CI) 53-83-8 6-Mercaptopurine ribonucleotide 6-Mercaptopurine riboside 5'-monophosphate 6-Mercaptopurine riboside 5'-phosphate 6-Mercaptopurine riboside-5-phosphate 6-Mercaptopurine ribotide 6-Thioinosine 5'-monophosphate 6-Thioinosine 5'-phosphate (VAN) 9H-Purine-6-thiol, 9-beta-D-ribofuranosyl-, 5'-(dihydrogen phosphate) (8CI) EINECS 200-183-9 NSC 520722 Thio-IMP Thioinosinic acid
pdb file: 668919.pdb
sdf file: 668919.sdf
directory: 668919

128007-95-4 Guanosine 5'-(trihydrogen diphosphate), p'-(4-(2-amino-1,4-dihydro-4-oxo-6-pteridinyl)-2-hydroxy-3,4-dimercapto-3-butenyl) ester molybdopterin guanine dinucleotide
pdb file: 698376.pdb
sdf file: 698376.sdf
directory: 698376

14922-97-5 321-02-8 7413-38-9 94628-21-4 Nicotinic acid mononucleotide Nicotinic acid ribonucleotide Pyridinium, 3-carboxy-1-(5-O-phosphono-beta-D-ribofuranosyl)-, inner salt nicotinate mononucleotide
pdb file: 698494.pdb
sdf file: 698494.sdf
directory: 698494

(3-Acetylpyridine)AD 3-Acetyl NAD 3-Acetyl-1-beta-D-ribofuranosylpyridinium hydroxide 5'ester 3-Acetylpyridine NAD 3-Acetylpyridine analog of DPN 3-Acetylpyridine diphosphopyridine nucleotide (VAN) 3-Acetylpyridine-DPN 3-Acetylpyridine-adenine dinucleotide 3-Acetylpyridineadenine dinucleotide 3-acetylpyridine adenine dinucleotide 86-08-8 AcPyAD Acetylpyridine adenine dinucleotide Acetylpyridine-adenine dinucleotide Adenosine 5'-(trihydrogen diphosphate), 5'-5'-ester with 3-acetyl-1-beta-D-ribofuranosylpyridinium hydroxide, inner salt (9CI) DPN 3-Acetylpyridine analog DPN, analogueol, 3-acetyl pyridine derivative Diphosphopyridine nucleotide, 1-(3-pyridinyl)ethanone analog Diphosphopyridine nucleotide, 3-acetylpyridine analog EINECS 201-649-4 NSC 20275 Nicotinamide acetylpyridine dinucleotide Nicotinamide-adenine dinucleotide, 3-acetyl analog Nicotinamide-hypoxanthine dinucleotide, 3-acetyl analog Pyridine, 3-acetyl-, derivative of DPN analogue beta-DPN acetylpyridine analog
pdb file: 700679.pdb
sdf file: 700679.sdf
directory: 700679

5502-96-5 Adenosine 5'-(trihydrogendiphosphate), 2'-(dihydrogen phosphate), 5'-5'-ester with 3-carboxy-1-beta-D-ribofuranosylpyridinium hydroxide, inner salt NAADP Nicotinate adenine dinucleotide phosphate Nicotinic acid adenine dinucleotide phosphate
pdb file: 700702.pdb
sdf file: 700702.sdf
directory: 700702

3'-Guanylic acid, guanylyl-(3'-5')-, cyclic 3',5'''-nucleotide 61093-23-0 Bis(3',5')-cyclic diguanylic acid Cyclic diguanylic acid Cyclic-bis(3',5')diguanylic acid c-(Gpgp) c-di-GMP cGpGp
pdb file: 701644.pdb
sdf file: 701644.sdf
directory: 701644

94516-25-3 EPDAD Pyridine 1,N(6)-ethenoadenine dinucleotide
pdb file: 701937.pdb
sdf file: 701937.sdf
directory: 701937

4-Hcpdad 4-Hydrazinocarbonylpyridine-1,N(6)-ethenoadenine dinucleotide 94516-26-4
pdb file: 701941.pdb
sdf file: 701941.sdf
directory: 701941

76573-09-6 Alanosyl-5-amino-4-imidazolecarboxylic acid ribonucleotide Alanosyl-aicor L-Alanine, N-((5-amino-1-(5-O-phosphono-beta-D-ribofuranosyl)-1H-imidazol-4-yl)carbonyl)-3-(hydroxynitrosoamino)-
pdb file: 704160.pdb
sdf file: 704160.sdf
directory: 704160

102686-21-5 3,4-Dimethylpyridine adenine dinucleotide 3,4-Dmpad Adenosine 5'-(trihydrogen diphosphate), 5'-5'-ester with 3,4-dimethyl-1-beta-D-ribofuranosylpyridinium hydroxide, inner salt
pdb file: 704766.pdb
sdf file: 704766.sdf
directory: 704766

102977-57-1 Adenosine, 5'-(hydrogen (phosphonomethyl)phosphonate), 5'-ester with 2-beta-D-ribofuranosyl-4-thiazolecarboxamide NSC 617998 beta-Methylene tad beta-Methylene thiazole-4-carboxamide adenine dinucleotide beta-Tad
pdb file: 704832.pdb
sdf file: 704832.sdf
directory: 704832

1H-Imidazole-4-carboxamide, 5-amino-1-(5-O-(hydroxy((hydroxy(phosphonooxy)phosphinyl)oxy)phosphinyl)-beta-D-ribofuranosyl)- 5-Amino-1-(5-O-(hydroxy((hydroxy(phosphonooxy)phosphinyl)oxy)phosphinyl)-beta-D-ribofuranosyl)-1H-imidazole-4-carboxamide 5-Amino-4-imidazolecarboxamide riboside 5'-triphosphate 5-Aminoimidazole-4-carboxamide-1-ribofuranosyl triphosphate 82989-82-0 ZTP Ztp nucleotide
pdb file: 705077.pdb
sdf file: 705077.sdf
directory: 705077

349-34-8 Acetamide, 2-(formylamino)-N-(5-O-phosphono-beta-D-ribofuranosyl)- Formylglycinamide ribonucleotide Formylglycineamideribotide Phosphoribosyl-N-formylglycineamide
pdb file: 707280.pdb
sdf file: 707280.sdf
directory: 707280

185229-68-9 Alicaforsen DNA, d((R)-P-thio)(G-C-C-A-A-G-C-T-G-G-C-A-T-C-C-G-T-C-A) Deoxyribonucleic acid, d((R)-P-thio)(G-C-C-C-A-A-G-C-T-G-G-C-A-T-C-C-G-T-C-A) ISIS 2302 ISIS-2302 Intercellular adhesion molecule-1 antisense oligodeoxynucleotide
pdb file: 733437.pdb
sdf file: 733437.sdf
directory: 733437

156724-91-3 Adenosine 5'-(trihydrogen diphosphate), P'-5'-ester with 3-beta-D-ribofuranosylbenzamide Benzamide adenine nucleotide
pdb file: 735819.pdb
sdf file: 735819.sdf
directory: 735819

151868-71-2 Adenosine, 5'-(hydrogen(phosphonomethyl)phosphonate), P'-5'-ester with 2-beta-D-ribofuranosyl-4-selenazolecarboxamide beta-Methylene sad beta-Methylene selenazole-4-carboxamide adenine dinucleotide beta-Sad
pdb file: 735988.pdb
sdf file: 735988.sdf
directory: 735988

(Pyridine-3-aldehyde)AD 3-Formylpyridine-adenine dinucleotide 3-Pyridine aldehyde-DPN 3-Pyridinealdehyde adenine dinucleotide 3-Pyridinealdehyde nad 3-Pyridinealdehyde-NAD 86-07-7 Adenine-nicotinaldehyde dinucleotide Adenosine 5'-(trihydrogen diphosphate), 5'-5'-ester with 3-formyl-1-beta-D-ribofuranosylpyridinium hydroxide, inner salt (9CI) Diphosphopyridine nucleotide, 3-pyridinecarboxaldehyde analog Diphosphopyridine nucleotide, nicotinaldehyde analog NSC 20270 Nicotinaldehyde-adenine dinucleotide Pyridine 3-aldehyde NAD Pyridine-3-aldehyde diphosphopyridine nucleotide Pyridine-3-aldehyde-adenine dinucleotide Pyridinecarbaldehyde adenine dinucleotide Pyridinium, 3-formyl-1-beta-D-ribofuranosyl-, hydroxide, 5'-5'-ester with adenosine 5'-(trihydrogen pyrophosphate), inner salt (8CI)
pdb file: 737910.pdb
sdf file: 737910.sdf
directory: 737910

3-Acetylpyridine-adenine dinucleotide phosphate 3-Acetylpyridine-nadp 341-67-3 Adenosine 5'-(trihydrogen diphosphate), 2'-(dihydrogen phosphate), P'-5'-ester with 3-acetyl-1-beta-D-ribofuranosylpyridinium inner salt
pdb file: 737947.pdb
sdf file: 737947.sdf
directory: 737947

3031-95-6 5'-Phosphoribosyl-4-(N-succinylcarboxamide)-5-aminoimidazole 5-Amino-4-imidazole-N-succinocarboxamide ribonucleotide N-((5-Amino-1-(5-O-phosphono-beta-D-ribofuranosyl)-1H-imidazol-4-yl)carbonyl)-L-aspartic acid N-(5-Amino-1-beta-D-ribofuranosylimidazole-4-carbonyl)-L-aspartic acid 5'-phosphate SAICAR
pdb file: 738172.pdb
sdf file: 738172.sdf
directory: 738172

10074-18-7 2-Amino-(N-D-ribofuranosyl)acetamide 5'-phosphate 5'-Phosphoribosylglycineamide Glycineamide ribonucleotide Glycineamideribotide
pdb file: 738414.pdb
sdf file: 738414.sdf
directory: 738414

5'-Guanylic acid, thymidylyl-(5'-3')-2'-deoxy-, homopolymer 55684-98-5 Poly d(G-T) Polydeoxy(guanine-thymine) nucleotide
pdb file: 740305.pdb
sdf file: 740305.sdf
directory: 740305

2',3'-Dialdehyde NADP 2',3'-Dialdehyde NADPH 2',3'-Dialdehyde TPN 2',3'-Dialdehyde nicotinamide-adenine dinucleotide phosphate 87075-47-6 Adenosine 5'-(trihydrogen diphosphate), 2'-(dihydrogen phosphate), 5'-mono(2-(1-(3-(aminocarbonyl)pyridinio)-2-oxoethoxy)-3-oxopropyl) ester, hydroxide, inner salt, (R-(R*,R*))- Dial-nadp NADPH Dialdehyde NADPH-2',3'-Dialdehyde oTPN oTPNH
pdb file: 741002.pdb
sdf file: 741002.sdf
directory: 741002

3-Aminopyridine-1,N(6)-ethenoadenine dinucleotide phosphate 87865-72-3 AADP Pyridinium, 3-amino-1-(5-O-(hydroxy(phosphonooxy)phosphinyl)-beta-D-ribofuranosyl)-, P'-5'-ester with 3-(2-O-phosphono-beta-D-ribofuranosyl)-3H-imidazo(2,1-i)purine, inner salt
pdb file: 741019.pdb
sdf file: 741019.sdf
directory: 741019

112345-60-5 Adenosine 5'-(trihydrogen diphosphate), 5'-((4-(3-(aminocarbonyl)pyridinio)-2,3-dihydroxycyclopentyl)methyl) ester, hydroxide, inner salt, (1R-(1alpha,2beta,3beta,4alpha))- Carba-NAD Carbanicotinamide adenine dinucleotide
pdb file: 741342.pdb
sdf file: 741342.sdf
directory: 741342

126609-61-8 2-Azido-NAD 2-Azidoadenosine dinucleotide 2N3NAD Adenosine 5'-(trihydrogen diphosphate), 2-azido-, P'-5'-ester with 3-(aminocarbonyl)-1-beta-D-ribofuranosylpyridinium hydroxide, inner salt Nicotinamide 2-azidoadenine dinucleotide
pdb file: 741667.pdb
sdf file: 741667.sdf
directory: 741667

1H-Imidazole-4-carboxylic acid, 5-amino-1-(5-O-phosphono-beta-D-ribofuranosyl)- 5-Amino-4-imidazolecarboxylic acid ribonucleotide 6001-14-5 AICOR Carboxy-air Carboxyaminoimidazole ribotide
pdb file: 742849.pdb
sdf file: 742849.sdf
directory: 742849

100659-17-4 100849-28-3 101123-76-6 115962-96-4 1183-79-5 1476-40-0 161395-10-4 63293-04-9 6450-77-7 81932-62-9 91918-20-6 Adenosine 5'-(trihydrogen diphosphate), P'-5'-ester with 3-carboxy-1-beta-D-ribofuranosylpyridinium inner salt Deamido-NAD Deamidonicotinamide adenine dinucleoetide Nicotinic acid adenine dinucleotide
pdb file: 742931.pdb
sdf file: 742931.sdf
directory: 742931

22052-73-9 6157-93-3 Deamino-NADH Hypnadh Inosine 5'-(trihydrogen diphosphate), P'-5'-ester with 1,4-dihydro-1-beta-D-ribofuranosyl-3-pyridinecarboxamide Nicotinamide-hypoxanthine dinucleotide Reduced nicotinamide hypoxanthine dinucleotide
pdb file: 745479.pdb
sdf file: 745479.sdf
directory: 745479

1,4,5,6-Tetrahydronicotinamide adenine dinucleotide 31172-31-3 Adenosine 5'-(trihydrogen diphosphate), 5'-5'-ester with 1,4,5,6-tetrahydro-1-beta-D- ribofuranosyl-3-pyridinecarboxamide
pdb file: 746788.pdb
sdf file: 746788.sdf
directory: 746788

34469-63-1 4482-82-0 69680-01-9 Flavin mononucleotide semiquinone Fmn semiquinone Riboflavin 5'-(dihydrogen phosphate), radical ion(1-)
pdb file: 747131.pdb
sdf file: 747131.sdf
directory: 747131

1,N(6)-Etheno-NAD 38806-38-1 Epsilon NAD Nicotinamide 1,N(6)-ethenoadenine dinucleotide Pyridinium, 3-(aminocarbonyl)-1-(5-O-(hydroxy(phosphonooxy)phosphinyl)-beta-D-ribofuranosyl)-, hydroxide, inner salt, 5'-5'-ester with 3-beta-D-ribofuranosyl-3H-imidazo(2,1-i)purine
pdb file: 747647.pdb
sdf file: 747647.sdf
directory: 747647

154591-46-5 8-(4-Bromo-2,3-dioxobutylthio)NAD 8-(4-Bromo-2,3-dioxobutylthio)nicotinamide adenine dinucleotide 8-Bdb-tnad Adenosine 5'-(trihydrogen diphosphate), 8-((4-bromo-2,3-dioxobutyl)thio)-, P'-5'-ester with 3-(aminocarbonyl)-1-beta-D-ribofuranosylpyridinium, inner salt
pdb file: 747857.pdb
sdf file: 747857.sdf
directory: 747857

3-Aminopyridine adenine dinucleotide phosphate 5'-(Trihydrogen diphosphate) 2'-(dihydrogen phosphate), 5'-5'-ester with 3-amino-1-beta-D-ribofuranosylpyridinium, hydroxide, inner salt 54758-28-0
pdb file: 748904.pdb
sdf file: 748904.sdf
directory: 748904

2'-Deoxy NAD 2'-Deoxyadenosine 5'-(trihydrogen diphosphate), 5'-5'-ester with 3-(aminocarbonyl)-1-beta- D-ribofuranosylpyridinium hydroxide, inner salt 2'-Deoxynicotinamide adenine dinucleotide 2'-Dnad 6697-37-6
pdb file: 766501.pdb
sdf file: 766501.sdf
directory: 766501

3-Azidopyridine-adenine dinucleotide 50695-15-3 Adenosine 5'-(trihydrogen diphosphate), 5-5'-ester with 3-azido-1-beta-D-ribofuranosylpyridinium hydroxide, inner salt
pdb file: 766630.pdb
sdf file: 766630.sdf
directory: 766630

42919-10-8 Adenosine 5'-(trihydrogen diphosphate), 5'-5'-ester with 3-diazonio-1-beta-D-ribofuranosylpyridinium hydroxide, inner salt Diazoaminopyridine dinucleotide
pdb file: 768608.pdb
sdf file: 768608.sdf
directory: 768608

59587-50-7 Adenosine-5'-(trihydrogen diphosphate), N-(2-aminoethyl)-, 5'-5'-ester with 3-(aminocarbonyl)-1-beta-D-ribofuranosylpyridinium hydroxide, inner salt Nicotinamide-6(2-aminoethylamino)purine dinucleotide
pdb file: 768988.pdb
sdf file: 768988.sdf
directory: 768988

68134-82-7 Adenosine 5'-(trihydrogen-diphosphate), 5'-5-ester with (S)-1,4-anhydro-1-C-phenyl-D-ribitol Phenyladenine dinucleotide
pdb file: 769289.pdb
sdf file: 769289.sdf
directory: 769289

70578-47-1 Adenosine 5'-(trihydrogen diphosphate), 2'-(dihydrogen phosphate), 5'-5'-ester with 3,4,4a,7-tetrahydro-3-hydroxy-4-octyl-7-beta-D-ribofuranosyl-2,7-naphthyridin-1(2H)-one Nadp-decanaldehyde Nicotinamide-adenine-dinucleotide phosphate decanaldehyde
pdb file: 769363.pdb
sdf file: 769363.sdf
directory: 769363

52213-58-8 Adenosine 5'-(trihydrogen diphosphate), N-(2-((6-aminohexyl)amino)-2-oxoethyl)-, 5'-5'-ester with 3-(aminocarbonyl)-1-beta-D-ribofuranosylpyridinium hydroxide, inner salt N-6-(N-(6-Aminohexyl)carbamoylmethyl)-NAD N-Acnad Nicotinamide-N(6)-(N-(6-aminohexyl)carbamoylmethyl)adenine dinucleotide
pdb file: 771222.pdb
sdf file: 771222.sdf
directory: 771222

3-Inad 3-Iodopyridine-adenine dinucleotide 56541-70-9 Adenosine 5'-(trihydrogen diphosphate), 5'-5'-ester with 3-iodo-1-beta-D-ribofuranosylpyridinium hydroxide, inner salt
pdb file: 771368.pdb
sdf file: 771368.sdf
directory: 771368

5-(3-Carboxy-3-hydroxypropyl)nicotinamide adenine dinucleotide 68889-85-0 Adenosine 5'-(trihydrogen diphosphate), 5'-5'-ester with 3-(aminocarbonyl)-5-(3-carboxy-3-hydroxypropyl)-1-beta-D-ribofuranosylpyridinium hydroxide, inner salt, (S)- S-Lac-NAD
pdb file: 771636.pdb
sdf file: 771636.sdf
directory: 771636

3-Inadp 3-Iodopyridine-adenine dinucleotide phosphate 71187-05-8 Adenosine-5'-(trihydrogen diphosphate), 2'-(dihydrogen phosphate), 5'-5'-ester with 3-iodo-1-beta-D-ribofuranosylpyridinium hydroxide, inner salt
pdb file: 771711.pdb
sdf file: 771711.sdf
directory: 771711

3'-Uridylic acid, uridylyl-(3'-5')-, cyclic nucleotide 73120-97-5 Bis(3'-5')cyclic diuridine monophosphate Cyclic bis((3'-5')uridylic acid) Cyclo(uridylyl-(3'-5')uridine monophosphate) Cyclo-upup
pdb file: 771826.pdb
sdf file: 771826.sdf
directory: 771826

110241-41-3 3-(4-(Reduced 3-pyridine aldehyde-adenine dinucleotide))pyruvate 3-RAP
pdb file: 772159.pdb
sdf file: 772159.sdf
directory: 772159

3-Aeadt 3-Aminopyridine 1,N(6)-ethenoadenine dinucleotide 82773-63-5 Pyridinium, 3- amino-1-(5-O-(hydroxy(phosphonooxy)phosphinyl)-beta-D-ribofuranosyl)-, hydroxide, inner salt, 5'-5'-ester with 3-beta-D-ribofuranosyl-3H-imidazo(2,1-i)purine
pdb file: 773451.pdb
sdf file: 773451.sdf
directory: 773451

104076-88-2 3-Benzoylpyridine-adenine dinucleotide Bz3PdAD
pdb file: 773591.pdb
sdf file: 773591.sdf
directory: 773591

66844-06-2 Adenosine 5'-(trihydrogen-diphosphate), 5'-5'-ester with 3-(aminocarbonyl)-1-beta-D-ribofuranosylpyridinium hydroxide, inner salt, dimer NAD Dimers Nicotinamide adenine dinucleotide dimers
pdb file: 773664.pdb
sdf file: 773664.sdf
directory: 773664

108646-17-9 Nicotinamide arabinoside adenine dinucleotide alpha-Naad
pdb file: 773838.pdb
sdf file: 773838.sdf
directory: 773838